A New Primer Pair for Detection of Chiamydia pneumoniae by Polymerase Chain Reaction

A New Primer Pair for Detection of Chiamydia pneumoniae by Polymerase Chain Reaction Microbiol. Immunol., 40(1), 27-32, 1996 Yoshifumi Kubota Division of Respiratory Diseases, Department of Medicine, Kawasaki Medical School, 577 Matsushima, Kurashiki, Okayama 701-01, Japan Received August 7, 1995; in revised form, October 11, 1995. Accepted October 13, 1995 Abstract: In order to improve the detection and identification of Chlamydia pneumoniae, new primers for polymerase chain reaction (PCR) were designed based on the DNA base sequence within the 53-kDa protein gene, which is specific for C. pneumoniae. The primers permitted the identification of 24 C. pneumoniae strains collected from different geographical locations, but no reaction was observed with C. trachomatis, C. psittaci nor C. pecorum. The primers were unable to amplify the DNA of bacteria commonly related to respiratory tract infections. The positive amplification was achieved with only 9 EBs/assay. Therefore, the new primers seem to be useful in the diagnosis of C. pneumoniae infections. Key words: Chlamydia pneumoniae, 53-kDa protein, PCR, 53.1-53.2 primer pair Chlamydia pneumoniae, a new species of the genus Chlamydia (7), is regarded as one of the important pathogens of human acute respiratory tract infections (6). In addition, recent studies have suggested that there is a direct association between C. pneumoniae infection and other clinical manifestations, such as coronary artery disease, asthma and sarcoidosis (9, 10, 14, 21). The prevalence of serum antibodies against C. pneumoniae increases with age and affects 50% to 60% of middleaged adults throughout the world (5, 8). Because of the difficulty in the detection of C. pneumoniae organisms in clinical specimens by isolation in cell cultures, direct or indirect immunofluorescent antibody staining (DFA or IFA) and enzyme immunoassay (EIA), an alternative method for detection of the organisms is needed. Although, C. pneumoniae specific primer pairs (HL-1- HR-1 and HM-1-HR-1) established by Campbell et al (1) have been used in polymerase chain reaction (PCR) of clinical diagnosis, and it is understood that the DNA amplified by PCR is highly specific for C. pneumoniae, no one knows which gene is amplified with their primer pairs. lijima et al (11) established a monoclonal antibody (MAb) against the 53-kDa protein which is one of the C. pneumoniae-specific, immunodominant antigens. Using the MAb, the gene encoding the 53-kDa protein was cloned from C. pneumoniae strain YK-41 genomic library constructed in T, gtll by standard methods (24) Abbreviations: bp, base pair; DFA, direct immunofluorescence; EBs, elementary bodies; EIA, enzyme immunoassay; IFA, indirect immunofluorescence; MAb, monoclonal antibody; PCR, polymerase chain reaction. and the DNA sequence was partially determined (H. Izutsu et al, 64th Western Annual Meeting of the Japanese Association for Infectious Diseases, Kurashiki, Okayama, 1994). Based on the sequence, a primer pair was designed and PCR was carried out for evaluation of its specificity and sensitivity. These results indicate that the DNA amplified was specific for C. pneumoniae, and furthermore, they strongly suggest that the newly designed primer pair was applicable to PCR for diagnosis of C. pneumoniae infection. Materials and Methods Organisms. The C. pneumoniae TW-183, AR-39, AR-388 (6), IOL-207 (2), Kajaani-6 (20), YK-41 (12), KKpn-1(11), KKpn-2-14 (13), KKpn-15 (17), KKpn-16-18 (unpublished, C. pneumoniae isolates determined with an MAb, RR-402, purchased from Washington Research Foundation, Seattle, U.S.A.), C. trachomatis L2/434/Bu (22), D/UW-3/Cx (23), C. psittaci meningopneumonitis Cal 10 (3), Budgerigar-1(16), 6BC (19) and C. pecorum E-58 (4) strains were used throughout this study (Table 1). The C. pneumoniae strains were grown in HEp-2 cell cultures by the method of Kuo and Grayston (15) and harvested on day 3 post-inoculation. The C. psittaci and C. trachomatis strains were grown in HeLa 229 cell cultures and harvested on day 2 or 3 post-inoculation. C. pecorum E-58 was grown in MDBK cell cultures and harvested on day 3 post-inoculation. Other bacteria including M. tuberculosis, were obtained from the Clinical Laboratory of Kawasaki Medical School. Inactivated organisms of C. burnetii and B. 27

28 Y. KUBOTA Table 1. Type of Chiamydia and bacteria used melitensis were kindly supplied by Dr. Hirai, Gifu University and Dr. Isayama, Azabu University, respectively (Table 1). Purification and particle counting of organisms. The elementary bodies (EBs) of C. pneumoniae TW-183 were purified, and then counted by the method of Miyashita and Matsumoto (18). DNA extraction and PCR amplification. Chlamydial organisms were pelleted by centrifugation (15,000 X g, for 5 min) and incubated in a mixture consisting of proteinase K (100 l.tg/ml), 0.5% Tween 20 and 0.5% Nonidet P-40 at 55 C for 60 min. Subsequently, the samples were boiled for 10 min. PCR was carried out using a primer pair, 53.1-53.2, for amplification of C. pneumoniae 53-kDa protein gene. To ensure amplification of the target sequence, a restriction endonuclease TthHB8 I (Takara Shuzo Co., Ltd.) cleavage site was included within the sequence to be amplified. Based on the sequence of the 53-kDa protein gene, the oligonucleotides, 5'-d(ATGATCGCGGTTTCTGTTGCCA)-3' for 53.1 and 5'-d(GAGCGACGTTTTGTTGCATCT- C)-3'for 53 were synthesized. The amplification of a 499-bp product was expected with the primer pair. PCR was performed on a 5 tl sample in a total volume of 50 µl. The final mixture contained 0.5 µm primers, 80 µm deoxynucleoside triphosphates (Promega), 1 X PCR buffer [10 mm Tris-HC1(pH 9.0 at 25 C), 50 mm KCI, 0.1% Triton X-100) (TOYOBO Co., Ltd.), 2.5 mm MgCI2 (TOYOBO Co., Ltd.), and 1.0 U of Taq polymerase (TOYOBO Co., Ltd.). The samples were amplified for 40 cycles. Each cycle consisted of the following steps: denaturation at 95 C for 1 min (first cycle for 90 sec), annealing at 56 C for 30 sec and primer extension at 72 C for 1 min in a DNA thermal cycler (Minicycler, FUNAKOSHI). After amplification, the samples were incubated at 72 C for 5 min and stored at 4 C until use in electrophoresis. In accordance with the conditions described by Campbell et al (1), PCR was also carried out with the HL-1-HR-1 primer pair which is known to amplify 437 by of C. pneumoniae DNA. To prevent contamination, separate rooms were used for sample preparation and PCR amplification. Analysis of amplified DNA. Amplification products were analyzed by electrophoresis on a 1.5% agarose gel at 100 V using Tris-acetate-EDTA buffer (ph 8.3). The PCR product amplified with the 53.1-53.2 primer pair is expected to be cut into 373 and 126 by fragments by TthHB8 I digestion. After electrophoresiș the bands were visualized by staining with ethidium bromide (1.0 ~tg/ml). Sequence analysis of PCR product. Amplified DNA was purified through 1.2% low-melt agarose gel electrophoresis. Then the double-stranded amplified DNA was sequenced using a dideoxy terminator cycle sequencing kit (Applied Biosystems, Inc.) and analyzed with an automated DNA sequencer (373S DNA Sequencing System; PERKIN ELMER). Based on the sequence in each single strand, the sequence of amplified DNA was determined.

DETECTION OF C. PNEUMONIAE BY PCR 29 Results Specificity of Primers for C. pneumoniae Based on the DNA sequence of the 53-kDa protein gene in C. pneumoniae strain YK-41, primers were chosen on the bases of G+C ratio, absence of secondary structure and low complementarity to each other as analyzed using the GENETYX software. The sequence to be amplified with the primers within a part of the 53-kDa protein gene is shown in Fig. 1. The size of the amplification product with the 53.1-53.2 primer pair is expected to be 499 bp. DNA extracted from 24 strains of C. pneumoniae (TW-183, AR-39, AR-388, IOL-207, Kajaani-6, YK- 41 and KKpn-1-18), 2 strains of C. trachomatis (L2/434/Bu, D/UW-3/Cx), 3 strains of C. psittaci (meningopneumonitis Cal 10, Budgerigar-1, 613C) and 1 of C. pecorum (E-58) was tested. Without any exceptions, the DNA of C. pneumoniae were amplified resulting in PCR products of 499 by (Fig. 2, a, b, c). In contrast, no product was observed when DNA of C. trachomatis, C. psittaci or C. pecorum were used as the template (Fig. 3). To confirm that the amplified products of C. pneumoniae strains were the target sequence, the product was digested with TthHB8 I. This result clearly showed that the products were cut into 373 and 126 by fragments (Fig. 4). The DNA sequence of the product was also confirmed by direct sequencing with an automated DNA sequencer. The resultant 499 by product was specific for C. pneumoniae and this product was, indeed, the target sequence in the 53-kDa protein gene, as expected. The ability of the 53.1-53.2 primer pair to amplify bacterial flora and pathogens associated with respiratory tract infections (Table 1) was tested. None of them were amplified by the primer pair in the present study. Sensitivity of PCR with the 53.1-53.2 Primer Pair To examine sensitivity, two primer pairs, 53.1-53.2 and HL-1-HR-1, were used in serially diluted suspensions of purified C. pneumoniae TW-183 EBs which were counted by scanning electron microscopy. The results obtained from repeated experiments showed that the bands of PCR products amplified with the 53.1-53.2 primer pair were clearer than those with the HL-1-HR- 1 primer pair. Consequently, the DNA corresponding to Fig. 1. DNA sequence of the C. pneumoniae (YK-41) 53-kDa protein. Primers illustrated by dashed arrows indicating direction of polymerization.

30 Y. KUBOTA Fig. 2. Amplification of C. pneumoniae DNA with the newly designed primer pair, 53.1-53.2. Panel a) C. pneumoniae strains:tw- 183 (lane 2), AR-39 (lane 3), AR-388 (lane 4), IOL-207 (lane 5), Kajaani-6 (lane 6). b) Lanes 2 to 7 C. pneumoniae KKpn-1, -2, -3, -4, -5, and -6, respectively. c) Lanes 2 to 14 C. pneumoniae KKpn-7, -8, -9, -10, -11, -12, -13, -14, -15, -16, -17, -18, and YK-41, respectively. Lane 0 contains marker DNAs. The sizes of the markers are as noted on the left side. Lane 1 contained the negative control (no DNA). PCR products were visualized with UV light following staining with ethidium bromide. Fig. 3. The specificity of PCR product for the detection of C. pneumoniae. All reaction mixtures contained primer pair 53.1-53.2. Lanes: C. pneumoniae TW-183 (lane 1), C. psittaci Budgerigar-1 (lane 2), Cal 10 (lane 3), 6BC (lane 4), C. trachomatis L2/434/Bu (lane 5), DIUW-3/Cx (lane 6), and C. pecorum E-58 (lane 7), respectively. PCR product is seen only in the lane 1. Fig. 4. Digestion of PCR products with restriction endonuclease TthHB8 I. To confirm that the amplified products of C, pneumoniae strains were the target sequence, the PCR products were digested with TthHB8 I. The result clearly shows that the products were cut into 373 and 126 by fragments. Lanes: KKpn-4 (lane 1), KKpn-15 (lane 2) and YK-41 (lane 3), respectively. Lane 0 contains marker DNAs.

DETECTION OF C. PNEUMONIAE BY PCR 31 Fig. 5. Comparison of the PCR sensitivity with two primer pairs, 53.1-53.2 and HL-1-HR-1. Ten-fold dilution of EB suspensions were tested. The sensitivities was evaluated by the number of EBs per assay as test parameter. Lanes: 1-4; 53.1-53.2 primer pair. Lanes: 114'; HL-1-HR-1 primer pair. Lanes: 1 and 1', 9 X 10'; 2 and 2', 9 X 102; 3 and 3, 9 X 10; 4 and 4', 9 (EBs/assay). The detection limit with the 53.1-53.2 primer pair was determined to be 9 EBs/assay (lane 4). only 9 EBs/assay was able to be detected by PCR with the new primer pair (Fig. 5). Discussion The C. pneumoniae species was established in 1989 and has been recognized as an important cause of respiratory tract infections (7). Since then, we have tried to detect the organisms by DFA, IFA and EIA for diagnosis of C. pneumoniae infections. However, because these methods proved to be insufficient in terms of sensitivity and specificity, PCR was developed for detection of C. pneumoniae by Campbell et al (1). However, it has not been clarified which gene was encoded in the target DNA. lijima et al (11) reported that the sera of C. pneumoniae patients contained antibodies against the 53- kda protein which was determined to be immunodominant and that the protein was strictly conserved among C. pneumoniae strains. Using the MAb, the 53-kDa protein gene was partially determined (Izutsu et al, 64th Western Annual Meeting of the Japanese Association for Infectious Diseases, 1994). The DNA sequence was confirmed (though partially) to be C. pneumoniae-specific. This was the reason why the primer pair 53.1-53.2 was newly designed and applied to PCR targeting the gene of the 53-kDa protein. All C. pneumoniae strains examined so far were positive on PCR with the 53-kDa protein primer pair and the PCR product was confirmed to be the expected DNA by the digestion with the restriction endonuclease and by direct sequencing. In contrast, no PCR product was obtained for C. trachomatis, C. psittaci, C. pecorum and other bacteria at any position of the molecular mass, indicating that the PCR product amplified with the 53.1-53.2 primer pair was specific for C. pneumoniae. Because of the constant quantity of the target DNA in EBs, the sensitivity of PCR was examined to indicate the number of EBs as a test parameter. Purified EB suspension in which the number of EBs was counted was serially diluted and then the DNA extracted from each dilution was assayed with both primer pairs, 53.1-53.2 and HL-1-HR-1. The results showed that the bands of PCR products with the 53.1-53.2 primer pair were clearer than those with the HL-1- HR-1 primer pair, and that 9 EBs and more were able to be detected with the new primer pair. The sensitivity of PCR with the new primer pair appeared to be greater than that of the primer pair developed by Campbell et al (1), and the new primer pair seems to be applicable for detection of C. pneumoniae organisms. The target DNA of the new primer pair was confirmed to be the 53-kDa protein gene specific for C. pneumoniae. Therefore, the primer pair may be used in direct association with detection of serum antibody to the 53-kDa protein. This seems to be advantageous not only for diagnosis of C. pneumoniae infection, but also for follow-up of clinical signs from two different approaches, the detection of organisms by PCR with the new primer pair and the detection of antibody against the 53-kDa protein by serological methods such as EIA and immunoblotting. This work was directed by Prof. R. Soejima, Division of Respiratory Diseases, Department of Medicine, Kawasaki Medical School. The author is grateful to Prof. A. Matsumoto, Drs. Y. Iijima, Department of Microbiology, T. Kishimoto, and Y Niki, Department of Medicine, Kawasaki Medical School and Mr. H. Izutsu, Hitachi Chemical Co., Ltd. for their technical support and advice. The author also acknowledges Mr. Y. Kurokawa, Department of Clinical Laboratory, Kawasaki Medical School for supplying the bacterial strains, Dr. K. Hirai, Faculty of Agriculture, Division of Veterinary Medicine, Laboratory of Microbiology, Gifu University for supplying C. burnetii and Dr. Y Isayama, Department of Immunology, College of Environmental Health, Azabu University for supplying B. melitensis. This work was supported by a Project Research Grant #6-506 from Kawasaki Medical School and a Grant-in-Aid for Scientific Research #07670-685 from the Ministry of Education, Science and Culture, Japan. References 1) Campbell, L.A., Melgosa, M.P., Hamilton, D.J., Kuo, C.-C., and Grayston, J.T. 1992. Detection of Chlamydia pneumoniae by polymerase chain reaction. J. Clin. Microbiol. 30: 434-439. 2) Dwyer, R.St.C., Treharne, J.D., Jones, B.R., and Herring, J. 1972. Chlamydial infection: results of micro-immunofluorescence tests for the detection of type-specific antibody in

32 Y. KUBOTA certain chlamydial infections. Br. J. Vener. Dis. 48: 452-459. 3) Francis, T., Jr., and Magill, T.O. 1938. An unidentified virus producing acute meningitis and pneumonitis in experimental animals. J. Exp. Med. 68: 147-163. 4) Fukushi, H., and Hirai, K. 1992. Proposal of Chlamydia pecorum sp. nov. for Chlamydia strains derived from ruminants. Int. J. Syst. Bacteriol. 42: 306-308. 5) Grayston, J.T., Campbell, L.A., Kuo, C.-C., Mordhorst, C., Saikku, P., Thom, D., and Wang, S.-P. 1990. A new respiratory tract pathogen: Chlamydia pneumoniae, strain TWAR. J. Infect. Dis. 161: 618-625. 6) Grayston, J.T., Kuo, C.-C., Wang, S.-P., and Altman, J. 1986. A new Chlamydia psittaci strain, TWAR, isolation in acute respiratory tract infections. N. Engl. J. Med. 315: 161-168. 7) Grayston, J.T., Kuo, C.-C., Campbell, L.A., and Wang, S.-P. 1989. Chlamydia pneumoniae sp. nov. for Chlamydia sp. strain TWAR. Int. J. Syst. Bacteriol. 39: 88-90. 8) Grayston, J.T, Wang, S.-P., Kuo, C.-C., and Campbell, L.A. 1989. Current knowledge on Chlamydia pneumoniae, strain TWAR, an important cause of pneumoniae and other acute respiratory diseases. Eur. J. Clin. Microbiol. Infect. Dis. 8: 191-202. 9) Gronhagen-Riska, C., Saikku, P., Riska, H., Froseth, B., and Grayston, J.T. 1988. Antibodies to TWAR, a novel type of Chlamydia in sarcoidosis, p. 297-301. In Grassi, C., Rizzato, G., and Pozzi, E. (eds), Sarcoidosis and other granulomatous disorders. Excerpta-Medica, New York. 10) Hahn, D.L., Dodge, R.W., and Golubjatnikov, R. 1991. Association of Chlamydia pneumoniae (strain TWAR) infection with wheezing, asthmatic bronchitis, and adult-onset asthma. JAMA 266: 225-230. 11) lijima, Y., Miyashita, N., Kishimoto, T., Kanamoto, Y, Soejima, R., and Matsumoto, A. 1994. Characterization of Chlamydia pneumoniae species-specific proteins immunodominant in humans. J. Clin. Microbiol. 32: 583-588. 12) Kanamoto, Y, and Sakano, T. 1992. Isolation of Chlamydia pneumoniae from a patient with acute bronchitis. J. Jpn. Assoc. Infect. Dis. 66: 637-642 (in Japanese). 13) Kishimoto, T., and Soejima, R. 1993. Current topics of Chlamydial respiratory tract infections-special reference to the epidemiology and clinical findings of Chlamydia pneumoniae infections in Japan. Intern. Med. 32: 934-937. 14) Kuo, C.-C., Shor, A., Campbell, L.A., Fukushi, H., Patton, D.L., and Grayston, J.T. 1993. Demonstration of Chlamydia pneumoniae in atherosclerotic lesions of coronary arteries. J. Infect. Dis. 167: 841-849. 15) Kuo, C.-C., and Grayston, J.T. 1990. A sensitive cell line. HL cells for isolation and propagation of Chlamydia pneumoniae strain TWAR. J. Infect. Dis. 162: 755-758. 16) Matsumoto, M., Omori, T., Inaba, Y., Ishitani, R., Kuroki, H., Morimoto, T., and Ishii, S. 1957. Miyagawanella: psittacosislymphogranuloma group of viruses. Jpn. J. Exp. Med. 27: 191-205. 17) Miyashita, N., Kubota, Y, Kimura, M., Nakajima, M., Niki, Y., Soejima, R., and Matsumoto, A. 1994. Characterization of Chlamydia pneumoniae strain isolated from a 57-year-old man. Microbiol. Immunol. 38: 857-864. 18) Miyashita, N., and Matsumoto, A. 1992. Establishment of a particle-counting method for purified elementary bodies of Chlamydiae and evaluation of sensitivities of the IDEIA Chlamydia kit and DNA probe by using the purified elementary bodies. J. Clin. Microbiol. 30: 2911-2916. 19) Morgan, H.R., and Wiseman, R.W. 1946. Growth of psittacosis virus in roller tube tissue culture; use in a vaccine. J. Infect. Dis. 79: 131-133. 20) Popov, V.L., Shatkin, A.A., Pankratova, V.N., Smirmova, N.S., von Bonsdorff, C.-H., Ekman, M.-R., Morttnen, A., and Saikku, P. 1991. Ultrastructure of Chlamydia pneumoniae in cell culture. FEMS Microbiol. Lett. 84:129-134. 21) Saikku, P., Leinonen, M., Tenkanen, L., Linnanmak, E., Ekman, M.-R., Manninen, V., Manttari, M., Frick, M.H., and Huttunen, J.K. 1992. Chronic Chlamydia pneumoniae infection as a risk factor for coronary heart disease in the Helsinki Heart Study. Ann. Intern. Med. 116: 273-278. 22) Schachter, J., and Meyer, K.F. 1969. Lymphogranuloma venereum. II. Characterization of some recently isolated strains. J. Bacteriol. 99: 636-638. 23) Wang, S.-P., and Grayston, J.T. 1970. Immunologic relationship between genital tric, Lmphogranuloma venereum, and related organisms in a new microtiter in direct immunofluorescence test. Am. J. Ophthalmol. 70: 367-374. 24) Young, R.A., and Davis, R.W. 1983. Efficient isolation of genes by using antibody probes. Proc. Natl. Acad. Sci. U.S.A. 80: 1194-1198.