Supporting Information

Similar documents
Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

Tel: ; Fax: ;

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Appendix. Table of Contents

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

Supplemental information contains 7 movies and 4 supplemental Figures

Supplementary Figure 1. Procedures for p38 activity imaging in living cells. (a) Schematic model of the p38 activity reporter. The reporter consists

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

SUPPLEMENTARY INFORMATION

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

SUPPLEMENTAL INFORMATIONS

Supplemental Information

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

Supplementary Figure 1

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Supplementary Figure S1

Figure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h

Online Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2

Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase

Supplementary information

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.

Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion

A. List of selected proteins with high SILAC (H/L) ratios identified in mass

T H E J O U R N A L O F C E L L B I O L O G Y

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle

Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay

Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Fig. S1. Schematic diagram of minigenome segments.

Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the

SUPPLEMENTARY INFORMATION

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:

Sustained Induction of NF- B Is Required for Efficient Expression of Latent Human Immunodeficiency Virus Type 1

Figures S1-S5, Figure Legends, Table S1 List of primers used in the study

Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation

T H E J O U R N A L O F C E L L B I O L O G Y

Supplemental Figures

Supplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were

NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin

Supplementary Materials

Supplementary Figures

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS

supplementary information

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis

Supplementary methods:

Additional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript.

SUPPLEMENTARY FIGURES AND TABLE

Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells

Phenomena first observed in petunia

Figure S1, Beyer et al.

Control. csarnt -/- Cre, f/f

MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function

The Role of Protein Domains in Cell Signaling

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Plasma exposure levels from individual mice 4 hours post IP administration at the

Boucher et al NCOMMS B

DNA methylation Dots(+) CxxC EGFP DAP

SUPPLEMENTARY INFORMATION

Supplementary Material

Supplementary Information. Novel lentiviral vectors with mutated reverse transcriptase for mrna delivery of TALE nucleases

IAS 2013 Towards an HIV Cure Symposium

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA

Supplementary Fig. 1. Identification of acetylation of K68 of SOD2

Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen

2.5. AMPK activity

oocytes were pooled for RT-PCR analysis. The number of PCR cycles was 35. Two

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.

doi: /nature14508 Rappsilber et al.

Supplementary Data Table of Contents:

Supplementary Materials for

Supplemental Figure 1

Supplementary Figure 1 IL-27 IL

TITLE: Inhibitors of Histone Deacetylases for Radiosensitization of Prostate Cancer

Transduction of lentivirus to human primary CD4+ T cells

Supplementary Materials for

Eukaryotic transcription (III)

Trehalose, sucrose and raffinose are novel activators of autophagy in human. keratinocytes through an mtor-independent pathway

Supplementary Information. Supplementary Figure 1

Supporting Information Table of content

Supplementary Figures

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

SUPPLEMENTARY FIGURES AND TABLES

Transcription:

Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification of OA1- expressing cells in the HeLa-OA1myc population by immunofluorescence (IF) analysis, at the indicated times of tyrosine (Y) starvation. The results are expressed as a percentage of OA1 + cells of the total cells (mean ± SD of 5 10 random fields from 1 experiment representative of 2). (B) Immunoblotting of lysates from HeLa cells stably transfected with an expression vector for rat LAMP1 and clonally selected (HeLa-rLAMP1) after 5 d of culture in the presence (+) or absence ( ) of Y, methionine and cysteine (M/C), or FBS in the medium and decorated with specified Abs. Note the huge accumulation of exogenous rat LAMP1 protein on starvation without amino acids but not without FBS, compared with endogenous LAMP1 and tubulin. (C) Immunoblotting of lysates from M14 and SK-MEL28 melanoma cells after 3 and 4 d of Y starvation and decorated with specified Abs. Note that compared with the loading control (tubulin), the protein levels of both endogenous OA1 and LAMP1 do not increase but rather decrease on starvation. (D) Immunoblotting of lysates from HeLa cells stably transduced with a viral vector for OA1 (HeLa-LOA1SN) after 3 and 4 d of Y starvation and decorated with specified Abs. (E) Immunoblotting of different HeLa clones (#1 #5) stably expressing OA1 under either the human phosphoglycerate kinase 1 (PGK1) promoter (HeLa-PGK1/OA1) or the human elongation factor-1α (EF-1α) promoter (HeLa-EF1/OA1) after 3 d of culture in the presence (+) or absence ( ) of M/C in the medium and decorated with specified Abs. Note the increase of exogenous OA1 protein on starvation. In B, D, and E, the cell lysate from nontransfected HeLa cells, not expressing rat LAMP1 or OA1, serves as a negative control for the specificity of the used Abs. *Nonspecific product recognized by the anti-oa1 Ab. (F) IF analysis of HeLa-PGK1/OA1 clone #2 and HeLa-EF1/OA1 clone #2 after 3 d of M/C starvation and stained with anti-oa1 Ab (green) and Hoechst (blue). The number of OA1 + cells increases on starvation. (Scale bars: 20 μm.) 1of5

Fig. S2. Transgene up-regulation is not reproduced by mammalian target of rapamycin (mtor) inhibition or by p38 activation but by histone hyperacetylation. HeLa-OA1myc cells were treated with PP242 (A and B) or rapamycin (Rapam; C) (mtor inhibitors) for 2 and 5 d, respectively; with anisomycin (Aniso; D and E) or hydrogen peroxide (H 2 O 2 ; F) (p38 activators) for 30 h; or with sodium butyrate (Na But; G) (pan-histone deacetylase inhibitor) for 24 h. (A, C, D, F, and G) Quantification of OA1-expressing cells in the HeLa-OA1myc population after the indicated treatments. The results are expressed as a percentage of OA1 + cells of the total cells and represent the mean ± SEM of three independent experiments (A and D) or the mean ± SD of five random fields (C, F, and G). (B and E) Immunoblotting of HeLa-OA1myc cell lysates decorated with specified Abs to confirm treatment efficacy. *Nonspecific product recognized by the anti phospho-p38 Ab. (H) Total histones H3 and H4 evaluated by immunoblotting of HeLa-OA1myc cell lysates after 3 d of culture in the presence (+) or absence ( ) of tyrosine (Y) or methionine and cysteine (M/C) in the medium and decorated with specified Abs. 2of5

Fig. S3. Inhibition or knockdown of histone deacetylase 4 (HDAC4) but not of other HDACs or sirtuins leads to OA1 up-regulation. (A) Quantification of OA1- expressing cells in the HeLa-OA1myc population by immunofluorescence (IF) analysis after 5 d of the indicated treatments. MC1568 and MC1575 are class II HDAC inhibitors (HDACi); MC2726 and MC2727 are selective inhibitors of HDAC6 and of HDAC3/6, respectively; and nicotinamide (NAM) is a selective inhibitor of sirtuins. Results are expressed as a percentage of OA1 + cells of the total cells [mean ± SD of 5 random fields from 1 experiment representative of 2 (Left)ormean± SEM of 3 independent experiments (Right)]. (B) Quantification of HDAC1, HDAC2, HDAC3, and HDAC4 mrna levels by real-time PCR following transfection with the corresponding sirna (si) compared with the not silencing sirna (si not silencing) or nontransfected (NT) cells. Data are expressed as the fold change vs. nontransfected cells (mean ± SEM of 5 independent experiments; ***P < 0.001, paired two-tailed Student t test vs. not silencing sirna). (Lower) Immunoblotting analysis of HDAC protein levels on whole-cell lysates after transfection with the corresponding sirnas. Antitubulin or antiactin Abs were used as loading controls. Legend continued on following page 3of5

(C) Assessment of OA1 expression in HeLa-OA1myc cells analyzed 72 h after transfection with sirnas against HDAC4 (#2) or not silencing. (Left)IFquantification of OA1-expressing cells presented as a percentage of the total cells (mean ± SEM of 4 independent experiments; *P < 0.05, paired two-tailed Student t test vs. nontransfected cells). (Right) Real-time PCR quantification of OA1 mrna levels expressed as the fold change compared with the amount of the OA1 mrna in nontransfected cells (mean ± SEM of 5 independent experiments; *P < 0.05, paired two-tailed Student t test vs. nontransfected cells). Fig. S4. Class II histone deacetylase (HDAC) inhibitors but not selective HDAC6 inhibitors reactivate latent HIV-1 in ACH-2 cells. (A) Quantification by ChIP and real-time PCR analysis of total and acetylated histone H3 bound to the LTR promoter after 24 and 18 h of MC1568 and trichostatin A (TSA) treatment, respectively, relative to control conditions. The scheme indicates the regions of the LTR promoter amplified by PCR1 and PCR2 primers (black bars), whereas B13 primers were used as a negative control. (Left) Results are normalized to the input DNA and expressed as the fold change vs. control (mean ± SEM of 2 3 independent experiments). (Right) Data represent the ratio of acetylated H3 vs. total H3 and are expressed as the fold change vs. control (mean ± SEM of 2 3 independent experiments). Although the amount of H3 associated with the LTR promoter does not change, its acetylation level increases after treatment. (B) Real-time PCR quantification of unspliced (US) HIV-1 RNA in ACH-2 cells incubated with DMSO (mock of MC1575), MC1575, or TSA at the reported times. Results are expressed as the fold change vs. the amount of US HIV-1 RNA in DMSO conditions at each time point (mean ± SEM of 3 technical replicates of 1 experiment representative of 2). (C) Reverse transcriptase (RT) activity of daily collected supernatants from ACH-2 cells incubated with standard medium (Nil), DMSO, MC1575, or TSA for up to 4 d (mean ± SEM of 3 technical replicates of 1 experiment representative of 3). (D) RT activity of daily collected supernatants from U1 cells incubated with standard medium, DMSO, MC1568, or TNF-α for up to 4 d (mean ± SEM of 2 independent experiments). (E) PCR amplification of HDAC6 and β-actin (ACTB) transcripts in HeLa, ACH-2, and U1 cell lines; HDAC6 is detected in ACH-2 and U1 cells. Blank, amplification in the absence of template. (F) Real-time PCR quantification of US HIV-1 RNA in ACH-2 cells incubated with DMSO (mock of MC2727 and MC2726), MC2727 (HDAC3 HDAC6 inhibitor), MC2726 (HDAC6 inhibitor), or TSA at the reported times. Results are expressed as the fold change vs. the amount of US HIV-1 RNA in DMSO conditions at each time point (mean ± SEM of 3 technical replicates). (G) RT activity of daily collected supernatants from ACH-2 cells incubated with standard medium, DMSO, MC2727, MC2726, or TSA for up to 4 d (mean ± SEM of 3 technical replicates). 4of5

Table S1. List of the sirna duplexes sirna name HDAC1 HDAC2 HDAC3 HDAC4 #1 HDAC4 #2 Not silencing sirna sequence 5 -ggcuccuaaaguaacaucatt-3 5 -ccaccaugcuuuaugugautt-3 5 -aaucagaacucacgccagutt-3 5 -cgacaggccucguguaugatt-3 5 -cgagcacugugguuuacaatt-3 5 -gcaagaaguagaccggauatt-3 HDAC4 sirna indicated with #1 is described in Fig. 3, and HDAC4 sirna indicated with #2 is an alternative duplex giving similar results and described in Fig. S3. HDAC, histone deacetylase. Table S2. List of the primers for real-time PCR and conventional PCR Primer name Primer sequence Conc. T. Eff. Length Primers used for real-time PCR using SYBR Green method (Roche Diagnostics) or conventional PCR OA1 F 5 -ctgatgccccatgaaaacc-3 0.25 54 1.779 105 OA1 R 5 -tgtgctggcatcagaacc-3 ARPC2 F 5 -gtctgacttcctcaaggtgc-3 0.3 54 56 1.814 2.010 153 ARPC2 R 5 -tccagtagcaagtgttccagc-3 DPP9 F 5 -gcaccacctgtggacagcc-3 0.5 56 2.027 84 DPP9 R 5 -actgaccagcagagcgtgg-3 HDAC1 F 5 -ggaaatctatcgccctcaca-3 0.5 56 1.896 168 HDAC1 R 5 -aacaggccatcgaatactgg-3 HDAC2 F 5 -taaatccaaggacaacagtgg-3 0.5 56 1.956 89 HDAC2 R 5 -ggtgagactgtcaaattcagg-3 HDAC3 F 5 -tagacaaggactgagattgcc-3 0.5 56 2.085 120 HDAC3 R 5 -gtgttagggagccagagcc-3 HDAC4 F 5 -ggtttattctgattgagaactgg-3 0.5 56 1.977 146 HDAC4 R 5 -attgtaaaccacagtgctcgc-3 CMV prom. F 5 -aggcgttttgcgctgcttcg-3 0.5 56 1.882 134 CMV prom. R 5 -aagttatgtaacgcggaactcc-3 CMV prom. F2 5 -cgtattagtcatcgctattacc-3 0.5 56 1.853 97 CMV prom. R2 5 -gtggagacttggaaatcccc-3 ACTB prom. F 5 -gagggggtaaaaaaatgctgc-3 0.5 56 1.909 103 ACTB prom. R 5 -cgctcgagccataaaaggc-3 Primers used for real-time PCR using Taq man method (Applied Biosystems) gag sense 5 -acatcaagcagccatgcaaat-3 0.9 60 1.938 104 gag antisense 5 -atctggcctggtgcaatagg-3 gag probe 5 -FAM-catcaatgaggaagctgcag gaatgggataga-tamra3 0.2 Primers used for conventional PCR ACTB F 5 -ccaaccgcgagaagatga-3 1 56 / 97 ACTB R 5 -ccagaggcgtacagggatag-3 HDAC6 F 5 -gaatatcctttgcaactcccc-3 1 56 / 105 HDAC6 R 5 -cctcaagcaggcaatgggc-3 CIDE-A F 5 -aagaggtcgggaatagcgagagtc-3 1 58 / 305 CIDE-A R 5 -ctgcatccctatccacacgtgaacc-3 ACTB, β-actin; ARPC2, actin-related protein 2/3 complex, subunit 2; CIDE-A, cell death-inducing DFF45-like effector A; Conc., primer concentration (μm); DPP9, dipeptidyl-peptidase 9; Eff., primer efficiency; F, forward; HDAC, histone deacetylase; Length, amplicon length (bp); prom., promoter; R, reverse; T., annealing temperature ( C); /, not calculated. 5of5

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback