Supplementary Figure 1
|
|
- Marlene McCarthy
- 5 years ago
- Views:
Transcription
1 Supplementary Figure 1 Isolation of mt-trnas and RNA-MS analysis of mt-trna Asn from M. nudus (a)m. nudus mt-trnas were isolated by RCC and resolved by 10% denaturing PAGE. The gel was stained with SYBR Gold (Invitrogen) and visualized using an FLA-7000 image analyzer (Fujifilm). The trnas as indicated by arrows were cut out of the gel and purified. (b) Top panel: base peak chromatogram (BPC) of RNase T 1 -digested fragments; second and third panel: extracted ion chromatograms (XIC) for the negative ions of the anticodon-containing fragments as indicated. Molecular mass of each fragment numbered on the BPC is listed in Supplementary Table 1. Bottom panel shows the CID spectrum of the cyanoethylated anticodon-containing fragment. The c- and y-series product ions are indicated on the CID spectrum and assigned on the corresponding sequence. (c) Secondary structure of M. nudus mt-trna Asn with post-transcriptional modifications. The numbering system of trna is based on the trna database (Juhling, F. et al., Nucleic Acids Res. 37, D159-62, 2009). m 1 A: 1- methyladenosine, m 2,2 G: N 2, N 2 -dimethylguanosine, Ψ: pseudouridine, and t 6 A: N 6 - threonylcarbamoyladenosine.
2 Supplementary Figure 2 RNA-MS analysis of M. nudus mt-trna Lys XICs of the anticodon-containing fragments with N 428 at position 37 (upper panel), t 6 A37 (lower panel). Sequence, m/z values, and charge state of each fragment are indicated on the right side. The frequency of each modification was calculated from the ratio of the peak areas of the two fragments.
3 Supplementary Figure 3 CID spectrum of t 6 A base The t 6 A base was generated by in-source fragmentation of t 6 A nucleoside in individual E. coli trna Thr4. The product ions are assigned on the chemical structure of the t 6 A base. The internal fragment of the threonine moiety is indicated by a dotted line.
4 Supplementary Figure 4 Enzymatic synthesis of Thr and 4-hydroxythreonine LtaE catalyzes an aldol condensation reaction of acetaldehyde and glycine to synthesize Thr utilizing pyridoxal phosphate (PLP) as a cofactor. LtaE catalyzes the same reaction with glycolaldehyde and glycine to form 4- hydroxythreonine.
5 Supplementary Figure 5 RPC-LC/MS co-injection analysis of the synthetic ht 6 A and natural N 428 XICs of synthetic ht 6 A (left panel), nucleosides of M. nudus mt-trna Lys (middle panel), and co-injection of both samples (right panel). Lower panels show XICs of m 1 A (m/z 298) as controls.
6 Supplementary Figure 6 CID analysis of the synthetic ht 6 A CID spectra of ht 6 A nucleoside (upper panel) and its base ion (lower panel). ht 6 A base (BH 2 + ) was generated by in-source fragmentation of ht 6 A nucleoside of E. coli trna Lys transcript bearing ht 6 A37. The product ions are assigned in the corresponding chemical structures. The internal fragment of the methyl threonine moiety is indicated by a dotted line.
7 list of DNA probes for RCC and primers Purpose Name 5' to 3' sequence probes for RCC mt trna Asn mt trna Asn probe AACGGCCAAGCGCCTTTACATTTAGCTACGACCCA mt trna Lys mt trna Lys probe TGGTCCTTAATAATAGGTATTAGCTATTTTCTTTTAAATTAAGAGTTTAA vector construction pet28a LtaE ltae fw AGTCAGTCAGTCCATATGATTGATTTACGCAGTGATAC ltae rv GACTGACTGACTCTCGAGTTAACGCGCCAGGAATG in vitro transcription E.coli trna Lys mutant trna Lys template GGGTCGTTAGCTCAGTTGGTAGAGCAGTTGACTCTTAATCAATTGGTCGCAGGTTCGAATC trna Lys fw GCTAATACGACTCACTATAGGGTCGTTAGCTCAG trna Lys rv TGGTGGGTCGTGCAGGATTCGAACCTGCG E.coli trna Ala2 trna Ala2 template AGCTCAGCTGGGAGAGCGCTTGCATGGCATGCAAGAGGTCAGCGGTTCGATCCCGCTT trna Ala2 fw GCTAATACGACTCACTATAGGGGCTATAGCTCAGCTGGGAGAG trna Ala2 rv TGGTGGAGCTAAGCGGGATCGAACCGC mrna mrna(aaa) template AGGGTTAACTTTAAGTAAGGAGGTACACTGCTAAATAACTGTAGAAAAAA mrna(aag) template AGGGTTAACTTTAAGTAAGGAGGTACACTGCTAAGTAACTGTAGAAAAAA mrna fw GCGAAATTAATACGACTCACTATAGGGTTAACTTTAAG mrna rv TTTTTTCTACAGTTA
Minutes Figure S1. HPLC separation of nucleosides from LC/ESI-MS analysis of a total enzymatic Trp
100 A % Relative Abundance m m Ø acp 5 m Øm 5 m m 7 m s * 6 ia m * 0 5 10 15 0 5 0 5 40 Minutes Figure S1. HPL separation of nucleosides from L/ESI-MS analysis of a total enzymatic digest of mt trna. V
More informationSupplementary Information
Supplementary Information Precursors of trnas are stabilized by methylguanosine cap structures Takayuki Ohira and Tsutomu Suzuki Department of Chemistry and Biotechnology, Graduate School of Engineering,
More informationreads observed in trnas from the analysis of RNAs carrying a 5 -OH ends isolated from cells induced to express
Supplementary Figure 1. VapC-mt4 cleaves trna Ala2 in E. coli. Histograms representing the fold change in reads observed in trnas from the analysis of RNAs carrying a 5 -OH ends isolated from cells induced
More informationSections 12.3, 13.1, 13.2
Sections 12.3, 13.1, 13.2 Now that the DNA has been copied, it needs to send its genetic message to the ribosomes so proteins can be made Transcription: synthesis (making of) an RNA molecule from a DNA
More informationTyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis
Supplementary information Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis Yasuyuki Yamada, Fumihiko Sato
More informationRNA (Ribonucleic acid)
RNA (Ribonucleic acid) Structure: Similar to that of DNA except: 1- it is single stranded polunucleotide chain. 2- Sugar is ribose 3- Uracil is instead of thymine There are 3 types of RNA: 1- Ribosomal
More informationDNA codes for RNA, which guides protein synthesis.
Section 3: DNA codes for RNA, which guides protein synthesis. K What I Know W What I Want to Find Out L What I Learned Vocabulary Review synthesis New RNA messenger RNA ribosomal RNA transfer RNA transcription
More informationSUPPLEMENTARY INFORMATION. An orthogonal ribosome-trnas pair by the engineering of
SUPPLEMENTARY INFORMATION An orthogonal ribosome-trnas pair by the engineering of peptidyl transferase center Naohiro Terasaka 1 *, Gosuke Hayashi 1 *, Takayuki Katoh 1, and Hiroaki Suga 1,2 1 Department
More informationSupplementary Figure 1. Amino acid sequences of GodA and GodA*. Inserted. residues are colored red. Numbers indicate the position of each residue.
Supplementary Figure 1. Amino acid sequences of GodA and GodA*. Inserted residues are colored red. Numbers indicate the position of each residue. Supplementary Figure 2. SDS-PAGE analysis of purified recombinant
More informationObjective: You will be able to explain how the subcomponents of
Objective: You will be able to explain how the subcomponents of nucleic acids determine the properties of that polymer. Do Now: Read the first two paragraphs from enduring understanding 4.A Essential knowledge:
More informationChemistry 107 Exam 4 Study Guide
Chemistry 107 Exam 4 Study Guide Chapter 10 10.1 Recognize that enzyme catalyze reactions by lowering activation energies. Know the definition of a catalyst. Differentiate between absolute, relative and
More informationNature Methods: doi: /nmeth.3177
Supplementary Figure 1 Characterization of LysargiNase, trypsin and LysN missed cleavages. (a) Proportion of peptides identified in LysargiNase and trypsin digests of MDA-MB-231 cell lysates carrying 0,
More informationThis exam consists of two parts. Part I is multiple choice. Each of these 25 questions is worth 2 points.
MBB 407/511 Molecular Biology and Biochemistry First Examination - October 1, 2002 Name Social Security Number This exam consists of two parts. Part I is multiple choice. Each of these 25 questions is
More informationBio 111 Study Guide Chapter 17 From Gene to Protein
Bio 111 Study Guide Chapter 17 From Gene to Protein BEFORE CLASS: Reading: Read the introduction on p. 333, skip the beginning of Concept 17.1 from p. 334 to the bottom of the first column on p. 336, and
More information2. Ionization Sources 3. Mass Analyzers 4. Tandem Mass Spectrometry
Dr. Sanjeeva Srivastava 1. Fundamental of Mass Spectrometry Role of MS and basic concepts 2. Ionization Sources 3. Mass Analyzers 4. Tandem Mass Spectrometry 2 1 MS basic concepts Mass spectrometry - technique
More informationProteins are sometimes only produced in one cell type or cell compartment (brain has 15,000 expressed proteins, gut has 2,000).
Lecture 2: Principles of Protein Structure: Amino Acids Why study proteins? Proteins underpin every aspect of biological activity and therefore are targets for drug design and medicinal therapy, and in
More informationSupplementary Information
Supplementary Information Archaeal Elp3 catalyzes trna wobble uridine modification at C5 via a radical mechanism Kiruthika Selvadurai, Pei Wang, Joseph Seimetz & Raven H Huang* Department of Biochemistry,
More informationBiological systems interact, and these systems and their interactions possess complex properties. STOP at enduring understanding 4A
Biological systems interact, and these systems and their interactions possess complex properties. STOP at enduring understanding 4A Homework Watch the Bozeman video called, Biological Molecules Objective:
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10962 Supplementary Figure 1. Expression of AvrAC-FLAG in protoplasts. Total protein extracted from protoplasts described in Fig. 1a was subjected to anti-flag immunoblot to detect AvrAC-FLAG
More informationDouble charge of 33kD peak A1 A2 B1 B2 M2+ M/z. ABRF Proteomics Research Group - Qualitative Proteomics Study Identifier Number 14146
Abstract The 2008 ABRF Proteomics Research Group Study offers participants the chance to participate in an anonymous study to identify qualitative differences between two protein preparations. We used
More informationISG15 sirna # Ctrl sirna+ifn+wt. Virus titer (Pfu/ml) hours post infection. d USP18 sirna #2 IFN
a ISG15 sirna Ctrl #1 #2 ISG15 conjugates IB: ISG15 Virus titer (Pfu/ml) b ISG15 sirna #2 10 7 Ctrl sirna+ifn+wt Ctrl sirna+ifn+67 10 6 ISG15 sirna+ifn+wt ISG15 sirna+ifn+67 10 5 10 4 10 3 Free ISG15 10
More informationCells and Tissues 3PART C. PowerPoint Lecture Slide Presentation by Patty Bostwick-Taylor, Florence-Darlington Technical College
PowerPoint Lecture Slide Presentation by Patty Bostwick-Taylor, Florence-Darlington Technical College Cells and Tissues 3PART C Protein Synthesis Gene DNA segment that carries a blueprint for building
More informationThe Blueprint of Life: DNA to Protein. What is genetics? DNA Structure 4/27/2011. Chapter 7
The Blueprint of Life: NA to Protein Chapter 7 What is genetics? The science of heredity; includes the study of genes, how they carry information, how they are replicated, how they are expressed NA Structure
More informationThe Blueprint of Life: DNA to Protein
The Blueprint of Life: NA to Protein Chapter 7 What is genetics? The science of heredity; includes the y; study of genes, how they carry information, how they are replicated, how they are expressed 1 NA
More informationPTM Discovery Method for Automated Identification and Sequencing of Phosphopeptides Using the Q TRAP LC/MS/MS System
Application Note LC/MS PTM Discovery Method for Automated Identification and Sequencing of Phosphopeptides Using the Q TRAP LC/MS/MS System Purpose This application note describes an automated workflow
More informationMicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
More informationA look at macromolecules (Text pages 38-54) What is the typical chemical composition of a cell? (Source of figures to right: Madigan et al.
A look at macromolecules (Text pages 38-54) What is the typical chemical composition of a cell? (Source of figures to right: Madigan et al. 2002 Chemical Bonds Ionic Electron-negativity differences cause
More informationSupporting Information. Lysine Propionylation to Boost Proteome Sequence. Coverage and Enable a Silent SILAC Strategy for
Supporting Information Lysine Propionylation to Boost Proteome Sequence Coverage and Enable a Silent SILAC Strategy for Relative Protein Quantification Christoph U. Schräder 1, Shaun Moore 1,2, Aaron A.
More informationHepatitis B Antiviral Drug Development Multi-Marker Screening Assay
Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Background ImQuest BioSciences has developed and qualified a single-plate method to expedite the screening of antiviral agents against
More informationManja Henze, Dorothee Merker and Lothar Elling. 1. Characteristics of the Recombinant β-glycosidase from Pyrococcus
S1 of S17 Supplementary Materials: Microwave-Assisted Synthesis of Glycoconjugates by Transgalactosylation with Recombinant Thermostable β-glycosidase from Pyrococcus Manja Henze, Dorothee Merker and Lothar
More informationNature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Subtiligase-catalyzed ligations with ubiquitin thioesters and 10-mer biotinylated peptides. (a) General scheme for ligations between ubiquitin thioesters and 10-mer, biotinylated
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationSupplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
More informationGenome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice
Supplementary Information Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice Gou Takahashi, Channabasavaiah B Gurumurthy,
More informationPROTEIN SYNTHESIS. It is known today that GENES direct the production of the proteins that determine the phonotypical characteristics of organisms.
PROTEIN SYNTHESIS It is known today that GENES direct the production of the proteins that determine the phonotypical characteristics of organisms.» GENES = a sequence of nucleotides in DNA that performs
More informationPoint total. Page # Exam Total (out of 90) The number next to each intermediate represents the total # of C-C and C-H bonds in that molecule.
This exam is worth 90 points. Pages 2- have questions. Page 1 is for your reference only. Honor Code Agreement - Signature: Date: (You agree to not accept or provide assistance to anyone else during this
More informationOncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong
More informationAmino acids. Side chain. -Carbon atom. Carboxyl group. Amino group
PROTEINS Amino acids Side chain -Carbon atom Amino group Carboxyl group Amino acids Primary structure Amino acid monomers Peptide bond Peptide bond Amino group Carboxyl group Peptide bond N-terminal (
More informationTime (min) Supplementary Figure 1: Gas decomposition products of irradiated DMC.
