The splicing regulation and clinical significance of epithelial splicing regulatory protein 1 in invasion and metastasis of epithelial ovarian cancer

Similar documents
microrna-200b and microrna-200c promote colorectal cancer cell proliferation via

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

mirna Dr. S Hosseini-Asl

Award Number: W81XWH TITLE: Characterizing an EMT Signature in Breast Cancer. PRINCIPAL INVESTIGATOR: Melanie C.

SUPPLEMENTARY FIGURES

Cancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz

supplementary information

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier

Review Article Long Noncoding RNA H19 in Digestive System Cancers: A Meta-Analysis of Its Association with Pathological Features

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or

ROLE OF TGF-BETA SIGNALING IN PIK3CA-

SUPPLEMENTARY INFORMATION

Supplementary Figures

Tumor microenvironment Interactions and Lung Cancer Invasiveness. Pulmonary Grand Rounds Philippe Montgrain, M.D.

Association of BTBD7 with Metastasis and Poor Prognosis in Non-Small-Cell Lung Cancer Patients

Cancer Biology Course. Invasion and Metastasis

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, MD

RESEARCH ARTICLE. Wen-Shuang Wang 1,2, Xing-Sheng Yang 2, Min Xia 1, Hai-Yang Jiang 1, Jian-Qing Hou 1 * Abstract. Introduction

Development of Carcinoma Pathways

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting

The heterogeneity of cancer stem like cells at the invasive front

Histological Typing Of Cancer And Precancer Of The Oral Mucosa

High Expression of Forkhead Box Protein C2 is Related to Poor Prognosis in Human Gliomas

CD44 splice isoform switching in human and mouse epithelium is essential for epithelialmesenchymal

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases

Maximizing the Potential of Population-Based Cancer Registries to Inform Cancer Research

Cell Polarity and Cancer

Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas

SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer.

VIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer

Does EMT Contribute to Radiation Resistance in Human Breast Cancer?

Neoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

The clinical significance of HPIP and the associated prognosis in cervical cancer

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications

The Hallmarks of Cancer

TGF-β. transforming. growth factor. growth factor-β TGF-β. Transforming growth factor-β TGF-β. Smad. DNA Smad Smad cofactor. transcription factor Smad

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola

An EMT Driven Alternative Splicing Program Occurs in Human Breast Cancer and Modulates Cellular Phenotype

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?

Intracellular and extracellular TGF-β signaling in cancer: some recent topics

Review Article Effect of mir-200b on metastasis of gastric cancer

NEK4 kinase regulates EMT to promote lung cancer metastasis

Original Article Increased LincRNA ROR is association with poor prognosis for esophageal squamous cell carcinoma patients

Practice of Medicine-1 Ovarian Cancer Clinical Correlation

SUPPLEMENTARY FIGURE LEGENDS

ONCOLOGY LETTERS 5: , 2013

cells is enhanced by proinflammatory cytokines derived from RAW macrophage cells

A263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195.

Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer

Original Article Downregulation of microrna-26b functions as a potential prognostic marker for osteosarcoma

CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent

Ovarian cancer: 2012 Update Srini Prasad MD Univ Texas MD Anderson Cancer Center

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Osteopontin (OPN) is a multifunctional protein identified

Expression of long non-coding RNA linc-itgb1 in breast cancer and its influence on prognosis and survival

Cancer cells in vitro

Dynamic cohesin-mediated chromatin architecture controls epithelial mesenchymal plasticity in cancer

CircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer

Purdue e-pubs. Purdue University. Michael K. Wendt Purdue University, Molly A. Taylor. Barbara J. Schiemann. Khalid Sossey-Alaoui

CRIPTO-1 A POSSIBLE NEW BIOMARKER IN GLIOBLASTOMA MULTIFORME PIA OLESEN, MD, PHD STUDENT

Supplementary Table S1. List of PTPRK-RSPO3 gene fusions in TCGA's colon cancer cohort. Chr. # of Gene 2. Chr. # of Gene 1

Advances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016)

How Changes in Central Cancer Registries are Impacting Cancer Research

Contents 1 The Windows of Susceptibility to Breast Cancer 2 The So Called Pre-Neoplastic Lesions and Carcinoma In Situ

Nature Genetics: doi: /ng Supplementary Figure 1. Phenotypic characterization of MES- and ADRN-type cells.

Biochemistry of Carcinogenesis. Lecture # 35 Alexander N. Koval

mir-218 tissue expression level is associated with aggressive progression of gastric cancer

Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis by regulating EZH2 and repressing E-cadherin in esophageal squamous cell carcinoma

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway

A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications

EMT: Epithelial Mesenchimal Transition

Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Cancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz October 11, 2013

Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a

Matrix metalloproteinase 1 and circulating tumor cells in early breast cancer.

Claudin-4 Expression in Triple Negative Breast Cancer: Correlation with Androgen Receptors and Ki-67 Expression

Dr Rodney Itaki Lecturer Anatomical Pathology Discipline. University of Papua New Guinea School of Medicine & Health Sciences Division of Pathology

MiR-181a promotes epithelial to mesenchymal transition of prostate cancer cells by targeting TGIF2

Supplementary Materials for

Marcello Deraco M.D. Responsible Peritoneal Malignancies

Exosomal Del 1 as a potent diagnostic marker for breast cancer : A prospective cohort study

Genetic Testing: When should it be ordered? Julie Schloemer, MD Dermatology

LncRNA NKILA suppresses colon cancer cell proliferation and migration by inactivating PI3K/Akt pathway

Stage 3 ovarian cancer survival rate

HOXC6 and HOXC8 are potentially novel prognosis predictors of esophageal squamous cell carcinoma

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

PBX3/MEK/ERK1/2/LIN28/let-7b positive feedback loop enhances mesenchymal phenotype to promote glioblastoma migration and invasion

H&E, IHC anti- Cytokeratin

Alan G. Casson FRCSC Professor of Surgery & VP Integrated Health Services University of Saskatchewan & Saskatoon Health Region

Stage 3 ovarian cancer survival rate

MicroRNA-132 inhibits migration, invasion and epithelial-mesenchymal transition by regulating TGFβ1/Smad2 in human non-small cell lung cancer

Phosphoproteomics Screen Reveals Akt Isoform-Specific Signals Linking RNA Processing to Lung Cancer

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

microrna Presented for: Presented by: Date:

mir-132 inhibits lung cancer cell migration and invasion by targeting SOX4

Transcription:

The splicing regulation and clinical significance of epithelial splicing regulatory protein 1 in invasion and metastasis of epithelial ovarian cancer Jie Tang MD, Ph.D, Professer Vice director of Department of Gynecologic Oncology Hunan Cancer Hospital Changsha, Hunan Province, China, 410000 Email: tangjie@hnszlyy.com Disclosure of interest: None

Introduction Ovarian Cancer Epidemiology: About 240,000 women are diagnosed each year worldwide The 5th most common cause of cancer death among women in the US.

Introduction Standard treatment: Debulking surgery and chemotherapy; 5-year survival rate of EOC : still less than 30% ; Key of EOC treantment: invasion and metastasis.

Introduction Epithelial-mesenchymal transition (EMT): an abnormally activated during cancer metastasis and recurrence EMT: acquisition of a migratory phenotype leading to increased invasion and metastasis.

Introduction ESRP1(also called RBM35A) : A newly discovered epithelialspecific RNA binding protein regulating alternative splicing events in EMT process Promoting splicing of the epithelial variant of the FGFR2, ENAH, CD44 and CTNND1 transcripts Warzecha CC, Shen S, Xing Y, Carstens RP. The epithelial splicing factors ESRP1 and ESRP2 positively and negatively regulate diverse types of alternative splicing events. RNA biology. 2009;6(5):546.

