Supplementary Methods: IGFBP7 Drives Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibition in Lung Cancer

Similar documents
Guangdong Medical University, Zhanjiang, China; 5 Guangxi Medical University, Nanning, China; 6 Department of Pathology, University of Michigan

SUPPLEMENTARY FIGURES AND TABLES

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as

Supplementary material for the manuscript

mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL-

SUPPLEMENTARY INFORMATION

Nature Neuroscience: doi: /nn Supplementary Figure 1

Supplementary Figure 1

Supplementary Information

SUPPLEMENTARY INFORMATION

Expression of programmed death ligand-1 on tumor cells varies pre and post

Afatinib in patients with EGFR mutation-positive NSCLC harboring uncommon mutations: overview of clinical data

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.

Patnaik SK, et al. MicroRNAs to accurately histotype NSCLC biopsies

Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG

Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Supplementary Data. Supplementary Methods:

SUPPLEMENTARY FIGURES AND TABLES

Supplementary Online Content

Supplementary Figure 1 Cell line TRIB2 status. Supplementary Figure 2 TRIB2 status has no impact on the cell cycle after PI3K inhibition. a. b.

Supplemental Information

Supplemental Figures:

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Plasma exposure levels from individual mice 4 hours post IP administration at the

Supplementary Figure 1:

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

Key Words. EGFR mutation Gefitinib Lung cancer EGFR TKI Complex mutation pattern

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Discovery of Novel Human Gene Regulatory Modules from Gene Co-expression and

Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.

Biomarkers of Response to EGFR-TKIs EORTC-NCI-ASCO Meeting on Molecular Markers in Cancer November 17, 2007

Figures S1-S5, Figure Legends, Table S1 List of primers used in the study

SUPPLEMENTARY FIGURES

Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and

Supplementary Figure 1

CONTRACTING ORGANIZATION: The Massachusetts General Hospital Boston, MA 02114

Supplementary Information

RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays

PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65

Personalized cancer therapy has attracted much attention

Epidermal growth factor receptor (EGFR) tyrosine kinase

Activation of Nrf2 by the dengue virus causes an increase in CLEC5A, which enhances TNF-α production by mononuclear phagocytes

Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the

Supplementary Figures

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Supplementary Materials for

Table S1: Analysis of Notch gene rearrangements in triple negative breast cancer subtypes

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β

Normal Skin. Tissue Samples and Melanoma Cell Lines. BRAF Mut. RAS Mut RAS WT /BRAF WT

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein

Supplementary Figure 1. a. b. Relative cell viability. Nature Genetics: doi: /ng SCR shyap1-1 shyap

MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function

Supplementary Figure 1

Supplementary Materials for

Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from

Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Information Titles Journal: Nature Medicine

Role of the pathologist in the diagnosis and mutational analysis of lung cancer Professor J R Gosney

Supplementary Figure 1

Cyclin E amplification, a novel mechanism of resistance to trastuzumab in HER2 amplified breast cancer Sunday, Apr 18, 2010, 2:25 PM - 2:40 PM

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis

Supplementary Information. Table of contents

microrna PCR System (Exiqon), following the manufacturer s instructions. In brief, 10ng of

Supplementary Materials for

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

Supplementary Information

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC

Title page. Title: MicroRNA-155 Controls Exosome Synthesis and Promotes Gemcitabine Resistance in

Corporate Medical Policy

Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

Supplementary Materials and Methods

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

Molecular Testing in Lung Cancer

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

MICROSCOPY PREDICTIVE PROFILING

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Samali A Figure S1.

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION

Osamu Tetsu, MD, PhD Associate Professor Department of Otolaryngology-Head and Neck Surgery School of Medicine, University of California, San

Marine Streptomyces sp. derived antimycin analogues. suppress HeLa cells via depletion HPV E6/E7 mediated by

Supplementary Table S1. List of PTPRK-RSPO3 gene fusions in TCGA's colon cancer cohort. Chr. # of Gene 2. Chr. # of Gene 1

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Cell lines and tissue samples. The 18 human NSCLC cell lines used in this. study included eight adenocarcinoma cell lines (ADCs; A427, A549, LC319,

microrna-200b and microrna-200c promote colorectal cancer cell proliferation via

DeSigN: connecting gene expression with therapeutics for drug repurposing and development. Bernard lee GIW 2016, Shanghai 8 October 2016

Transcription:

S1 of S6 Supplementary Methods: IGFBP7 Drives Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibition in Lung Cancer Shang-Gin Wu, Tzu-Hua Chang, Meng-Feng Tsai, Yi-Nan Liu, Chia-Lang Hsu, Yih-Leong Chang, Chong-Jen Yu and Jin-Yuan Shih Figure S1. Illustration of the integration of multiple rank lists into a single score to identify TKI resistance-related genes. Figure S2. Gene expression correlation between IGFBP7 and IGFBP5 in lung cancer cell lines from Cancer Cell Line Encyclopedia (CCLE) and lung adenocarcinoma tissue from TCGA-LUAD datasets. A B HCC4006/ER Si-scramble Si-IGFBP7-1 Si-IGFBP7-4 Afatinib (μm) 0 0.5 0 0.5 0 0.5 Caspase-7 Cleave-caspase-7 Bim α-tubulin Figure S3. Knock-down IGFBP7 recovers EGFR-TKI sensitivity in EGFR-TKI-resistant cells by increasing apoptosis. (A) EGFR-TKI-resistant cells (HCC4006/ER) were transfected with different IGFBP7 small interfering RNAs (sirnas) (si-igfbp7-1, si-igfbp7-4) or scramble sirna (si-scramble).

S2 of S6 The percentage of apoptotic cells was quantified after treatment with 1.0 µm afatinib for 24 h. The columns are the mean of three independent experiments. Error bars show the standard deviations for n = 3 independent experiments (* p < 0.05). (B) HCC4006/ER was exposed to 1.0 µm of afatinib for 24 h. Next, apoptosis markers, including cleaved-caspase-7 and BIM, were assayed by western blotting. A Fold expression (IGFBP7/TBP) 1.0 0.8 0.6 0.4 0.2 IGFBP7 α-tubulin si-scramble si-igfbp7-1 0 HCC827/gefsi-IGFBP7-1 HCC827/gefsi-scramble B C HCC827/gef Si-scramble Si-IGFBP7-1 Gefitinib (nm) -- 50 250 -- 50 250 PARP Cleave-PARP α-tubulin Figure S4. Knockdown of IGFBP7 expression reversed EGFR-TKI resistance in HCC827/gef cells by enhancing EGFR-TKI-induced cleave-parp expression (A) HCC827/gef cells were transfected with IGFBP7 small interfering RNAs (sirna; si-igfbp7-1) or scramble sirna (si-scramble). The effect of sirnas was evaluated by quantitative RT-PCR (left) and western blot analysis (right). (B) Cellular viability of si-scramble and si-igfbp7 transfectants was determined at different doses of gefitinib for 96 h using MTS assays. Error bars show the standard deviations for n = 3 independent experiments. (*** p < 0.001). (C) HCC827/gef was exposed to 50 and 250 nm of gefitinib for 24 h. Next, the apoptosis marker cleaved-parp was assayed by western blot analysis.