200000 C 2 CH 3 CH 3 DMC 180000 160000 140000 Intensity 120000 100000 80000 60000 40000 C 2 H 6 CH 3 CH 2 CH 3 CH 3 CCH 3 EMC DEC 20000 C 3 H 8 HCCH 3 5 10 15 20 25 Time (min) Supplementary Figure 1: Gas
More informationSupplementary Information
Supplementary Information HBV maintains electrostatic homeostasis by modulating negative charges from phosphoserine and encapsidated nucleic acids Authors: Pei-Yi Su 1,2,3, Ching-Jen Yang 2, Tien-Hua Chu
More informationA systematic investigation of CID Q-TOF-MS/MS collision energies to allow N- and O-glycopeptide identification by LC-MS/MS
A systematic investigation of CID Q-TO-MS/MS collision energies A systematic investigation of CID Q-TO-MS/MS collision energies to allow N- and O-glycopeptide identification by LC-MS/MS Abstract The MS
More informationStructural Characterization of Prion-like Conformational Changes of the Neuronal Isoform of Aplysia CPEB
Structural Characterization of Prion-like Conformational Changes of the Neuronal Isoform of Aplysia CPEB Bindu L. Raveendra, 1,5 Ansgar B. Siemer, 2,6 Sathyanarayanan V. Puthanveettil, 1,3,7 Wayne A. Hendrickson,
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/2/1/e1500678/dc1 Supplementary Materials for Chemical synthesis of erythropoietin glycoforms for insights into the relationship between glycosylation pattern and
More informationMolecular Biology (BIOL 4320) Exam #2 May 3, 2004
Molecular Biology (BIOL 4320) Exam #2 May 3, 2004 Name SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses after the question number. Good
More informationCells. Variation and Function of Cells
Cells Variation and Function of Cells Plasma Membrane= the skin of a cell, it protects and nourishes the cell while communicating with other cells at the same time. Lipid means fat and they are hydrophobic
More informationReceived 29 December 1998/Accepted 9 March 1999
JOURNAL OF VIROLOGY, June 1999, p. 4794 4805 Vol. 73, No. 6 0022-538X/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Molecular Requirements for Human Immunodeficiency
More informationAmino acid Catabolism
Enzymatic digestion of dietary proteins in gastrointestinal-tract. Amino acid Catabolism Amino acids: 1. There are 20 different amino acid, they are monomeric constituents of proteins 2. They act as precursors
More informationSupplementary Figure 1.
Supplementary Figure 1. Supplementary Figure 1. Translation of naturally occurring CC[C/U]-[C/U] sequences in E. coli. a. The frequency of occurrence of CC[C/U]-[C/U] in E. coli K12 protein coding genes.
More informationAmino acid metabolism
Amino acid metabolism The important reaction commonly employed in the breakdown of an amino acid is always the removal of its -amino group. The product ammonia is excreted after conversion to urea or other
More informationSUPPLEMENTARY INFORMATION
In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM.2919 Direct observation of the influence of cardiolipin and antibiotics on lipid II binding to MurJ Jani
More informationComplete Student Notes for BIOL2202
Complete Student Notes for BIOL2202 Revisiting Translation & the Genetic Code Overview How trna molecules interpret a degenerate genetic code and select the correct amino acid trna structure: modified
More informationDNA and Protein Synthesis Practice
Biology 12 DNA and Protein Synthesis Practice Name: 1. DNA is often called the "code of life". Actually it contains the code for a) the sequence of amino acids in a protein b) the sequence of base pairs
More informationIron depletion enhances production of antimicrobials by Pseudomonas
Iron depletion enhances production of antimicrobials by Pseudomonas aeruginosa. Angela T. Nguyen 1, Jace W. Jones 1, Max A. Ruge 1, Maureen A. Kane 1, and Amanda G. Oglesby-Sherrouse 1,2 * University of
More informationBiology. Lectures winter term st year of Pharmacy study
Biology Lectures winter term 2008 1 st year of Pharmacy study 3 rd Lecture Chemical composition of living matter chemical basis of life. Atoms, molecules, organic compounds carbohydrates, lipids, proteins,
More informationBeta Amyloid Peptides
Beta Amyloid Peptides The Most Comprehensive Collection for Alzheimer s Disease Academic Services Pharmaceutical Services Beta Amyloid Peptides The Most Comprehensive Collection for Alzheimer s Disease
More informationSupplementary Table 1. Properties of lysates of E. coli strains expressing CcLpxI point mutants
Supplementary Table 1. Properties of lysates of E. coli strains expressing CcLpxI point mutants Species UDP-2,3- diacylglucosamine hydrolase specific activity (nmol min -1 mg -1 ) Fold vectorcontrol specific
More informationSolid-Phase Purification of Synthetic DNA Sequences. Serge L. Beaucage, Ph.D. Chief, Laboratory of Biological Chemistry FDA-CDER
Solid-Phase Purification of Synthetic DNA Sequences Serge L. Beaucage, Ph.D. Chief, Laboratory of Biological Chemistry FDA-CDER The one who follows the crowd will usually go no further than the crowd.
More informationPhosphorylation of proteins Steve Barnes Feb 19th, 2002 in some cases, proteins are found in a stable, hyperphosphorylated state, e.g.
Phosphorylation of proteins Steve Barnes Feb 19th, 2002 in some cases, proteins are found in a stable, hyperphosphorylated state, e.g., casein more interestingly, in most other cases, it is a transient
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Design of isolated protein and RNC constructs, and homogeneity of purified RNCs. (a) Schematic depicting the design and nomenclature used for all the isolated proteins and RNCs used
More informationSupplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random
S1 Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random Conical Tilt (RCT) reconstruction (left: -50,right:
More informationBiochemistry 2000 Sample Question Transcription, Translation and Lipids. (1) Give brief definitions or unique descriptions of the following terms:
(1) Give brief definitions or unique descriptions of the following terms: (a) exon (b) holoenzyme (c) anticodon (d) trans fatty acid (e) poly A tail (f) open complex (g) Fluid Mosaic Model (h) embedded
More informationFour Classes of Biological Macromolecules. Biological Macromolecules. Lipids
Biological Macromolecules Much larger than other par4cles found in cells Made up of smaller subunits Found in all cells Great diversity of func4ons Four Classes of Biological Macromolecules Lipids Polysaccharides
More informationShort polymer. Dehydration removes a water molecule, forming a new bond. Longer polymer (a) Dehydration reaction in the synthesis of a polymer
HO 1 2 3 H HO H Short polymer Dehydration removes a water molecule, forming a new bond Unlinked monomer H 2 O HO 1 2 3 4 H Longer polymer (a) Dehydration reaction in the synthesis of a polymer HO 1 2 3
More informationOverview of the Expressway Cell-Free Expression Systems. Expressway Mini Cell-Free Expression System
Overview of the Expressway Cell-Free Expression Systems The Expressway Cell-Free Expression Systems use an efficient coupled transcription and translation reaction to produce up to milligram quantities
More informationSupplementary Fig. 1. Identification of acetylation of K68 of SOD2
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio
More informationProtein Synthesis and Mutation Review
Protein Synthesis and Mutation Review 1. Using the diagram of RNA below, identify at least three things different from a DNA molecule. Additionally, circle a nucleotide. 1) RNA is single stranded; DNA
More informationGenetics. Instructor: Dr. Jihad Abdallah Transcription of DNA
Genetics Instructor: Dr. Jihad Abdallah Transcription of DNA 1 3.4 A 2 Expression of Genetic information DNA Double stranded In the nucleus Transcription mrna Single stranded Translation In the cytoplasm
More informationSupporting Information. Post translational Modifications of Serotonin Type 4 Receptor Heterologously Expressed in. Mouse Rod Cells
Supporting Information Post translational Modifications of Serotonin Type 4 Receptor Heterologously Expressed in Mouse Rod Cells David Salom,, Benlian Wang,, Zhiqian Dong, Wenyu Sun, Pius Padayatti, Steven
More informationfor the Identification of Phosphorylated Peptides
Application of a Data Dependent Neutral-Loss Experiment on the Finnigan LTQ for the Identification of Phosphorylated Peptides Gargi Choudhary Diane Cho Thermo Electron, San Jose, CA Abstracted from posters
More informationObjectives: Prof.Dr. H.D.El-Yassin
Protein Synthesis and drugs that inhibit protein synthesis Objectives: 1. To understand the steps involved in the translation process that leads to protein synthesis 2. To understand and know about all
More informationCELLS. Cells. Basic unit of life (except virus)
Basic unit of life (except virus) CELLS Prokaryotic, w/o nucleus, bacteria Eukaryotic, w/ nucleus Various cell types specialized for particular function. Differentiation. Over 200 human cell types 56%
More informationSUPPORTING INFORMATION. Lysine Carbonylation is a Previously Unrecognized Contributor. to Peroxidase Activation of Cytochrome c by Chloramine-T
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2019 SUPPORTING INFORMATION Lysine Carbonylation is a Previously Unrecognized Contributor to
More informationProtein Synthesis
Protein Synthesis 10.6-10.16 Objectives - To explain the central dogma - To understand the steps of transcription and translation in order to explain how our genes create proteins necessary for survival.
More informationInhibition of trna 3 Lys -Primed Reverse Transcription by Human APOBEC3G during Human Immunodeficiency Virus Type 1 Replication
JOURNAL OF VIROLOGY, Dec. 2006, p. 11710 11722 Vol. 80, No. 23 0022-538X/06/$08.00 0 doi:10.1128/jvi.01038-06 Copyright 2006, American Society for Microbiology. All Rights Reserved. Inhibition of trna
More informationChapter 23 Enzymes 1
Chapter 23 Enzymes 1 Enzymes Ribbon diagram of cytochrome c oxidase, the enzyme that directly uses oxygen during respiration. 2 Enzyme Catalysis Enzyme: A biological catalyst. With the exception of some
More informationIntroduction to Peptide Sequencing
Introduction to Peptide equencing Quadrupole Ion Traps tructural Biophysics Course December 3, 2014 12/8/14 Introduction to Peptide equencing - athan Yates 1 Why are ion traps used to sequence peptides?
More informationName: Date: Block: Biology 12
Name: Date: Block: Biology 12 Provincial Exam Review: Cell Processes and Applications January 2003 Use the following diagram to answer questions 1 and 2. 1. Which labelled organelle produces most of the
More informationLecture: Amino Acid catabolism: Nitrogen-The Urea cycle
BIOC 423: Introductory Biochemistry Biochemistry Education Department of Biochemistry & Molecular Biology University of New Mexico Lecture: Amino Acid catabolism: Nitrogen-The Urea cycle OBJECTIVES Describe
More informationRNA Processing in Eukaryotes *
OpenStax-CNX module: m44532 1 RNA Processing in Eukaryotes * OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you
More informationLuminescent platforms for monitoring changes in the solubility of amylin and huntingtin in living cells
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2016 Contents Supporting Information Luminescent platforms for monitoring changes in the
More informationSupplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
More informationAmino acids-incorporated nanoflowers with an
Amino acids-incorporated nanoflowers with an intrinsic peroxidase-like activity Zhuo-Fu Wu 1,2,+, Zhi Wang 1,+, Ye Zhang 3, Ya-Li Ma 3, Cheng-Yan He 4, Heng Li 1, Lei Chen 1, Qi-Sheng Huo 3, Lei Wang 1,*
More informationAccurate determination of protein methionine oxidation by stable isotope labeling and LC-MS analysis
Accurate determination of protein methionine oxidation by stable isotope labeling and LC-MS analysis Hongcheng Liu*, Gomathinayagam Ponniah, Alyssa Neil, Rekha Patel, Bruce Andrien Protein Characterization,
More informationNature Structural & Molecular Biology: doi: /nsmb.2419
Supplementary Figure 1 Mapped sequence reads and nucleosome occupancies. (a) Distribution of sequencing reads on the mouse reference genome for chromosome 14 as an example. The number of reads in a 1 Mb
More informationMaterials and Methods , The two-hybrid principle.
The enzymatic activity of an unknown protein which cleaves the phosphodiester bond between the tyrosine residue of a viral protein and the 5 terminus of the picornavirus RNA Introduction Every day there
More informationTECHNICAL BULLETIN. R 2 GlcNAcβ1 4GlcNAcβ1 Asn
GlycoProfile II Enzymatic In-Solution N-Deglycosylation Kit Product Code PP0201 Storage Temperature 2 8 C TECHNICAL BULLETIN Product Description Glycosylation is one of the most common posttranslational
More informationImprove Protein Analysis with the New, Mass Spectrometry- Compatible ProteasMAX Surfactant
Improve Protein Analysis with the New, Mass Spectrometry- Compatible Surfactant ABSTRACT Incomplete solubilization and digestion and poor peptide recovery are frequent limitations in protein sample preparation
More informationMacromolecules of Life -3 Amino Acids & Proteins
Macromolecules of Life -3 Amino Acids & Proteins Shu-Ping Lin, Ph.D. Institute of Biomedical Engineering E-mail: splin@dragon.nchu.edu.tw Website: http://web.nchu.edu.tw/pweb/users/splin/ Amino Acids Proteins
More informationSupporting information
Supporting information Figure legends Supplementary Table 1. Specific product ions obtained from fragmentation of lithium adducts in the positive ion mode comparing the different positional isomers of
More informationBiochemistry 423 Final Examination NAME:
Biochemistry 423 Final Examination NAME: 1 Circle the single BEST answer (3 points each) 1. At equilibrium the free energy of a reaction G A. depends only on the temperature B. is positive C. is 0 D. is
More informationBiomolecules Amino Acids & Protein Chemistry
Biochemistry Department Date: 17/9/ 2017 Biomolecules Amino Acids & Protein Chemistry Prof.Dr./ FAYDA Elazazy Professor of Biochemistry and Molecular Biology Intended Learning Outcomes ILOs By the end
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. RNAseq expression profiling of selected glycosyltransferase genes in CHO.
Supplementary Figure 1 RNAseq expression profiling of selected glycosyltransferase genes in CHO. RNAseq analysis was performed on two common CHO lines (CHO-K1, CHO-GS) and two independent CHO-GS triple
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationChapter 2 Part 3: Organic and Inorganic Compounds
Chapter 2 Part 3: Organic and Inorganic Compounds Objectives: 1) List the major groups of inorganic chemicals common in cells. 2) Describe the functions of various types of inorganic chemicals in cells.
More informationSupplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated
More informationProblem 2 (10 Points) The wild type sequence of the coding region of an mrna is shown below.
Problem 2 (10 Points) The wild type sequence of the coding region of an mrna is shown below. 5 AUG ACC UGG AAU AAA UGA 3 Use that sequence to answer each of the questions below. a) What is the sequence
More informationTRANSLATION: 3 Stages to translation, can you guess what they are?
TRANSLATION: Translation: is the process by which a ribosome interprets a genetic message on mrna to place amino acids in a specific sequence in order to synthesize polypeptide. 3 Stages to translation,
More informationPhosphorylated glycosphingolipids essential for cholesterol mobilization in C. elegans
SUPPLEMENTARY INFORMATION Phosphorylated glycosphingolipids essential for cholesterol mobilization in C. elegans Sebastian Boland, Ulrike Schmidt, Vyacheslav Zagoriy, Julio L. Sampaio, Raphael Fritsche,
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationOctober 26, Lecture Readings. Vesicular Trafficking, Secretory Pathway, HIV Assembly and Exit from Cell
October 26, 2006 Vesicular Trafficking, Secretory Pathway, HIV Assembly and Exit from Cell 1. Secretory pathway a. Formation of coated vesicles b. SNAREs and vesicle targeting 2. Membrane fusion a. SNAREs
More information