FEBS Letters 581 (2007) 2954 2958 Wnt signling enhnces the ctivtion nd survivl of humn heptic stellte cells Sun Jung Myung, Jung-Hwn Yoon, *, Geum-Youn Gwk, Won Kim, Jeong-Hoon Lee, Kng Mo Kim, Chn Soo Shin, J June Jng, Sung-Hee Lee, Soo-Mi Lee, Hyo-Suk Lee Deprtment of Internl Medicine nd Liver Reserch Institute, Seoul Ntionl University College of Medicine, Seoul, Repulic of Kore Deprtment of Pthology, Seoul Ntionl University College of Medicine, Seoul, Repulic of Kore Received 25 Jnury 2007; revised 9 My 2007; ccepted 18 My 2007 Aville online 29 My 2007 Edited y Veli-Pekk Lehto Astrct Wnt signling ws implicted in pulmonry nd renl firosis. Since Wnt ctivity is enhnced in liver cirrhosis, Wnt signling my lso prticipte in heptic firogenesis. Thus, we determined if Wnt signling modultes heptic stellte cell (HSC) ctivtion nd survivl. Wnt3A tretment significntly ctivted humn HSCs, while this ws inhiited in secreted frizzled-relted protein 1 () overexpressing cells. Wnt3A tretment significntly suppressed TRAIL-induced poptosis in HSCs versus over-expressing cells. Prticulrly, cspse 3 ws more ctivted in over-expressing cells following TRAIL nd Wnt3A tretment. These oservtions imply tht Wnt signling promotes heptic firosis y enhncing HSC ctivtion nd survivl. Ó 2007 Federtion of Europen Biochemicl Societies. Pulished y Elsevier B.V. All rights reserved. Keywords: Heptic stellte cell; Firosis; Wnt; Secreted frizzled-relted protein 1; Apoptosis 1. Introduction Heptic firosis is common wound-heling response to chronic liver injuries, including persistent virl infection, lcoholic or drug toxicity nd hereditry metl overlod [1]. Activted heptic stellte cells (HSCs) re the most importnt source of extrcellulr mtrix proteins during this firotic process [2]. Therefore, the mjority of nti-firotic therpies re designed to inhiit the ctivtion, prolifertion, or synthetic products of HSCs. More recently, the selective induction of HSC poptosis y TRAIL (tumor necrosis fctor-relted poptosis-inducing lignd) hs een proposed s n nti-firotic tretment [3]. Verterte Wnt nd Drosophil wingless re homologous genes, nd their protein products hve een shown to prticipte in the regultion of cellulr differentition, prolifertion, nd polrity [4]. More recently, Wnt signling ws implicted in humn firosing diseses, such s pulmonry nd renl firosis [5,6]. Given tht Wnt ctivity is enhnced in liver cirrhosis [7], it is lso likely tht Wnt signling prticiptes in heptic firogenesis. Secreted frizzled-relted proteins (sfrps) re solule proteins tht re cple of inding to Wnt nd its receptor, frizzled (Fz), * Corresponding uthor. Fx: +82 2 743 6701. E-mil ddress: yoonjh@snu.c.kr (J.-H. Yoon). nd therey, interfere with Wnt signling [8]. Diverse sfrp fmily memers exhiit distinctive expression ptterns, nd modulte vrious spects of Wnt signling. In prticulr, plys prominent role in the regultion of cellulr poptosis, differentition, nd ngiogenesis [4,8]. If Wnt ctivtion promotes heptic firosis, the inhiition of this signling y sfrp is likely to ttenute the Wnt-dependent ctivtion of heptic firosis. In the present study, we hypothesized tht Wnt signling promotes heptic firosis, nd tht the inhiition of this signling y sfrp ttenutes the Wnt-dependent ctivtion of heptic firosis. To test this hypothesis, we formulted the following questions: (i) Are Wnt receptors expressed in humn HSCs? (ii) Does Wnt signling enhnce the ctivtion or nti-poptotic signling of HSCs? And if so, (iii) Does sfrp inhiit these Wntdependent processes in HSCs? Collectively, our results demonstrte tht Wnt signling does prticipte in heptic firosis y enhncing HSC ctivtion nd survivl, nd tht this process is effectively prevented y over-expression, thus suggesting tht the selective interruption of this signling pthwy my provide n efficient nti-firotic strtegy in heptic firosis. 2. Mterils nd methods 2.1. Cell culture nd regents LX-2 cells, n immortlized humn HSC line, were used in this study, nd were cultured in Dulecco s modified Egle medium (DMEM) supplemented with 10% fetl ovine serum, 100,000 U/L penicillin, 100 mg/l streptomycin, nd 100 nm insulin. Cells were plted t 5 10 4 cells/well in 1 ml of medi or 10 6 cells in 5 ml of medi in 6-well plte or 100-mm culture dish, respectively. Wnt3A-conditioned or medium ws prepred from stly trnsfected mouse L cell clone, which secreted solule Wnt3A proteins into the medium, or L cells, respectively, s previously descried with minor modifiction [9], nd ws diluted to finl concentrtion of 30%. TRAIL ws purchsed from Alexis (Sn Diego, CA). 2.2. Isoltion of HSCs from norml humn liver tissues HSCs were isolted from norml dult liver specimen otined during the surgicl resection of metsttic tumor y collgense/pronse digestion, followed y density grdient centrifugtion using Nycodenz, s descried previously [10]. The purity of the isolted HSCs, s determined y vitmin A utofluorescence, ws more thn 97% t 24 h fter plting. The humn mteril used in this study ws normlly discrded specimen, nd the study protocol ws pproved y the Institutionl Review Bord of Seoul Ntionl University Hospitl. 2.3. Reverse trnscription-polymerse chin rection (RT-PCR) Totl RNA ws extrcted from cells using Trizol Regent (Invitrogen, Crlsd, CA). cdna templtes were prepred using oligo-dt rndom primers nd MoMLV (Moloney Murine Leukemi Virus) 0014-5793/$32.00 Ó 2007 Federtion of Europen Biochemicl Societies. Pulished y Elsevier B.V. All rights reserved. doi:10.1016/j.feslet.2007.05.050
S.J. Myung et l. / FEBS Letters 581 (2007) 2954 2958 2955 reverse trnscriptse. PCR ws performed using primers specific for the Fz genes (forwrd, 5 0 -cgcgtcttgcccgccgtcc; reverse, 5 0 - ctgcgccgctcttcgtgtcctg) [11]. To exclude the possiility of the presence of genomic DNA in the rection, we performed rections without the RT step. RT-PCR products were sucloned using TOPO TA cloning kits (Invitrogen). Positive clones were sequenced using n ABI PRISM Ò 377 Genetic Anlyzer (Applied Biosystems, Sn Frncisco), nd genes were identified y BLAST serching. 2.4. Vectors The cdna clone ws gift from Dr. Jeremy Nthns (Johns Hopkins University, Bltimore, MD). A hemgglutinin epitope ws incorported t the C-terminl of y PCR, nd then ligted into the BglII/EcoRI site of pmscv-ires-gfp retrovirl vector ( gift from Neil A. Clipstone, Northwestern University, Chicgo, IL) upstrem of IRES to give pmscv--ires-gfp. 2.5. Retrovirus genertion nd trnsduction For the trnsient genertion of VSV-G pseudo-typed retrovirus, 293T cells were trnsfected with pmd-gg-pol, pmd-vsvg (oth gifts from Dr. Richrd C. Mullign (Hrvrd Medicl School, Boston, MA)) nd the retrovirl vectors pmscv--ires-gfp or pmscv-ires-gfp using LipofectAMINE Plus regents (Invitrogen, Crlsd, CA). LX-2 cells were trnsduced with virus-contining superntnts in the presence of 8 lg/ml of Polyrene for 6 h nd cells were collected 48 h lter. GFP-positive frctions were FACS-sorted using BD FACS Vntge Cell Sorter (Frnklin Lkes, NJ). 2.6. Reporter gene ssy Cells were cotrnsfected over 24 h using 20 ng TK Renill-CMV nd 0.2 lg TCF reporter plsmid (Upstte Biotechnology Inc., Lke Plcid, NY). Firefly nd Renill luciferse ctivities were quntitted using dul luciferse reporter ssy system (Promeg, Mdison, WI). Dt re expressed s rtios of firefly to Renill luciferse ctivity. 