S3 of S6 No. Table S1 Gene expression profiles of TKI-sensitive and TKI-resistant human lung cancer cell lines from GEO. Source TKI- Resistant Cells GSM2124851 TKI-Resistance Cell Lines EGFR TKI TKI-Sensitive Cells TKI- Sensitive Cell Lines HCC4006 1 GSE80344 HCC4006-RC2.2-rep1 GSM2124848 GSM2124859 HCC4006-RC2.2-rep2 GSM2124856 HCC4006 2 GSE80344 GSM2124847 HCC827-RA1-rep1 GSM2124855 HCC827-RA1-rep2 GSM2124858 HCC827 3 GSE80344 GSM2124852 HCC827-RA2-rep1 GSM2124860 HCC827-RA2-rep2 GSM2124858 HCC827 4 GSE80344 GSM2124849 HCC827-RB1-rep1 GSM2124857 HCC827-RB1-rep2 GSM2124858 HCC827 5 GSE80344 GSM2124846 HCC827-RB1.1-rep1 GSM2124854 HCC827-RB1.1-rep2 GSM2124858 HCC827 6 GSE80344 GSM2124853 HCC827-RB2-rep1 GSM2124861 HCC827-RB2-rep2 GSM2124858 HCC827 7 GSE103350 GSM2768999 PC9GTR Gefitinib GSM2768998 PC9 8 GSE103350 GSM2769000 PC9OTR Osimiertinib GSM2768998 PC9 9 GSE103350 GSM2769002 HCC827GTR Gefitinib GSM2769001 HCC827 10 GSE103350 GSM2769003 HCC827OTR Osimiertinib GSM2769001 HCC827 11 GSE106765 GSM2850069 PC-9-AR Afatinib GSM2850068 PC9 12 GSE106765 GSM2850070 PC-9-OR Osimiertinib GSM2850068 PC9 13 GSE106765 GSM2850072 HCC827-AR Afatinib GSM2850071 HCC827 14 GSE106765 GSM2850073 HCC827-OR Osimiertinib GSM2850071 HCC827 15 GSE95558 GSM2516279 HCC827 ZDR3 Gefitinib GSM2516278 HCC827 Table S2 IC50 values of EGFR-TKIs examined in this study are summarized. The growth inhibitory effects of EGFR-TKIs were measured using an MTS assay. The cells were treated with increasing doses of gefitinib, erlotinib, and afatinib for 96 h. IC50 values were calculated using SigmaPlot and are shown in the table. Lung cancer cell lines IC50 (μm) Gefitinib (Iressa) (Tarceva) Afatinib (Giotrief) PC9 0.04 0.02 <0.001 PC9/gef 6.01 4.66 0.68 HCC827 <0.0078 <0.0078 <0.0078 HCC827/gef >10 >10 2.6714 HCC4006 0.01 0.06 <0.002 HCC4006/ER 20.05 28.97 2.98

S4 of S6 Table S3 Clinical characteristics of the 102 patients with advanced lung adenocarcinoma administered EGFR-TKIs as first-line treatment. Variable Number of IGFBP7 IHC Patients Positive Negative p-value Total No. 102 53 49 Age median 61.0 59.5 61.5 0.507 # range 28.0 89.6 28.0 85.4 38.5 89.6 Sex Female 66 34 32 0.903 Male 36 19 17 Smoking 0.071 Non-/light smoker 86 48 38 Smoker 16 5 11 EGFR-TKI 0.346 * gefitinib 91 49 42 erlotinib 11 4 7 EGFR mutation 0.628 Del-19 47 22 25 L858R 48 27 21 Other β 7 4 3 # By Mann-Whitney U; * By Fisher exact test; β Other: 2 G719S, one G719A, one L861Q, one G719C+E790A, one G719S+G709A and one L858R+E709V; IHC: Immunohistochemical staining. Table S4 Clinical characteristics of 75 patients with advanced lung adenocarcinoma administered EGFR-TKIs as first-line treatment (cut-off point was the median value of IGFBP7: 544.96 ng/ml). Caption Patient No. Serum IGFBP7 level High Low p-value Total No. 75 38 37 Mean years of age 63.8 66.1 61.1 0.053 * range 42.7 88.5 44.1 88.5 42.7 83.6 Sex 0.110 Female 53 30 23 Male 22 8 14 Smoking 0.708 Nonsmokers 64 33 31 Former/current smokers 11 5 6 T 0.629 1 3 1 2 2 9 2 7 3 1 0 1 4 16 7 9 N 0.186 0 1 0 1 1 4 3 1 2 11 2 9 3 13 5 8 EGFR-TKI 0.430 gefitinib 68 33 35 erlotinib 7 5 2 by Fisher s Exact test; * by Mann-Whitney U test.

S5 of S6 Table S5. List of primers for quantitative RT-PCR. Primers IGFBP7 SPANXA1 HRASLS RNF182 SPANXC LY6D Sequences F: 5 -ACTGGCTGGGTGCTGGTA-3 R: 5 -TGG ATG CAT GGC ACT CAT A-3 F: 5 -AACGAGGCCAACGAGATGAT-3 R: 5 -CTAGTATGGTCGAGGACTCAGATGTT-3 F: 5 -CTGTACTTGGGTGATGGTTACGTTA-3 R: 5 -AGACTTGGCGCTTGTAAAGGAC-3 F: 5 -TCTTAGAGGCAGGACTTGATGA-3 R: 5 -AAGGCCACATGAAGGGTTC-3 F: 5 -CAACGAGGTGAATGAGACGA-3 R: 5 -TGGTCGAGGACTCAGATGTTT-3 F: 5 -CGAACACAGTGGAGCCTCTGA-3 R: 5 -AGCTTCTCATTGCACAGGTCC-3 Table S6. List of antibodies for western blot analysis. Primary antibody Company Dilution IGFBP7 R&D Systems 1:2000 PARP Cell Signaling 1:1000 caspase-3 Cell Signaling 1:1000 caspase-7 Cell Signaling 1:1000 Bim Cell Signaling 1:1000 pigf1r Santa Cruz 1:500 IGF1R GeneTex 1:1000 pakt Cell Signaling 1:1000 Akt Cell Signaling 1:2000 perk Cell Signaling 1:1000 Erk Cell Signaling 1:2000 α-tubulin Millipore 1:3000 β-actin Millipore 1:3000 Supplementary Method Data sources and gene ranking We collected gene the expression profiles of TKI sensitive and TKI-resistant human lung cancer cell lines from the GEO with accession numbers GSE80344, GSE10335, GSE106765, and GSE95558 consisting of 15 comparisons of TKI-resistant to TKI-sensitive cell lines (Table S1). The raw data from GSE106765 were processed using R affy packages and normalized by Frozen Robust Multi-Array Analysis implemented in the frma packages [1]. The raw data from GSE80344 were processed, including background correction, quantile normalization, and summarization, using the limma package in R [2]. The read counts from GSE10335 and GSE95558 were normalized by the trimmed mean of M-values normalization method (TMM) implemented by edger [3]. For each comparison, NOISeq [4] was performed to obtain the logarithm fold-change (logfc) and probability of differential expression (prob) between TKI-resistant and TKI-sensitive cells. The TKI resistance-related score was defined as follows: Score = sign(logfc) prob Where sign () is the sign function. Genes were ranked in descending order based on this score. Rank list fusion The discounted rating system was used to combine these ranking lists into a single score [5]. Briefly, for each rank list, genes were categorized into ten equal-size bins based on their rank positions and assigned ratings ranging from 10 to 1. A higher rating indicates that the gene was more

S6 of S6 relevant to TKI resistance. In the next step, the discounted rating for each gene (dri) was calculated using the following formula: ranting dr = log (r +1) Where ratingi and ri are the rating and rank position of the investigated gene in experiment i, respectively. Finally, the combined score for the investigated gene was the mean value of the eight highest discounted ratings of the experiments, and the genes were ranked according to this score. References 1. McCall, M.N.; Jaffee, H.A.; Irizarry, R.A. frma ST: Frozen robust multiarray analysis for Affymetrix Exon and Gene ST arrays. Bioinformatics 2012, 28, 3153 3154. 2. Ritchie, M.E.; Phipson, B.; Wu, D.; Hu, Y.; Law, C.W.; Shi, W.; Smyth, G.K. Limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015, 43, e47. 3. Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edger: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139 140. 4. Tarazona, S.; Furio-Tari, P.; Turra, D.; Pietro, A.D.; Nueda, M.J.; Ferrer, A.; Conesa, A. Data quality aware analysis of differential expression in RNA-seq with NOISeq R/Bioc package. Nucleic Acids Res. 2015, 43, e140. 5. Li, Y.; Patra, J.C. Integration of multiple data sources to prioritize candidate genes using discounted rating system. BMC Bioinformatics 2010, 1, doi: 10.1186/1471-2105-11-S1-S20. 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback