Supplementary Figure 1

Size: px
Start display at page:

Download "Supplementary Figure 1"

Transcription

1 Supplementary Figure 1 Isolation of mt-trnas and RNA-MS analysis of mt-trna Asn from M. nudus (a)m. nudus mt-trnas were isolated by RCC and resolved by 10% denaturing PAGE. The gel was stained with SYBR Gold (Invitrogen) and visualized using an FLA-7000 image analyzer (Fujifilm). The trnas as indicated by arrows were cut out of the gel and purified. (b) Top panel: base peak chromatogram (BPC) of RNase T 1 -digested fragments; second and third panel: extracted ion chromatograms (XIC) for the negative ions of the anticodon-containing fragments as indicated. Molecular mass of each fragment numbered on the BPC is listed in Supplementary Table 1. Bottom panel shows the CID spectrum of the cyanoethylated anticodon-containing fragment. The c- and y-series product ions are indicated on the CID spectrum and assigned on the corresponding sequence. (c) Secondary structure of M. nudus mt-trna Asn with post-transcriptional modifications. The numbering system of trna is based on the trna database (Juhling, F. et al., Nucleic Acids Res. 37, D159-62, 2009). m 1 A: 1- methyladenosine, m 2,2 G: N 2, N 2 -dimethylguanosine, Ψ: pseudouridine, and t 6 A: N 6 - threonylcarbamoyladenosine.

2 Supplementary Figure 2 RNA-MS analysis of M. nudus mt-trna Lys XICs of the anticodon-containing fragments with N 428 at position 37 (upper panel), t 6 A37 (lower panel). Sequence, m/z values, and charge state of each fragment are indicated on the right side. The frequency of each modification was calculated from the ratio of the peak areas of the two fragments.

3 Supplementary Figure 3 CID spectrum of t 6 A base The t 6 A base was generated by in-source fragmentation of t 6 A nucleoside in individual E. coli trna Thr4. The product ions are assigned on the chemical structure of the t 6 A base. The internal fragment of the threonine moiety is indicated by a dotted line.

4 Supplementary Figure 4 Enzymatic synthesis of Thr and 4-hydroxythreonine LtaE catalyzes an aldol condensation reaction of acetaldehyde and glycine to synthesize Thr utilizing pyridoxal phosphate (PLP) as a cofactor. LtaE catalyzes the same reaction with glycolaldehyde and glycine to form 4- hydroxythreonine.

5 Supplementary Figure 5 RPC-LC/MS co-injection analysis of the synthetic ht 6 A and natural N 428 XICs of synthetic ht 6 A (left panel), nucleosides of M. nudus mt-trna Lys (middle panel), and co-injection of both samples (right panel). Lower panels show XICs of m 1 A (m/z 298) as controls.

6 Supplementary Figure 6 CID analysis of the synthetic ht 6 A CID spectra of ht 6 A nucleoside (upper panel) and its base ion (lower panel). ht 6 A base (BH 2 + ) was generated by in-source fragmentation of ht 6 A nucleoside of E. coli trna Lys transcript bearing ht 6 A37. The product ions are assigned in the corresponding chemical structures. The internal fragment of the methyl threonine moiety is indicated by a dotted line.

7 list of DNA probes for RCC and primers Purpose Name 5' to 3' sequence probes for RCC mt trna Asn mt trna Asn probe AACGGCCAAGCGCCTTTACATTTAGCTACGACCCA mt trna Lys mt trna Lys probe TGGTCCTTAATAATAGGTATTAGCTATTTTCTTTTAAATTAAGAGTTTAA vector construction pet28a LtaE ltae fw AGTCAGTCAGTCCATATGATTGATTTACGCAGTGATAC ltae rv GACTGACTGACTCTCGAGTTAACGCGCCAGGAATG in vitro transcription E.coli trna Lys mutant trna Lys template GGGTCGTTAGCTCAGTTGGTAGAGCAGTTGACTCTTAATCAATTGGTCGCAGGTTCGAATC trna Lys fw GCTAATACGACTCACTATAGGGTCGTTAGCTCAG trna Lys rv TGGTGGGTCGTGCAGGATTCGAACCTGCG E.coli trna Ala2 trna Ala2 template AGCTCAGCTGGGAGAGCGCTTGCATGGCATGCAAGAGGTCAGCGGTTCGATCCCGCTT trna Ala2 fw GCTAATACGACTCACTATAGGGGCTATAGCTCAGCTGGGAGAG trna Ala2 rv TGGTGGAGCTAAGCGGGATCGAACCGC mrna mrna(aaa) template AGGGTTAACTTTAAGTAAGGAGGTACACTGCTAAATAACTGTAGAAAAAA mrna(aag) template AGGGTTAACTTTAAGTAAGGAGGTACACTGCTAAGTAACTGTAGAAAAAA mrna fw GCGAAATTAATACGACTCACTATAGGGTTAACTTTAAG mrna rv TTTTTTCTACAGTTA

Minutes Figure S1. HPLC separation of nucleosides from LC/ESI-MS analysis of a total enzymatic Trp

Minutes Figure S1. HPLC separation of nucleosides from LC/ESI-MS analysis of a total enzymatic Trp 100 A % Relative Abundance m m Ø acp 5 m Øm 5 m m 7 m s * 6 ia m * 0 5 10 15 0 5 0 5 40 Minutes Figure S1. HPL separation of nucleosides from L/ESI-MS analysis of a total enzymatic digest of mt trna. V

More information

Supplementary Information

Supplementary Information Supplementary Information Precursors of trnas are stabilized by methylguanosine cap structures Takayuki Ohira and Tsutomu Suzuki Department of Chemistry and Biotechnology, Graduate School of Engineering,

More information

reads observed in trnas from the analysis of RNAs carrying a 5 -OH ends isolated from cells induced to express

reads observed in trnas from the analysis of RNAs carrying a 5 -OH ends isolated from cells induced to express Supplementary Figure 1. VapC-mt4 cleaves trna Ala2 in E. coli. Histograms representing the fold change in reads observed in trnas from the analysis of RNAs carrying a 5 -OH ends isolated from cells induced

More information

Sections 12.3, 13.1, 13.2

Sections 12.3, 13.1, 13.2 Sections 12.3, 13.1, 13.2 Now that the DNA has been copied, it needs to send its genetic message to the ribosomes so proteins can be made Transcription: synthesis (making of) an RNA molecule from a DNA

More information

Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis

Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis Supplementary information Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis Yasuyuki Yamada, Fumihiko Sato

More information

RNA (Ribonucleic acid)

RNA (Ribonucleic acid) RNA (Ribonucleic acid) Structure: Similar to that of DNA except: 1- it is single stranded polunucleotide chain. 2- Sugar is ribose 3- Uracil is instead of thymine There are 3 types of RNA: 1- Ribosomal

More information

DNA codes for RNA, which guides protein synthesis.

DNA codes for RNA, which guides protein synthesis. Section 3: DNA codes for RNA, which guides protein synthesis. K What I Know W What I Want to Find Out L What I Learned Vocabulary Review synthesis New RNA messenger RNA ribosomal RNA transfer RNA transcription

More information

SUPPLEMENTARY INFORMATION. An orthogonal ribosome-trnas pair by the engineering of

SUPPLEMENTARY INFORMATION. An orthogonal ribosome-trnas pair by the engineering of SUPPLEMENTARY INFORMATION An orthogonal ribosome-trnas pair by the engineering of peptidyl transferase center Naohiro Terasaka 1 *, Gosuke Hayashi 1 *, Takayuki Katoh 1, and Hiroaki Suga 1,2 1 Department

More information

Supplementary Figure 1. Amino acid sequences of GodA and GodA*. Inserted. residues are colored red. Numbers indicate the position of each residue.

Supplementary Figure 1. Amino acid sequences of GodA and GodA*. Inserted. residues are colored red. Numbers indicate the position of each residue. Supplementary Figure 1. Amino acid sequences of GodA and GodA*. Inserted residues are colored red. Numbers indicate the position of each residue. Supplementary Figure 2. SDS-PAGE analysis of purified recombinant

More information

Objective: You will be able to explain how the subcomponents of

Objective: You will be able to explain how the subcomponents of Objective: You will be able to explain how the subcomponents of nucleic acids determine the properties of that polymer. Do Now: Read the first two paragraphs from enduring understanding 4.A Essential knowledge:

More information

Chemistry 107 Exam 4 Study Guide

Chemistry 107 Exam 4 Study Guide Chemistry 107 Exam 4 Study Guide Chapter 10 10.1 Recognize that enzyme catalyze reactions by lowering activation energies. Know the definition of a catalyst. Differentiate between absolute, relative and

More information

Nature Methods: doi: /nmeth.3177

Nature Methods: doi: /nmeth.3177 Supplementary Figure 1 Characterization of LysargiNase, trypsin and LysN missed cleavages. (a) Proportion of peptides identified in LysargiNase and trypsin digests of MDA-MB-231 cell lysates carrying 0,

More information

This exam consists of two parts. Part I is multiple choice. Each of these 25 questions is worth 2 points.

This exam consists of two parts. Part I is multiple choice. Each of these 25 questions is worth 2 points. MBB 407/511 Molecular Biology and Biochemistry First Examination - October 1, 2002 Name Social Security Number This exam consists of two parts. Part I is multiple choice. Each of these 25 questions is

More information

Bio 111 Study Guide Chapter 17 From Gene to Protein

Bio 111 Study Guide Chapter 17 From Gene to Protein Bio 111 Study Guide Chapter 17 From Gene to Protein BEFORE CLASS: Reading: Read the introduction on p. 333, skip the beginning of Concept 17.1 from p. 334 to the bottom of the first column on p. 336, and

More information

2. Ionization Sources 3. Mass Analyzers 4. Tandem Mass Spectrometry

2. Ionization Sources 3. Mass Analyzers 4. Tandem Mass Spectrometry Dr. Sanjeeva Srivastava 1. Fundamental of Mass Spectrometry Role of MS and basic concepts 2. Ionization Sources 3. Mass Analyzers 4. Tandem Mass Spectrometry 2 1 MS basic concepts Mass spectrometry - technique

More information

Proteins are sometimes only produced in one cell type or cell compartment (brain has 15,000 expressed proteins, gut has 2,000).

Proteins are sometimes only produced in one cell type or cell compartment (brain has 15,000 expressed proteins, gut has 2,000). Lecture 2: Principles of Protein Structure: Amino Acids Why study proteins? Proteins underpin every aspect of biological activity and therefore are targets for drug design and medicinal therapy, and in

More information

Supplementary Information

Supplementary Information Supplementary Information Archaeal Elp3 catalyzes trna wobble uridine modification at C5 via a radical mechanism Kiruthika Selvadurai, Pei Wang, Joseph Seimetz & Raven H Huang* Department of Biochemistry,

More information

Biological systems interact, and these systems and their interactions possess complex properties. STOP at enduring understanding 4A

Biological systems interact, and these systems and their interactions possess complex properties. STOP at enduring understanding 4A Biological systems interact, and these systems and their interactions possess complex properties. STOP at enduring understanding 4A Homework Watch the Bozeman video called, Biological Molecules Objective:

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10962 Supplementary Figure 1. Expression of AvrAC-FLAG in protoplasts. Total protein extracted from protoplasts described in Fig. 1a was subjected to anti-flag immunoblot to detect AvrAC-FLAG

More information

Double charge of 33kD peak A1 A2 B1 B2 M2+ M/z. ABRF Proteomics Research Group - Qualitative Proteomics Study Identifier Number 14146

Double charge of 33kD peak A1 A2 B1 B2 M2+ M/z. ABRF Proteomics Research Group - Qualitative Proteomics Study Identifier Number 14146 Abstract The 2008 ABRF Proteomics Research Group Study offers participants the chance to participate in an anonymous study to identify qualitative differences between two protein preparations. We used

More information

ISG15 sirna # Ctrl sirna+ifn+wt. Virus titer (Pfu/ml) hours post infection. d USP18 sirna #2 IFN

ISG15 sirna # Ctrl sirna+ifn+wt. Virus titer (Pfu/ml) hours post infection. d USP18 sirna #2 IFN a ISG15 sirna Ctrl #1 #2 ISG15 conjugates IB: ISG15 Virus titer (Pfu/ml) b ISG15 sirna #2 10 7 Ctrl sirna+ifn+wt Ctrl sirna+ifn+67 10 6 ISG15 sirna+ifn+wt ISG15 sirna+ifn+67 10 5 10 4 10 3 Free ISG15 10

More information

Cells and Tissues 3PART C. PowerPoint Lecture Slide Presentation by Patty Bostwick-Taylor, Florence-Darlington Technical College

Cells and Tissues 3PART C. PowerPoint Lecture Slide Presentation by Patty Bostwick-Taylor, Florence-Darlington Technical College PowerPoint Lecture Slide Presentation by Patty Bostwick-Taylor, Florence-Darlington Technical College Cells and Tissues 3PART C Protein Synthesis Gene DNA segment that carries a blueprint for building

More information

The Blueprint of Life: DNA to Protein. What is genetics? DNA Structure 4/27/2011. Chapter 7

The Blueprint of Life: DNA to Protein. What is genetics? DNA Structure 4/27/2011. Chapter 7 The Blueprint of Life: NA to Protein Chapter 7 What is genetics? The science of heredity; includes the study of genes, how they carry information, how they are replicated, how they are expressed NA Structure

More information

The Blueprint of Life: DNA to Protein

The Blueprint of Life: DNA to Protein The Blueprint of Life: NA to Protein Chapter 7 What is genetics? The science of heredity; includes the y; study of genes, how they carry information, how they are replicated, how they are expressed 1 NA

More information

PTM Discovery Method for Automated Identification and Sequencing of Phosphopeptides Using the Q TRAP LC/MS/MS System

PTM Discovery Method for Automated Identification and Sequencing of Phosphopeptides Using the Q TRAP LC/MS/MS System Application Note LC/MS PTM Discovery Method for Automated Identification and Sequencing of Phosphopeptides Using the Q TRAP LC/MS/MS System Purpose This application note describes an automated workflow

More information

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on

More information

A look at macromolecules (Text pages 38-54) What is the typical chemical composition of a cell? (Source of figures to right: Madigan et al.

A look at macromolecules (Text pages 38-54) What is the typical chemical composition of a cell? (Source of figures to right: Madigan et al. A look at macromolecules (Text pages 38-54) What is the typical chemical composition of a cell? (Source of figures to right: Madigan et al. 2002 Chemical Bonds Ionic Electron-negativity differences cause

More information

Supporting Information. Lysine Propionylation to Boost Proteome Sequence. Coverage and Enable a Silent SILAC Strategy for

Supporting Information. Lysine Propionylation to Boost Proteome Sequence. Coverage and Enable a Silent SILAC Strategy for Supporting Information Lysine Propionylation to Boost Proteome Sequence Coverage and Enable a Silent SILAC Strategy for Relative Protein Quantification Christoph U. Schräder 1, Shaun Moore 1,2, Aaron A.

More information

Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay

Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Background ImQuest BioSciences has developed and qualified a single-plate method to expedite the screening of antiviral agents against

More information

Manja Henze, Dorothee Merker and Lothar Elling. 1. Characteristics of the Recombinant β-glycosidase from Pyrococcus

Manja Henze, Dorothee Merker and Lothar Elling. 1. Characteristics of the Recombinant β-glycosidase from Pyrococcus S1 of S17 Supplementary Materials: Microwave-Assisted Synthesis of Glycoconjugates by Transgalactosylation with Recombinant Thermostable β-glycosidase from Pyrococcus Manja Henze, Dorothee Merker and Lothar

More information

Nature Methods: doi: /nmeth Supplementary Figure 1

Nature Methods: doi: /nmeth Supplementary Figure 1 Supplementary Figure 1 Subtiligase-catalyzed ligations with ubiquitin thioesters and 10-mer biotinylated peptides. (a) General scheme for ligations between ubiquitin thioesters and 10-mer, biotinylated

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.

More information

Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice

Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice Supplementary Information Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice Gou Takahashi, Channabasavaiah B Gurumurthy,

More information

PROTEIN SYNTHESIS. It is known today that GENES direct the production of the proteins that determine the phonotypical characteristics of organisms.

PROTEIN SYNTHESIS. It is known today that GENES direct the production of the proteins that determine the phonotypical characteristics of organisms. PROTEIN SYNTHESIS It is known today that GENES direct the production of the proteins that determine the phonotypical characteristics of organisms.» GENES = a sequence of nucleotides in DNA that performs

More information

Point total. Page # Exam Total (out of 90) The number next to each intermediate represents the total # of C-C and C-H bonds in that molecule.

Point total. Page # Exam Total (out of 90) The number next to each intermediate represents the total # of C-C and C-H bonds in that molecule. This exam is worth 90 points. Pages 2- have questions. Page 1 is for your reference only. Honor Code Agreement - Signature: Date: (You agree to not accept or provide assistance to anyone else during this

More information

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong

More information

Amino acids. Side chain. -Carbon atom. Carboxyl group. Amino group

Amino acids. Side chain. -Carbon atom. Carboxyl group. Amino group PROTEINS Amino acids Side chain -Carbon atom Amino group Carboxyl group Amino acids Primary structure Amino acid monomers Peptide bond Peptide bond Amino group Carboxyl group Peptide bond N-terminal (

More information

Time (min) Supplementary Figure 1: Gas decomposition products of irradiated DMC.

Time (min) Supplementary Figure 1: Gas decomposition products of irradiated DMC. 200000 C 2 CH 3 CH 3 DMC 180000 160000 140000 Intensity 120000 100000 80000 60000 40000 C 2 H 6 CH 3 CH 2 CH 3 CH 3 CCH 3 EMC DEC 20000 C 3 H 8 HCCH 3 5 10 15 20 25 Time (min) Supplementary Figure 1: Gas

More information

Supplementary Information

Supplementary Information Supplementary Information HBV maintains electrostatic homeostasis by modulating negative charges from phosphoserine and encapsidated nucleic acids Authors: Pei-Yi Su 1,2,3, Ching-Jen Yang 2, Tien-Hua Chu

More information

A systematic investigation of CID Q-TOF-MS/MS collision energies to allow N- and O-glycopeptide identification by LC-MS/MS

A systematic investigation of CID Q-TOF-MS/MS collision energies to allow N- and O-glycopeptide identification by LC-MS/MS A systematic investigation of CID Q-TO-MS/MS collision energies A systematic investigation of CID Q-TO-MS/MS collision energies to allow N- and O-glycopeptide identification by LC-MS/MS Abstract The MS

More information

Structural Characterization of Prion-like Conformational Changes of the Neuronal Isoform of Aplysia CPEB

Structural Characterization of Prion-like Conformational Changes of the Neuronal Isoform of Aplysia CPEB Structural Characterization of Prion-like Conformational Changes of the Neuronal Isoform of Aplysia CPEB Bindu L. Raveendra, 1,5 Ansgar B. Siemer, 2,6 Sathyanarayanan V. Puthanveettil, 1,3,7 Wayne A. Hendrickson,

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/2/1/e1500678/dc1 Supplementary Materials for Chemical synthesis of erythropoietin glycoforms for insights into the relationship between glycosylation pattern and

More information

Molecular Biology (BIOL 4320) Exam #2 May 3, 2004

Molecular Biology (BIOL 4320) Exam #2 May 3, 2004 Molecular Biology (BIOL 4320) Exam #2 May 3, 2004 Name SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses after the question number. Good

More information

Cells. Variation and Function of Cells

Cells. Variation and Function of Cells Cells Variation and Function of Cells Plasma Membrane= the skin of a cell, it protects and nourishes the cell while communicating with other cells at the same time. Lipid means fat and they are hydrophobic

More information

Received 29 December 1998/Accepted 9 March 1999

Received 29 December 1998/Accepted 9 March 1999 JOURNAL OF VIROLOGY, June 1999, p. 4794 4805 Vol. 73, No. 6 0022-538X/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Molecular Requirements for Human Immunodeficiency

More information

Amino acid Catabolism

Amino acid Catabolism Enzymatic digestion of dietary proteins in gastrointestinal-tract. Amino acid Catabolism Amino acids: 1. There are 20 different amino acid, they are monomeric constituents of proteins 2. They act as precursors

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Supplementary Figure 1. Translation of naturally occurring CC[C/U]-[C/U] sequences in E. coli. a. The frequency of occurrence of CC[C/U]-[C/U] in E. coli K12 protein coding genes.

More information

Amino acid metabolism

Amino acid metabolism Amino acid metabolism The important reaction commonly employed in the breakdown of an amino acid is always the removal of its -amino group. The product ammonia is excreted after conversion to urea or other

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM.2919 Direct observation of the influence of cardiolipin and antibiotics on lipid II binding to MurJ Jani

More information

Complete Student Notes for BIOL2202

Complete Student Notes for BIOL2202 Complete Student Notes for BIOL2202 Revisiting Translation & the Genetic Code Overview How trna molecules interpret a degenerate genetic code and select the correct amino acid trna structure: modified

More information

DNA and Protein Synthesis Practice

DNA and Protein Synthesis Practice Biology 12 DNA and Protein Synthesis Practice Name: 1. DNA is often called the "code of life". Actually it contains the code for a) the sequence of amino acids in a protein b) the sequence of base pairs

More information

Iron depletion enhances production of antimicrobials by Pseudomonas

Iron depletion enhances production of antimicrobials by Pseudomonas Iron depletion enhances production of antimicrobials by Pseudomonas aeruginosa. Angela T. Nguyen 1, Jace W. Jones 1, Max A. Ruge 1, Maureen A. Kane 1, and Amanda G. Oglesby-Sherrouse 1,2 * University of

More information

Biology. Lectures winter term st year of Pharmacy study

Biology. Lectures winter term st year of Pharmacy study Biology Lectures winter term 2008 1 st year of Pharmacy study 3 rd Lecture Chemical composition of living matter chemical basis of life. Atoms, molecules, organic compounds carbohydrates, lipids, proteins,

More information

Beta Amyloid Peptides

Beta Amyloid Peptides Beta Amyloid Peptides The Most Comprehensive Collection for Alzheimer s Disease Academic Services Pharmaceutical Services Beta Amyloid Peptides The Most Comprehensive Collection for Alzheimer s Disease

More information

Supplementary Table 1. Properties of lysates of E. coli strains expressing CcLpxI point mutants

Supplementary Table 1. Properties of lysates of E. coli strains expressing CcLpxI point mutants Supplementary Table 1. Properties of lysates of E. coli strains expressing CcLpxI point mutants Species UDP-2,3- diacylglucosamine hydrolase specific activity (nmol min -1 mg -1 ) Fold vectorcontrol specific

More information

Solid-Phase Purification of Synthetic DNA Sequences. Serge L. Beaucage, Ph.D. Chief, Laboratory of Biological Chemistry FDA-CDER

Solid-Phase Purification of Synthetic DNA Sequences. Serge L. Beaucage, Ph.D. Chief, Laboratory of Biological Chemistry FDA-CDER Solid-Phase Purification of Synthetic DNA Sequences Serge L. Beaucage, Ph.D. Chief, Laboratory of Biological Chemistry FDA-CDER The one who follows the crowd will usually go no further than the crowd.

More information

Phosphorylation of proteins Steve Barnes Feb 19th, 2002 in some cases, proteins are found in a stable, hyperphosphorylated state, e.g.

Phosphorylation of proteins Steve Barnes Feb 19th, 2002 in some cases, proteins are found in a stable, hyperphosphorylated state, e.g. Phosphorylation of proteins Steve Barnes Feb 19th, 2002 in some cases, proteins are found in a stable, hyperphosphorylated state, e.g., casein more interestingly, in most other cases, it is a transient

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Design of isolated protein and RNC constructs, and homogeneity of purified RNCs. (a) Schematic depicting the design and nomenclature used for all the isolated proteins and RNCs used

More information

Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random

Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random S1 Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random Conical Tilt (RCT) reconstruction (left: -50,right:

More information

Biochemistry 2000 Sample Question Transcription, Translation and Lipids. (1) Give brief definitions or unique descriptions of the following terms:

Biochemistry 2000 Sample Question Transcription, Translation and Lipids. (1) Give brief definitions or unique descriptions of the following terms: (1) Give brief definitions or unique descriptions of the following terms: (a) exon (b) holoenzyme (c) anticodon (d) trans fatty acid (e) poly A tail (f) open complex (g) Fluid Mosaic Model (h) embedded

More information

Four Classes of Biological Macromolecules. Biological Macromolecules. Lipids

Four Classes of Biological Macromolecules. Biological Macromolecules. Lipids Biological Macromolecules Much larger than other par4cles found in cells Made up of smaller subunits Found in all cells Great diversity of func4ons Four Classes of Biological Macromolecules Lipids Polysaccharides

More information

Short polymer. Dehydration removes a water molecule, forming a new bond. Longer polymer (a) Dehydration reaction in the synthesis of a polymer

Short polymer. Dehydration removes a water molecule, forming a new bond. Longer polymer (a) Dehydration reaction in the synthesis of a polymer HO 1 2 3 H HO H Short polymer Dehydration removes a water molecule, forming a new bond Unlinked monomer H 2 O HO 1 2 3 4 H Longer polymer (a) Dehydration reaction in the synthesis of a polymer HO 1 2 3

More information

Overview of the Expressway Cell-Free Expression Systems. Expressway Mini Cell-Free Expression System

Overview of the Expressway Cell-Free Expression Systems. Expressway Mini Cell-Free Expression System Overview of the Expressway Cell-Free Expression Systems The Expressway Cell-Free Expression Systems use an efficient coupled transcription and translation reaction to produce up to milligram quantities

More information

Supplementary Fig. 1. Identification of acetylation of K68 of SOD2

Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio

More information

Protein Synthesis and Mutation Review

Protein Synthesis and Mutation Review Protein Synthesis and Mutation Review 1. Using the diagram of RNA below, identify at least three things different from a DNA molecule. Additionally, circle a nucleotide. 1) RNA is single stranded; DNA

More information

Genetics. Instructor: Dr. Jihad Abdallah Transcription of DNA

Genetics. Instructor: Dr. Jihad Abdallah Transcription of DNA Genetics Instructor: Dr. Jihad Abdallah Transcription of DNA 1 3.4 A 2 Expression of Genetic information DNA Double stranded In the nucleus Transcription mrna Single stranded Translation In the cytoplasm

More information

Supporting Information. Post translational Modifications of Serotonin Type 4 Receptor Heterologously Expressed in. Mouse Rod Cells

Supporting Information. Post translational Modifications of Serotonin Type 4 Receptor Heterologously Expressed in. Mouse Rod Cells Supporting Information Post translational Modifications of Serotonin Type 4 Receptor Heterologously Expressed in Mouse Rod Cells David Salom,, Benlian Wang,, Zhiqian Dong, Wenyu Sun, Pius Padayatti, Steven

More information

for the Identification of Phosphorylated Peptides

for the Identification of Phosphorylated Peptides Application of a Data Dependent Neutral-Loss Experiment on the Finnigan LTQ for the Identification of Phosphorylated Peptides Gargi Choudhary Diane Cho Thermo Electron, San Jose, CA Abstracted from posters

More information

Objectives: Prof.Dr. H.D.El-Yassin

Objectives: Prof.Dr. H.D.El-Yassin Protein Synthesis and drugs that inhibit protein synthesis Objectives: 1. To understand the steps involved in the translation process that leads to protein synthesis 2. To understand and know about all

More information

CELLS. Cells. Basic unit of life (except virus)

CELLS. Cells. Basic unit of life (except virus) Basic unit of life (except virus) CELLS Prokaryotic, w/o nucleus, bacteria Eukaryotic, w/ nucleus Various cell types specialized for particular function. Differentiation. Over 200 human cell types 56%

More information

SUPPORTING INFORMATION. Lysine Carbonylation is a Previously Unrecognized Contributor. to Peroxidase Activation of Cytochrome c by Chloramine-T

SUPPORTING INFORMATION. Lysine Carbonylation is a Previously Unrecognized Contributor. to Peroxidase Activation of Cytochrome c by Chloramine-T Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2019 SUPPORTING INFORMATION Lysine Carbonylation is a Previously Unrecognized Contributor to

More information

Protein Synthesis

Protein Synthesis Protein Synthesis 10.6-10.16 Objectives - To explain the central dogma - To understand the steps of transcription and translation in order to explain how our genes create proteins necessary for survival.

More information

Inhibition of trna 3 Lys -Primed Reverse Transcription by Human APOBEC3G during Human Immunodeficiency Virus Type 1 Replication

Inhibition of trna 3 Lys -Primed Reverse Transcription by Human APOBEC3G during Human Immunodeficiency Virus Type 1 Replication JOURNAL OF VIROLOGY, Dec. 2006, p. 11710 11722 Vol. 80, No. 23 0022-538X/06/$08.00 0 doi:10.1128/jvi.01038-06 Copyright 2006, American Society for Microbiology. All Rights Reserved. Inhibition of trna

More information

Chapter 23 Enzymes 1

Chapter 23 Enzymes 1 Chapter 23 Enzymes 1 Enzymes Ribbon diagram of cytochrome c oxidase, the enzyme that directly uses oxygen during respiration. 2 Enzyme Catalysis Enzyme: A biological catalyst. With the exception of some

More information

Introduction to Peptide Sequencing

Introduction to Peptide Sequencing Introduction to Peptide equencing Quadrupole Ion Traps tructural Biophysics Course December 3, 2014 12/8/14 Introduction to Peptide equencing - athan Yates 1 Why are ion traps used to sequence peptides?

More information

Name: Date: Block: Biology 12

Name: Date: Block: Biology 12 Name: Date: Block: Biology 12 Provincial Exam Review: Cell Processes and Applications January 2003 Use the following diagram to answer questions 1 and 2. 1. Which labelled organelle produces most of the

More information

Lecture: Amino Acid catabolism: Nitrogen-The Urea cycle

Lecture: Amino Acid catabolism: Nitrogen-The Urea cycle BIOC 423: Introductory Biochemistry Biochemistry Education Department of Biochemistry & Molecular Biology University of New Mexico Lecture: Amino Acid catabolism: Nitrogen-The Urea cycle OBJECTIVES Describe

More information

RNA Processing in Eukaryotes *

RNA Processing in Eukaryotes * OpenStax-CNX module: m44532 1 RNA Processing in Eukaryotes * OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you

More information

Luminescent platforms for monitoring changes in the solubility of amylin and huntingtin in living cells

Luminescent platforms for monitoring changes in the solubility of amylin and huntingtin in living cells Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2016 Contents Supporting Information Luminescent platforms for monitoring changes in the

More information

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan

More information

Amino acids-incorporated nanoflowers with an

Amino acids-incorporated nanoflowers with an Amino acids-incorporated nanoflowers with an intrinsic peroxidase-like activity Zhuo-Fu Wu 1,2,+, Zhi Wang 1,+, Ye Zhang 3, Ya-Li Ma 3, Cheng-Yan He 4, Heng Li 1, Lei Chen 1, Qi-Sheng Huo 3, Lei Wang 1,*

More information

Accurate determination of protein methionine oxidation by stable isotope labeling and LC-MS analysis

Accurate determination of protein methionine oxidation by stable isotope labeling and LC-MS analysis Accurate determination of protein methionine oxidation by stable isotope labeling and LC-MS analysis Hongcheng Liu*, Gomathinayagam Ponniah, Alyssa Neil, Rekha Patel, Bruce Andrien Protein Characterization,

More information

Nature Structural & Molecular Biology: doi: /nsmb.2419

Nature Structural & Molecular Biology: doi: /nsmb.2419 Supplementary Figure 1 Mapped sequence reads and nucleosome occupancies. (a) Distribution of sequencing reads on the mouse reference genome for chromosome 14 as an example. The number of reads in a 1 Mb

More information

Materials and Methods , The two-hybrid principle.

Materials and Methods , The two-hybrid principle. The enzymatic activity of an unknown protein which cleaves the phosphodiester bond between the tyrosine residue of a viral protein and the 5 terminus of the picornavirus RNA Introduction Every day there

More information

TECHNICAL BULLETIN. R 2 GlcNAcβ1 4GlcNAcβ1 Asn

TECHNICAL BULLETIN. R 2 GlcNAcβ1 4GlcNAcβ1 Asn GlycoProfile II Enzymatic In-Solution N-Deglycosylation Kit Product Code PP0201 Storage Temperature 2 8 C TECHNICAL BULLETIN Product Description Glycosylation is one of the most common posttranslational

More information

Improve Protein Analysis with the New, Mass Spectrometry- Compatible ProteasMAX Surfactant

Improve Protein Analysis with the New, Mass Spectrometry- Compatible ProteasMAX Surfactant Improve Protein Analysis with the New, Mass Spectrometry- Compatible Surfactant ABSTRACT Incomplete solubilization and digestion and poor peptide recovery are frequent limitations in protein sample preparation

More information

Macromolecules of Life -3 Amino Acids & Proteins

Macromolecules of Life -3 Amino Acids & Proteins Macromolecules of Life -3 Amino Acids & Proteins Shu-Ping Lin, Ph.D. Institute of Biomedical Engineering E-mail: splin@dragon.nchu.edu.tw Website: http://web.nchu.edu.tw/pweb/users/splin/ Amino Acids Proteins

More information

Supporting information

Supporting information Supporting information Figure legends Supplementary Table 1. Specific product ions obtained from fragmentation of lithium adducts in the positive ion mode comparing the different positional isomers of

More information

Biochemistry 423 Final Examination NAME:

Biochemistry 423 Final Examination NAME: Biochemistry 423 Final Examination NAME: 1 Circle the single BEST answer (3 points each) 1. At equilibrium the free energy of a reaction G A. depends only on the temperature B. is positive C. is 0 D. is

More information

Biomolecules Amino Acids & Protein Chemistry

Biomolecules Amino Acids & Protein Chemistry Biochemistry Department Date: 17/9/ 2017 Biomolecules Amino Acids & Protein Chemistry Prof.Dr./ FAYDA Elazazy Professor of Biochemistry and Molecular Biology Intended Learning Outcomes ILOs By the end

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. RNAseq expression profiling of selected glycosyltransferase genes in CHO.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. RNAseq expression profiling of selected glycosyltransferase genes in CHO. Supplementary Figure 1 RNAseq expression profiling of selected glycosyltransferase genes in CHO. RNAseq analysis was performed on two common CHO lines (CHO-K1, CHO-GS) and two independent CHO-GS triple

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

Chapter 2 Part 3: Organic and Inorganic Compounds

Chapter 2 Part 3: Organic and Inorganic Compounds Chapter 2 Part 3: Organic and Inorganic Compounds Objectives: 1) List the major groups of inorganic chemicals common in cells. 2) Describe the functions of various types of inorganic chemicals in cells.

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

Problem 2 (10 Points) The wild type sequence of the coding region of an mrna is shown below.

Problem 2 (10 Points) The wild type sequence of the coding region of an mrna is shown below. Problem 2 (10 Points) The wild type sequence of the coding region of an mrna is shown below. 5 AUG ACC UGG AAU AAA UGA 3 Use that sequence to answer each of the questions below. a) What is the sequence

More information

TRANSLATION: 3 Stages to translation, can you guess what they are?

TRANSLATION: 3 Stages to translation, can you guess what they are? TRANSLATION: Translation: is the process by which a ribosome interprets a genetic message on mrna to place amino acids in a specific sequence in order to synthesize polypeptide. 3 Stages to translation,

More information

Phosphorylated glycosphingolipids essential for cholesterol mobilization in C. elegans

Phosphorylated glycosphingolipids essential for cholesterol mobilization in C. elegans SUPPLEMENTARY INFORMATION Phosphorylated glycosphingolipids essential for cholesterol mobilization in C. elegans Sebastian Boland, Ulrike Schmidt, Vyacheslav Zagoriy, Julio L. Sampaio, Raphael Fritsche,

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

October 26, Lecture Readings. Vesicular Trafficking, Secretory Pathway, HIV Assembly and Exit from Cell

October 26, Lecture Readings. Vesicular Trafficking, Secretory Pathway, HIV Assembly and Exit from Cell October 26, 2006 Vesicular Trafficking, Secretory Pathway, HIV Assembly and Exit from Cell 1. Secretory pathway a. Formation of coated vesicles b. SNAREs and vesicle targeting 2. Membrane fusion a. SNAREs

More information