2.7. Rel-time PCR Totl RNA ws extrcted nd cdna templtes were prepred s descried ove. Collgen 1 mrna ws quntitted using rel-time PCR technology nd the following primers: forwrd, 5 0 -ctgccccgtg, reverse, 5 0 -cttgtttcctgtgtcttctgg. Universl 18S primers (Amion Inc., Austin, TX) were used s for RNA integrity nd s housekeeping gene. For quntittion, we used rel-time PCR (LightCycler, Roche Moleculr Biochemicls, Mnnheim, Germny) nd SYBR green s the fluorophore (Moleculr Proes, Eugene, OR). 2.8. Apoptosis Apoptosis ws induced in LX2 cells using TRAIL [3], nd ssessed y exmining chrcteristic nucler chnges (i.e., chromtin condenstion nd nucler frgmenttion) using the nucler inding dye 4 0,6- dimidino-2-phenylindole dihydrochloride (DAPI) nd fluorescence microscopy (Zeiss, Germny). 2.9. Immunolotting Cell lystes were resolved y SDS PAGE, nd lotted using pproprite primry ntiodies nd peroxidse-conjugted secondry ntiodies (Biosource Interntionl, Cmrillo, CA). The primry ntiodies used were; rit nti-cspse 9 from Cell Signling Technology Inc. (Beverly, MA); rit nti-cspse 8, mouse nti-cytochrome c nd rit nti-cspse 3 from Phrmingen (Sn Diego, CA); mouse nti--smooth muscle ctin from BioGenex (Sn Rmon, CA); nd rit nti- nd got nti--ctin from Snt Cruz Biotechnology Inc. (Snt Cruz, CA). 2.10. Immunoprecipittion nlysis Cells were treted with Wnt3A-conditioned medi for 24 h, nd poptosis ws induced using TRAIL. The cell lystes otined were mixed with nti-ser for XIAP (X chromosome-linked inhiitor of poptosis protein) (Cell Signling Technology Inc.), nd then incuted overnight t 4 C. Immune complexes were immunoprecipitted with protein A/G PLUS-Agrose (Snt Cruz) nd then wshed for 5 10 min with 1 ml of wshing uffer. After wshing, polypeptides were resolved y oiling with Lemmli smple uffer, nd then immunolotted for cspse 9. 2.11. Sttisticl nlysis All numericl dt represent t lest three independent experiments using cells from minimum of three seprte isoltions nd re expressed s mens ± S.D. Groups were compred using two-tiled Student s t-tests. 3. Results 3.1. Identifiction of Wnt receptors in humn HSCs RT-PCR using primers tht ind to the conserved sequences of ll Fz genes were used to visulize the expressions of these genes in oth LX-2 cells nd primrily isolted humn HSCs (Fig. 1). PCR products from LX-2 cells were cloned using the TA cloning procedure, nd rndom clones were nlyzed y sequencing. Six out of sixteen clones sequenced were identified s contining Fz gene sequences, such s Fz-2, Fz-7, nd Fz-10, y BLAST serching (Fig. 1). These findings indicte tht humn HSCs re cple of responding to Wnt stimulus. 3.2. Estlishment of humn HSC line over-expressing To inhiit Wnt signling in HSCs, we estlished humn HSC line over-expressing y infecting LX-2 cells with n /GFP expression vector nd y the flow cytometric cloning of GFP-expressing cells. over-expression in these cells ws confirmed y immunolot nlysis (Fig. 2). 3.3. Functionl nlysis of Wnt ctivity in humn HSCs We next evluted whether cnonicl Wnt signling is functionlly ctive in humn HSCs, nd whether this is inhiited in over-expressing cells. For this purpose, cells were stimulted using Wnt3A, which is cple of ctivting the cnonicl Wnt pthwy. Cnonicl Wnt signling ctivity ws evluted y TOPflsh TCF-luciferse reporter gene ssy. Following Wnt3A-conditioned medi tretment, twofold increse in TOPflsh reporter gene ctivity ws oserved in cells, wheres this ws significntly suppressed in over-expressing cells (Fig. 2). These findings indicte tht the cnonicl Wnt signling pthwy is functionlly ctive in humn HSCs. 3.4. Wnt regultion of HSC ctivtion The expressions of collgen 1 nd -smooth muscle ctin (firosis-relted mrkers during HSC ctivtion) were compred in nd over-expressing HSCs. Tretment of cells with Wnt3A-conditioned medi for 24 h incresed collgen 1 mrna levels, wheres this ws not oserved in over-expressing cells (Fig. 3). In similr wy, -smooth muscle ctin expression ws incresed in cells following Wnt3A tretment, wheres this ws not evident in over-expressing cells (Fig. 3). These findings indicte cnonicl Wnt signling prticiptes in HSC ctivtion. 3.5. Wnt signling in HSC poptosis We next evluted if Wnt signling modultes HSC survivl y regulting cellulr poptotic processes. When cells were
2956 S.J. Myung et l. / FEBS Letters 581 (2007) 2954 2958 Fig. 1. Expression of Fz (frizzled) gene fmilies in humn HSCs. () Totl cellulr RNA ws isolted from LX-2 cells nd HSCs otined from resected humn liver. Reverse trnscription PCR ws performed using primers specific for the Fz gene. NC, negtive. () RT-PCR products of LX2 cells were sucloned nd sequenced. Expressed Fz genes were identified y BLAST serching. F/Rrtio β-ctin 40 30 20 10 p < 0.05 p < 0.05 30KD Collgen α1/18s rtio 5.0 4.0 3.0 2.0 1.0 0 p < 0.05 p < 0.05 0 24 48 0 24 48 h Control Control 0 24 48 0 24 48 h 0 Wnt3A-CM(-) Wnt3A-CM(+) Wnt3A-CM(+) Fig. 2. Estlishment of humn HSC line over-expressing. () LX-2 cells were either infected with retrovirl vector pmscv- IRES-GFP or pmscv--ires-gfp encoding. GFPexpressing cells were then flow cytometriclly cloned. Lystes of nd over-expressing cells were immunolotted with nti- nd nti--ctin ntiodies. () Control nd overexpressing cells were cotrnsfected with TK Renill-CMV nd TCF reporter plsmid. Cells were then treted with Wnt3A-conditioned medi (CM) for 24 h. Both firefly nd Renill luciferse ctivities were quntitted using dul luciferse reporter ssy system. Dt re expressed s rtios of firefly to Renill luciferse ctivity. α -smooth muscle ctin β-ctin Fig. 3. Wnt regultion of HSC ctivtion. () Control nd over-expressing cells were treted with Wnt3A-CM for the indicted times. Totl cellulr RNA ws isolted nd rel-time PCR ws then performed. Results re expressed s rtios of collgen 1 product copies/ml to 18S copies/ml, ssuming tht of the time 0 s 1. All dt re expressed s the mens ± S.D. of five individul experiments. () Control nd over-expressing cells were treted with Wnt3A- CM for the indicted times. Cells were then lysed nd immunolot nlysis ws performed for -smooth muscle ctin nd -ctin. treted with TRAIL, Wnt3A incution significntly suppressed cellulr poptosis in cells versus over-expressing cells (Fig. 4). As shown in Fig. 4, TRAILinduced cspse 8, cytochrome c, nd cspse 9 modultions were similr in nd over-expressing cells, wheres cspse 3 ctivtion ws more enhnced in over-expressing cells thn in cells (Fig. 4). To further chrcterize the mechnism underlying enhnced cspse 3 ctivtion in these cells, we immunoprecipitted XIAP from cell lystes, nd then immunolotted these precipittes with
S.J. Myung et l. / FEBS Letters 581 (2007) 2954 2958 2957 cspse 8 cytochrome c cspse 9 Control 0 2 4 0 2 4 h 55KD 15KD 47KD 35KD TRAIL cspse 9 XIAP PC Control + _ + _ + 47KD 35KD 53KD cspse 3 β-ctin 18KD IP:XIAP Fig. 4. Wnt signling nd HSC poptosis. () Control nd over-expressing cells were incuted with or without Wnt3A-CM for 24 h. Cells were then incuted with TRAIL for 9 h. Apoptosis ws quntitted y DAPI stining nd fluorescence microscopy. Dt re expressed s the mens ± S.D. of three individul experiments. () Control nd over-expressing cells were treted with Wnt3A-CM for 24 h. Cells were then incuted with TRAIL (100 ng/ml) for the indicted times. Immunolotting ws performed using the indicted ntiodies. (c) Control nd over-expressing cells were treted with Wnt3A-conditioned medi for 24 h, nd then incuted with or without TRAIL (100 ng/ml) for 4 h. XIAP ws immunoprecipitted from whole cell lystes, nd these precipittes were immunolotted for cspse 9 nd XIAP. PC, positive, TRAILtreted whole cell lystes. cspse 9. As shown in Fig. 4c, TRAIL tretment induced complex formtion etween XIAP nd ctive cspse 9 in cells, wheres this ws diminished in over-expressing cells. Therefore, these oservtions collectively indicte tht cnonicl Wnt signling exerts n nti-poptotic effect in HSCs y regulting complex formtion etween XIAP nd cspse 9, thus enhncing HSC survivl. 4. Discussion The principl finding of this study reltes to Wnt signling during heptic firosis. Our results collectively demonstrte tht Wnt signling prticiptes in heptic firosis y enhncing HSC ctivtion nd y cting s n nti-poptotic signl in these cells. This study demonstrtes tht memrnous receptors for Wnt lignds, which re memers of the Fz gene fmily, re expressed in humn HSCs. In prticulr, t lest three different memers of Fz (Fz-2, -7, nd -10) re expressed in these cells. However, using the sme methodology used for detecting Fz gene expression, we were unle to detect Wnt gene expression in these cells (dt not shown). In view of the high sensitivity of RT-PCR, it is likely tht HSCs do not secrete Wnt proteins. However, since heptocytes re le to produce Wnt proteins [12], Fz expression in HSCs in this study implies tht these cells re likely to respond to Wnt proteins within the liver. Wnt proteins hve een grouped into two clsses, i.e., cnonicl nd non-cnonicl clsses. Cnonicl Wnts (e.g. Wnt1, Wnt3A nd Wnt8) stilize -ctenin, nd thus ctivte the trnscriptions of TCF/LEF trget genes, wheres noncnonicl Wnts (e.g., Wnt4, Wnt5A nd Wnt11) ctivte other signling pthwys, such s the plnr-cell-polrity-like pthwy nd the Wnt/C 2+ pthwy [13]. In ddition, the extrcellulr ntgonists of Wnt signling pthwy re clssified into two groups, i.e., the sfrp nd the Dickkopf fmily [8]. In this study, we used n -overexpressing system to inhiit Wnt signling, since hs previously een shown to ply prominent role in the regultion of cellulr poptosis, differentition nd ngiogenesis in mny tissues [4,8]. Moreover, our findings demonstrte tht TCF/LEF-dependent trnscriptionl ctivity ws incresed in HSCs treted with Wnt3A, nd tht this trnscriptionl ctivity ws significntly reduced in over-expressing cells. These oservtions, therefore, indicte tht cnonicl Wnt signling is ctive in HSCs, nd tht functions s cnonicl Wnt ntgonist in these cells. Moreover, the ctivtion of cnonicl Wnt signling in this study resulted in HSC ctivtion, which led to incresed collgen 1 nd -smooth muscle ctin expression. In ddition, our study demonstrted tht Wnt signl ctivtion ttenuted HSC poptosis. Thus these results collectively suggest tht cnonicl Wnt signling is ctive in HSCs nd tht it prticiptes in heptic firosis y enhncing HSC ctivtion nd survivl. It hs een rgued tht is likely to e iphsic modultor of Wnt signling [14]. However, over-expression in this study efficiently pertured cnonicl Wnt signl-dependent HSC ctivtion. In ddition, over-expression in the present study enhnced TRAIL-induced HSC poptosis. In ctivted HSCs, TRAIL induces poptosis y ctivting TRAIL receptor-dependent pro-poptotic signls [3]. We oserved tht TRAIL-induced cspse 8, cytochrome c, nd cspse 9 modultions were similr in nd -overexpressing cells, wheres cspse 3 ctivtion ws significntly
2958 S.J. Myung et l. / FEBS Letters 581 (2007) 2954 2958 higher in over-expressing cells tht in s. Severl cytoplsmic proteins re criticlly involved in the regultion of the cytochrome c/apf-1 cspse ctivting pthwy. Inhiitors of poptosis proteins (IAPs) including XIAP hve een shown to ind procspse 9, preventing its ctivtion, nd to ind directly with nd inhiit ctive cspse 9 [15]. Therefore, it is likely tht complex formtion etween IAPs nd cspse 9 might e modulted in over-expressing cells. Indeed, the present study demonstrtes tht this complex formtion etween XIAP nd cspse 9 ws diminished in these cells. In prticulr, ctive cspse 9 (37, 35 KD) inding with XIAP ws reduced in these cells (Fig. 4c). This oservtion suggests tht more ctive cspse 9 cn ct on procspse 3 in these cells, nd tht this enhnces cspse 3 ctivtion. Therefore, these findings indicte tht cnonicl Wnt signling exerts n nti-poptotic effect in HSCs y regulting complex formtion etween XIAP nd cspse 9. In conclusion, our results demonstrte tht cnonicl Wnt signling is ctive in HSCs nd tht it prticiptes in heptic firosis y promoting HSC ctivtion nd survivl. Moreover, since this process ws effectively prevented y forced expression, the interruption of cnonicl Wnt signls my therpeuticlly e useful s n nti-firotic strtegy in the liver. References [1] Friedmn, S.L. (2000) Moleculr regultion of heptic firosis, n integrted cellulr response to tissue injury. J. Biol. Chem. 275, 2247 2250. [2] Wells, R.G. (2005) The role of mtrix stiffness in heptic stellte cell ctivtion nd liver firosis. J. Clin. Gstroenterol. 39, S158 S161. [3] Timr, P., Higuchi, H., Kocov, E., Rippe, R.A., Friedmn, S. nd Gores, G.J. (2003) Activted stellte cells express the TRAIL receptor-2/deth receptor-5 nd undergo TRAIL-medited poptosis. Heptology 37, 87 95. [4] Logn, C.Y. nd Nusse, R. (2004) The Wnt signling pthwy in development nd disese. Annu. Rev. Cell Dev. Biol. 20, 781 810. [5] Morrisey, E.E. (2003) Wnt signling nd pulmonry firosis. Am. J. Pthol. 162, 1393 1397. [6] Surendrn, K., McCul, S.P. nd Simon, T.C. (2002) A role for Wnt-4 in renl firosis. Am. J. Physiol. Renl. Physiol. 282, F431 F441. [7] Shckel, N.A., McGuinness, P.H., Aott, C.A., Gorrell, M.D. nd McCughn, G.W. (2001) Identifiction of novel molecules nd pthogenic pthwys in primry iliry cirrhosis: cdna rry nlysis of intrheptic differentil gene expression. Gut 49, 565 576. [8] Kwno, Y. nd Kypt, R. (2003) Secreted ntgonists of the Wnt signlling pthwy. J. Cell Sci. 116, 2627 2634. [9] Willert, K., Brown, J.D., Dnenerg, E., Duncn, A.W., Weissmn, I.L., Rey, T., Ytes 3rd, J.R. nd Nusse, R. (2003) Wnt proteins re lipid-modified nd cn ct s stem cell growth fctors. Nture 423, 448 452. [10] Lim, Y.S., Kim, K.A., Jung, J.O., Yoon, J.H., Suh, K.S., Kim, C.Y. nd Lee, H.S. (2002) Modultion of cytokertin expression during in vitro cultivtion of humn heptic stellte cells: evidence of trnsdifferentition from epithelil to mesenchyml phenotype. Histochem. Cell Biol. 118, 127 136. [11] Helmrecht, K., Kispert, A., von Wsielewski, R. nd Brnt, G. (2001) Identifiction of Wnt/et-ctenin signling pthwy in humn thyroid cells. Endocrinology 142, 5261 5266. [12] Zeng, G., Awn, F., Otru, W., Muller, P., Apte, U., Tn, X., Gndhi, C., Demetris, A.J. nd Mong, S.P. (2007) Wnt er in liver: expression of Wnt nd frizzled genes in mouse. Heptology 45, 195 204. [13] Gordon, M.D. nd Nusse, R. (2006) Wnt signling: multiple pthwys, multiple receptors, nd multiple trnscription fctors. J. Biol. Chem. 281, 22429 22433. [14] Uren, A., Reichsmn, F., Anest, V., Tylor, W.G., Muriso, K., Bottro, D.P., Cumerledge, S. nd Ruin, J.S. (2000) Secreted frizzled-relted protein-1 inds directly to Wingless nd is iphsic modultor of Wnt signling. J. Biol. Chem. 275, 4374 4382. [15] Roy, N., Deverux, Q.L., Tkhshi, R., Slvesen, G.S. nd Reed, J.C. (1997) The c-iap-1 nd c-iap-2 proteins re direct inhiitors of specific cspses. Emo J. 16, 6914 6925.