Introduction ESRP1: Play multiple roles in tumor progression Whether ESRP1 play positive or negative roles during tumor progression remains controversial Functions and roles in ovarian cancer have not been reported yet.. ESRP1 Ovarian cancer 1.Shirakihara T., Horiguchi K., Miyazawa K., Ehata S., Shibata T., Morita I., Miyazono K., Saitoh M. (2011) TGF-β regulates isoform switching of FGF receptors and epithelial-mesenchymal transition. EMBO J. 30, 783 795 2. Shirakihara T., Kawasaki T., Fukagawa A., Semba K., Sakai R., Miyazono K., Miyazawa K., Saitoh M. (2013) Identification of integrin α3 as a molecular marker of cells undergoing epithelial-mesenchymal transition and of cancer cells with aggressive phenotypes. Cancer Sci. 104, 1189 1197 3. Horiguchi K., Sakamoto K., Koinuma D., Semba K., Inoue A., Inoue S., Fujii H., Yamaguchi A., Miyazawa K., Miyazono K., Saitoh M. (2012) TGF-β drives epithelialmesenchymal transition through δef1-medicated downregulation of ESRP. Oncogene 31, 3190 320113. 4.Leontieva O. V., Ionov Y. (2009) RNA-binding motif protein 35A is a novel tumor suppressor for colorectal cancer. Cell Cycle 8, 490 497 5Yae T., Tsuchihashi K., Ishimoto T., Motohara T., Yoshikawa M., Yoshida G. J., Wada T., Masuko T., Mogushi K., Tanaka H., Osawa T., Kanki Y., Minami T., Aburatani H., Ohmura M., Kubo A., Suematsu M., Takahashi K., Saya H., Nagano O.) Alternative splicing of CD44 mrna by ESRP1 enhances lung colonization of metastatic cancer cell. Nat. Commun. 3, 883.

ESRP1 in the heat map (a) and scatter plot (b) of an Affymetrix HTA 2.0 scanning in 3 EOC Vs. 3 normal tissues

An validation of ESRP1 expression in normal ovary and ovarian cancer by three different GEO datasets:*** presents P<0.001

A B The expression of ESRP1 in ovarian cancer and normal tissues measured by Western Blot (A) and RT-PCR (B)

200x 400x ESRP1 was abundant in malignant lesions measured by IHC

ESRP1 was weakly in normal and benign lesions a :normal ovary tissue; b: benign lesions ; c&d: borderline ovarian tumor

Characteristic Case number Expression of ESRP1 low (-/+) High (++/+++) P value Age.yr 50 29 13 16 >50 29 13 16 Staging I 11 8 3 III 47 18 29 Differentiated degree High/ Moderate 21 15 6 Poorly 37 11 26 P=1.000 P=0.040 P=0.002 ESRP1 expression was associated with clinical staging (P=0.04) and differentiation degree (P=0.002).Expression of ESRP1 was measured by HIS(IHC). Epithelial ovarian cancer (EOC) with stage III or low differentiated had a higher expression of ESRP1.

A down-regulation of ESRP-1 in human ovarian cancer cell line HO-8910 by shrna lentivirus,confirmed by RT-PCR and Western Blot.

A B C There was no significant change in cell proliferation between HO8910 and HO8910-shESRP1 (A,CCK-8, P=0.8272), but down-regulation of ESRP1 increased migration (B, Transwell,P<0.0001) and invasion (C, Transwell,P<0.0001) of EOC cells significantly.

Knockdown of ESRP1 promoted EMT measured by RT-PCR

A * B * * P<0.01 C Relative Gene Expression 2.0 1.5 1.0 0.5 0.0 Snail * ESRP-1 NC +TGF-β Relative Snail Expression 1.5 1.0 0.5 0.0 Scrambled-HO8910 si-snail-ho8190 Snail ESRP-1 actin TGF-βinduced EMT(10ng/mL,48h), Snail were continuous activated and the mrna expression of ESRP1 was decreased (A). Down-regulation of snail and slug caused increasing of ESRP1 expression (B,C).

A B * P<0.05 Relative CD44s Expression 2.0 1.5 1.0 0.5 0.0 EV-HO8910 sh-esrp1-ho8910 Both FGFR2-IIIb and FGFR2-IIIc were up regulated in ESRP1 knockdown cells while the mesenchymal IIIc isoform increased more significantly than IIIb isoform (A). Down-regulated of ESRP1 also effectively up-regulated CD44s isoform expression in EOC cells(b).

Discussion 1.Positive or negative roles during ovarian cancer progression? Plastic: during carcinogenesis, ESRP-1 is up-regulated relative to their levels in normal epithelium but down-regulated in invasive fronts.

Discussion 2.What happened in ovarian cancer invasion fronts? EMT

Conclusion ESRP1 played an important role in the progression of carcinogenesis and was associated with disease prognosis in EOC. It regulated alternative splicing events during the EMT process and might provide some potential clinical application in EOC patients.

Questions? Email: tangjie@hnszlyy.com