Leptin induces TGF-b synthesis through functional leptin receptor expressed by human peritoneal mesothelial cell
|
|
- Clarence Carter
- 5 years ago
- Views:
Transcription
1 originl rticle & 2006 Interntionl Society of Nephrology Leptin induces TGF- synthesis through functionl leptin receptor expressed y humn peritonel mesothelil cell JCK Leung 1, LYY Chn 1, SCW Tng 1, KM Chu 2 nd KN Li 1 1 Deprtment of Medicine, Queen Mry Hospitl, The University of Hong Kong, Hong Kong; 2 Deprtment of Surgery, Queen Mry Hospitl, The University of Hong Kong, Hong Kong Mrked increse in leptin concentrtion in spent peritonel dilyste hs een reported following continuous multory peritonel dilysis tretment. The present study ws designed to determine whether functionl leptin receptor is expressed y humn peritonel mesothelil cells nd if so, the possile impliction in dilysis. Expression of leptin receptors in cultured mesothelil cells nd omentl tissue ws exmined. The effect of leptin on the production of trnsforming growth fctor- (TGF-) y mesothelil cells in the presence or sence of high glucose ws determined using in vitro culture model of humn peritonel mesothelil cells nd dipocytes. The signling mechnism involved in leptin-induced TGF- synthesis y mesothelil cells ws studied. Both mrna nd protein of the full-length leptin receptor re constitutively expressed in mesothelil cells. The leptin receptor expression in mesothelil cells ws upregulted y glucose ut not leptin. In dipocytes, glucose incresed the mrna expression nd synthesis of leptin. The Jnus kinse-signl trnsducers nd ctivtion (JAK-STAT) signl trnsduction pthwy in mesothelil cells ws ctivted y either exogenous or dipocytes-derived leptin. Exogenous leptin induced the relese of TGF- y mesothelil cells. The TGF- synthesis induced y leptin ws mplified y glucose through incresed leptin receptor expression. Our novel findings revel tht functionl leptin receptor is present on humn peritonel mesothelil cells. The leptin-induced TGF- synthesis in mesothelil cells is ssocited with the expression of leptin receptor nd the ctivtion of the JAK-STAT signl trnsduction pthwy. Kidney Interntionl (2006) 69, doi: /sj.ki ; pulished online 26 April 2006 KEYWORDS: leptin; leptin receptor; CAPD; mesothelil cell; TGF-; JAK-STAT Correspondence: KN Li, Deprtment of Medicine, Room 411, Professoril Block, Queen Mry Hospitl, The University of Hong Kong, Hong Kong. E-mil: knli@hku.hk Received 23 Septemer 2005; revised 8 Ferury 2006; ccepted 15 Ferury 2006; pulished online 26 April 2006 Continuous multory peritonel dilysis (CAPD) is n importnt tretment modlity of the renl replcement therpy. Unfortuntely, the peritonel memrne frequently exhiits structurl nd functionl chnges following longterm dilysis. 1 During CAPD, peritonel cells re repetedly exposed to nonphysiologicl hypertonic environment tht my led to peritonel firosis nd, ultimtely, ultrfiltrtion filure. 2 Humn peritonel dipocytes (HPAC) re uiquitously found in peritonel tissues. There is now compelling evidence suggesting dipocytes cn medite vrious physiologic processes through secretion of dipokines, including leptin, diponectin, resistin, tumour necrosis fctor-, interleukin-6, trnsforming growth fctor- (TGF-), tissue fctors, nd other growth fctors. 3,4 Adipocytes lso express receptors for leptin, insulin growth fctor-1, tumour necrosis fctor-, interleukin-6, TGF- tht orchestrte network of utocrine, prcrine, nd endocrine signls. 4 In prietl peritoneum, dipocytes lie deep underneth the mesothelium. During the fluid dwell in CAPD, solutes in peritonel dilysis fluid (PDF) re trnsported y pssive diffusion through the peritonel rrier nd come into contct with the dipocytes. In the omentum, dipocytes re in close contct with mesothelil cells. Ultrstructurl study revels tht portion of dipocytes re protruded from the mesothelil surfce, suggesting tht omentl dipocytes my e directly exposed to dilyste. 5 In ddition, dilyste cn lso rech the prietl dipose tissue when there is junctionl dmge or denudtion of the mesothelil monolyer. It is therefore logicl to postulte tht under repeted exposure to PDF nd the continuous chnges of the physiologic milieu of the peritonel cvity during CAPD, peritonel dipocytes will inevitly e ctivted. Yet, study on ny impct of CAPD on peritonel dipocytes is scrce. Leptin, n dipocytes-derived 16-kD hormone, exerts mny iologicl effects through leptin receptor. 4,6 Leptin receptors elong to the clss I cytokine fmily with six spliced isoforms (O-R to O-Rf). 4 Only the full-length isoform, O-R, contins the intrcellulr motifs essentil for the Jnus kinse-signl trnsducers nd ctivtion (JAK-STAT) 2078 Kidney Interntionl (2006) 69,
2 JCK Leung et l.: Leptin induces TGF- synthesis y mesothelil cell o r i g i n l r t i c l e signl trnsduction pthwy. 4,7 Accumulting evidence for systemic effects of leptin on specific tissues nd metolic pthwys indictes tht leptin opertes oth directly nd indirectly to orchestrte complex pthophysiologicl processes. 6,8 Leptin is clered principlly y the kidney nd the serum leptin concentrtion is incresed in ptients with chronic renl filure or undergoing dilysis. 9 Mrked increse in leptin concentrtion from serum nd spent dilyste hs een reported following CAPD tretment. 10 Leptin in peritonel dilyste is derived not only from plsm ut lso loclly from peritonel dipose tissue. In vitro experiments using dipocyte cell line 3T3-L1 showed glucose-sed PDFs induce higher leptin secretion. 11 In the present study, we determine whether functionl leptin receptors re expressed y humn peritonel mesothelil cells (HPMC) nd if so, whether these mesothelil leptin receptors could e triggered y leptin to modulte locl TGF- production. RESULTS Culture of HPMC nd HPAC Figure 1 shows the cultured cells used in our study. HPMC showed typicl colestone ppernce t confluence (Figure 1). For in vitro experiments, dipocyte differentition ws initited y culturing predipocytes (Figure 1) in dipogenic medium. After 15 dys of differentition, 90% of cells re positively stined with Oil Red O for neutrl lipid ccumultion (Figure 1C). Expression of O-R in omentl tissue nd cultured HPMC Expression of the O-R mrna (Figure 2) nd protein (Figure 2) ws demonstrted in three different lines of HPMC. Expression of O-R ws confirmed for peripherl lood mononucler cells nd HepG2 cells, which served s positive control for the reverse trnscriptse-polymerse chin rection (RT-PCR). 12,13 Expression of O-R ws detected on cell surfce of peritonel mesothelil cells nd dipocytes in omentum (Figure 3). However, HPMC do not produce leptin either constitutively or fter incution with glucose (dt not shown). c Figure 1 Culture of peritonel mesothelil cells nd dipocytes. Microgrphs showing () humn omentl mesothelil cells, () predipocytes, nd (c) differentited dipocytes in culture. The differentited dipocytes (HPAC) were positively stined with Oil Red O (originl mgnifiction 100). O-R O-R p 452 p upregultes O-R expression y HPMC Figure 4 shows the time course of O-R expression y HPMC cultured with glucose or mnnitol. Expression of O-R mrna (Figure 4) or protein (Figure 4) ws significntly incresed in HPMC y incution with glucose ut not with mnnitol fter 12 h nd plteued t 72 h (Po0.005). Similrly, glucose ut not mnnitol upregulted O-R mrna (Figure 5) nd protein expression (Figure 5) in HPMC in dose-dependent mnner. upregultes leptin mrna nd protein expression y HPAC Significnt increse in mrna expression of leptin ws detected in HPAC fter exposed to 40 mm glucose for h (Po0.005) (Figure 6). Then, the leptin expression fell t 72 h nd the level remined not different from the seline vlue. significntly incresed leptin relese from HPAC fter exposure for 48 h (Po0.005) (Figure 6). t concentrtion of 20 mm or greter significntly incresed the leptin mrna expression (Figure 7) nd M 125 kd 42 kd Figure 2 Expression of O-R in mesothelil cells. Expression of () full-length O-R mrna nd () protein in cultured humn mesothelil cells. Lnes 1 3 were HPMC cell lines. The liver cell line HepG2 (lne 4), humn peripherl mononucler cells (lne 5), nd omentl tissue (lne 6) were served s positive control for O-R expression. c Figure 3 Immunostining of O-R in omentl tissue. ( nd c) Representtive immunohistochemicl stining of O-R in humn omentl tissue. Omentl mesothelil cells (rrow hed) nd dipocytes (rrow) showed strong immunorectivity for O-R (rown). () No stining ws oserved for isotypic control (originl mgnifiction ( nd ) 200, (c) 1000). Kidney Interntionl (2006) 69,
3 o r i g i n l r t i c l e JCK Leung et l.: Leptin induces TGF- synthesis y mesothelil cell O-R protein (% of time zero) O-R/ rtio (h) (h) Mnnitol (h) (h) Mnnitol (h) Figure 4 Time-dependent upregultion of O-R expression in HPMC y glucose. Time response curve for () O-R mrna nd () protein expression in HPMC upon exposure to glucose. Tretment with glucose (40 mm; drk r) ut not mnnitol (40 mm; white r) led to time-dependent upregultion in O-R mrna nd protein expression in HPMC. Mesurement of O-R mrna t time intervls 12, 24, 48, nd 72 h; or O-R protein t time intervls 24, 48, nd 72 h differed significntly from vlues t time zero. Dt re men7s.d. of four individul experiments. *Po protein relese (Figure 7) (Po0.005 for oth). Similr upregultion ws not oserved with mnnitol. Expression of O-R HPAC ws not ffected y glucose (dt not shown). Leptin did not lter the expression of O-R ut incresed the TGF- relese y HPMC Incution with incresing dose of leptin (5 40 ng/ml) filed to upregulte the expression of OB-R in HPMC (Figure 8). However, leptin t concentrtion of 10 ng/ml or greter significntly incresed the TGF- mrna expression nd protein relese y HPMC (Po0.005) (Figure 8). Activtion of JAK-STAT signl trnsduction pthwy in HPMC y leptin Figure 9 shows the detection of phospho-jak2 nd phospho- STAT3 of the JAK-STAT pthwy, phospho-pn-protein kinse (PKC) or c-fos in lyste from HPMC following incution with medium contining glucose ( mm), medium contining leptin (0 40 ng/ml), control-hpac, or glucose-hpac medium. Incresing concentrtion of glucose ctivted the PKC ut not the JAK-STAT pthwy in stepwise fshion. In contrst, leptin ctivted the JAK2, STAT3, nd c-fos ut not PKC in HPMC. Activtion of the (h) O-R/ rtio O-R protein (% of 5.6 mm control) (mm) (mm) Mnnitol (mm) (mm) (mm) Mnnitol (mm) Figure 5 Dose-dependent upregultion of O-R expression in HPMC y glucose. Dose response curve for () O-R mrna nd () protein expression in HPMC upon exposure to glucose for 24 (mrna) or 48 h (protein). Tretment with incresing concentrtion of glucose (drk r) ut not mnnitol (white r) led to dosedependent upregultion in O-R mrna nd protein expression in HPMC. Mesurement of O-R mrna t high concentrtions of glucose (20, 40, nd 80 mm) differed significntly from the seline vlue t 5 mm. Dt re men7s.d. of four individul experiments. *Po JAK-STAT, c-fos, nd PKC pthwys were detected in HPMC incuted with glucose-hpac medium ut not with control- HPAC medium. Roles of PKC nd JAK-STAT signling pthwys To study the roles of PKC nd JAK-STAT signling pthwys in TGF- relese from HPMC induced y glucose or/nd leptin, HPMC ws cultured with medium contining 5.6 or 40 mm glucose, 40 mm glucose plus 20 ng/ml leptin, nd glucose-hpac medium in the sence or presence of neutrlizing ntiody to leptin receptor, inhiitor to JAK2 (AG490; 10 mm), or/nd PKC (clphostin; 100 nm). Leptin upregulted TGF- relese y HPMC (Figure 10). Addition of glucose further mplified this TGF- relese. There ws synergistic increse (960% of sl vlue) in TGF- synthesis y HPMC exposed to 40 mm glucose plus 20 ng/ml leptin. AG490, nti-leptin receptor or clphostin lone only reduced TGF- relese to 575, 637, or 340% of tht of the sl level. The TGF- relese in HPMC induced y simultneous exposure to glucose nd leptin ws completely olished only with the presence of oth AG490 nd clphostin. The 2080 Kidney Interntionl (2006) 69,
4 JCK Leung et l.: Leptin induces TGF- synthesis y mesothelil cell o r i g i n l r t i c l e Leptin/ rtio (h) (h) Mnnitol Leptin/ rtio (mm) (mm) Mnnitol Leptin (ng/10 5 cells) (h) (h) Figure 6 Time-dependent upregultion of leptin expression in HPAC y glucose. Time response curve for () leptin mrna nd () protein expression in HPAC upon exposure to glucose. Tretment with glucose (40 mm; drk r) ut not mnnitol (40 mm; white r) led to time-dependent upregultion in leptin gene nd protein expression in HPAC. Mesurement of leptin mrna t time intervls 12 h, 24, nd 48 h differed significntly from vlues t time zero. Significnce ws not oserved t 72 h when compred with seline vlues. Mesurement of leptin protein t 48 nd 72 h differed significntly from vlue t time zero. Dt re men7s.d. of four individul experiments. *Po Leptin (ng/10 5 cells) (mm) (mm) Figure 7 Dose-dependent upregultion of leptin expression in HPAC y glucose. Dose response curve for () leptin mrna nd () protein expression in HPAC upon exposure to glucose for 24 (mrna) or 48 h (protein). Tretment with incresing concentrtion of glucose (drk r) ut not mnnitol (white r) led to dosedependent upregultion in leptin gene nd leptin relese in HPAC. Mesurement of leptin mrna t high-dose concentrtions of glucose (20, 40, nd 80 mm) differed significntly from seline vlue t 5 mm. Dt re men7s.d. of four individul experiments. *Po concentrtions of glucose nd leptin in the conditioned medium were 3672 mm nd ng/ml, respectively. -HPAC medium significntly incresed TGF- synthesis y HPMC (803% of sl level). AG490, clphostin, nd ntileptin receptor reduced 39.7, 86.96, nd 33.1% of the incresed TGF- level, respectively. DISCUSSION To the est of our knowledge, this is the first study showing tht HPMC express functionl full-length leptin receptor, the O-R. We hve demonstrted tht O-R is constitutively expressed in cultured HPMC nd humn omentl tissue y RT-PCR, immunolotting, nd immunohistochemicl stining. The expression of O-R in HPMC ws upregulted following exposure to glucose. The synthesis of leptin y HPAC is upregulted y glucose ut not y equimolr mnnitol. These dt re in keeping with the recent finding tht glucose-sed PDF induces higher leptin secretion y murine dipocyte cell line 3T3-L1 compred with dilyste with lower glucose concentrtion or without glucose. 11 High glucose content in the dilyste is mjor fctor cusing the structurl nd functionl normlities in peritonel cells during CAPD. 14,15 Decresed expression of intercellulr junctionl proteins ZO-1 nd -ctenin is oserved in HPMC cultured with glucose. 16 upregultes TGF- nd fironectin synthesis y HPMC. 17,18 TGF- is involved in vrious pthophysiologicl events in peritonel iology. 19 Overexpressed TGF- in murine mesothelil cells results in peritonel memrne firosis nd loss of ultrfiltrtion. 20 In n niml model of peritonel dilysis, inhiition of TGF- function nd production reduces peritonel firosis. 21 -induced TGF- upregultion in kidney mesngil cells nd HPMC is medited y PKC. 18,22 High glucose induces de novo synthesis of dicylglycerol nd ctivte PKC in HPMC. 23 Activtion of PKC leds to trnscription of c-fos nd c-jun erly response gene. 24 The c-fos nd c-jun proteins cn form dimeric complexes with ech other tht ind to the ctivtor protein- 1 (AP-1) consensus sequence to ctivte the promoter ctivity. 25 It hs een shown tht the AP-1 ox B inding sites on the TGF- promoter medite the high glucose response in mesngil cells. 26 High glucose increses the TGF- promoter ctivity y enhncing the expression of c-fos, nd hence its inding to AP-1. The involvement of c-fos in regulting the TGF- promoter ctivity is well demonstrted y the oservtion tht heprin prevents TGF- ctivtion induced y glucose through reducing the c-fos expression, nd therey preventing the formtion of ctivted AP-1 complexes. 27 Kidney Interntionl (2006) 69,
5 o r i g i n l r t i c l e JCK Leung et l.: Leptin induces TGF- synthesis y mesothelil cell (ng/ml) (ng/ml) O-R mrna O-R protein O-R protein (% of control) TGF-β (pg/10 5 cells) Leptin (ng/ml) (ng/ml) TGF-β Leptin (ng/ml) Figure 8 Effect of exogenous leptin on O-R expression nd TGF- relese y HPMC. () Expression of O-R mrna (white r) or protein (drk r) ws not ltered in HPMC cultured with different concentrtion of leptin for 24 h (mrna) or for 48 h (protein). () Relese of TGF- in HPMC cultured with incresing doses of leptin for 48 h. The expression of TGF- mrna (white r) ws significntly incresed in HPMC incuted with leptin t 20 nd 40 ng/ml. The relese of TGF- (drk r) ws up-regulted in HPMC incuted with leptin t 10, 20, nd 40 ng/ml. Dt re men7s.d. of four individul experiments. *Po In the present study, we hve demonstrted tht leptin upregultes the gene expression nd protein relese of TGF- in HPMC. HPMC do not produce leptin constitutively or fter incution with high glucose, nd there could e prcrine effect of HPAC-derived leptin on HPMC expression of TGF-. It hd een shown tht leptin enhnced romtse expression in the rest cncer cell line vi AP We next exmined whether leptin-induced TGF- synthesis in HPMC is medited through signl pthwys involving PKC nd AP-1. Our dt showed tht PKC is not ctivted y leptin nd neither the leptin-induced TGF- synthesis is olished y PKC inhiitor. Hence, unlike TGF- synthesis in HPMC induced y high glucose, TGF- synthesis in HPMC induced y leptin is independent of the PKC pthwy. Leptin triggers O-R signling through the JAK-STAT signl trnsduction pthwy. 7 In vsculr smooth muscle cells, high glucose enhnces the ngiotensin II-induced cell prolifertion through the JAK-STAT pthwy. 29 In glomerulr mesngil cells, inhiition of the JAK-STAT pthwy prevents the glucose-induced TGF- nd fironectin synthesis. 30 Our O-R/ rtio TGF-β/ rtio (mm) (40 mm) Leptin (20 ng/ml) AG490 (10 μm) Clphostin (100 nm) Leptin (ng/ml) Phospho-pn-PKC Phospho-STAT3 Phospho-JAK2 c-fos immunolotting dt hve reveled tht leptin, ut not glucose, is le to ctivte JAK2 nd STAT3. Furthermore, the TGF- synthesis in HPMC induced y leptin ws olished y JAK2 specific inhiitor, AG490. Tken these oservtions together, TGF- synthesis in HPMC induced y leptin is triggered y O-R signling involving the JAK-STAT pthwy. It hs een shown tht ctivted STAT3 inds to c-fos promoter nd upregultes c-fos trnscription. 31 It is likely tht the downstrem event in leptin-induced TGF- synthesis y HPMC is similr to the mechnism of high glucose-medited TGF- synthesis, which involves n incresed c-fos expression nd TGF- promoter ctivity. Our dt show tht in the presence of 40 mm glucose or 20 ng/ml leptin, there ws 583 or 349% increse in TGF- synthesis y HPMC. However, glucose (40 mm) mplified the leptin-induced TGF- synthesis y HPMC (1113% (glucose þ leptin) versus 932% (glucose or leptin 583 þ 349 ¼ 932%). This mplifiction of TGF- synthesis is likely to e due to the incresed expression of O-R in HPMC y high glucose. Indeed, our inhiition studies show tht TGF- synthesis y HPMC in the presence of oth glucose nd leptin ws olished only y using oth PKC nd JAK2 inhiitors ut not with either one lone. Bsed on our present dt, hypotheticl model of leptin-induced TGF- synthesis in HPMC is proposed (Figure 11). TGF- synthesis y HPMC is upregulted y glucose through PKC-dependent mechnisms. HPMC exposed to high glucose will induce PKC ctivtion. PKC will then upregulte the trnscription fctors c-fos nd c-jun, which form complexes with the AP-1 Control-HPAC medium HPAC medium c-fos Figure 9 Detection of different phospho-specific signls in HPMC lyste following incution with glucose, leptin, glucose-hpac conditioned medium, or control-hpac conditioned medium. () Activtion of the PKC signl trnsduction pthwy ws detected in HPMC incuted with glucose or glucose-hpac medium ut not with leptin or control-hpac medium. () Activtion of the JAK2, STAT3, nd c-fos signl trnsduction pthwys ws detected in HPMC incuted with leptin or glucose-hpac conditioned medium ut not with glucose or control-hpac conditioned medium Kidney Interntionl (2006) 69,
6 JCK Leung et l.: Leptin induces TGF- synthesis y mesothelil cell o r i g i n l r t i c l e 1600 # 1400 TGF-β (pg/10 5 cells) # Φ Φ Ω# Φ mm glucose 40 mm glucose 20 ng/ml leptin 40 mm glucose -HPAC plus 20 ng/ml leptin medium Ω P < vs glucose plus leptin, without inhiitor # P < vs 40 mm glucose, without inhiitor P < vs 40 mm glucose, with AG490 ΦP < vs 40 mm glucose, with clphostin P < vs 40 mm glucose, with nti-leptin receptor A Figure 10 Blocking study of TGF- relese y HPMC. Concentrtion of TGF- in culture superntnt from HPMC incuted with medium contining 5.6 mm glucose, 40 mm glucose, 20 ng/ml leptin, 40 mm glucose plus 20 ng/ml leptin, or glucose-hpac conditioned medium in the sence (white r) presence of nti-leptin receptor ntiody (crossed r; lst r in ech group; 50mg/ml), inhiitor to JAK2 (AG490; 10 mm; dotted r; 2nd r in ech group), PKC (clphostin; 100 nm; gry r) or oth (10 mm AG490 plus 100 nm clphostin; drk r). Dt re men7s.d. of four individul experiments. P JAK2 AG490 P STAT3 Leptin O-R + c-fos c-jun c-fos AP HG + P PKC TGF-β trnscription HG Clphostin Figure 11 Hypotheticl model of leptin-induced TGF- synthesis in HPMC. HPMC exposed to high glucose will induce PKC ctivtion. PKC will then upregulte the trnscription of erly response genes, c-fos or/nd c-jun, which form complexes with the AP-1 inding site nd enhnce the inding of AP-1 proteins to the AP-1 ox B on the TGF- promoter. TGF- synthesis is upregulted y high glucose through this PKC-dependent mechnism. Although leptin cnnot ctivte the PKC pthwy directly, it does ctivte the JAK2 nd STAT3 through the functionl O-R expressed on HPMC. Activted STAT3 ccumultes on the c-fos promotor nd provides oost to c-fos trnscription. High glucose upregultes the expression of O-R y HPMC s well the PKC-dependent TGF- synthesis. In the presence of leptin nd incresed O-R expression y HPMC stimulted with high glucose, upregultion of TGF- synthesis will e further mplified through the JAK-STAT pthwy. inding site nd enhnce the inding of AP-1 proteins to the AP-1 ox B on the TGF- promoter. Although leptin cnnot ctivte the PKC pthwy directly, it does ctivte the JAK2 nd STAT3 through the functionl O-R expressed on HPMC. Activted STAT3 ccumultes on the c-fos promoter nd increses c-fos trnscription. Since high glucose lso upregultes the expression of O-R on HPMC, in the presence of leptin nd high glucose, upregultion of TGF- synthesis y leptin will further e mplified through O-R nd the JAK-STAT3-dependent pthwy. Pthwys other thn JAK-STAT could lso e involved in mediting leptin s ction. In peripherl lood mononucler cells, leptin ctivtes the MAPK nd phosphtidyl-inositol 3 0 -kinse pthwys, nd is implicted in regulting cell growth nd glucose metolism. 32 It hs een shown tht leptin directly suppressed peroxisome prolifertor-ctivted receptor-g expression in dipocytes. In kidney mesngil nd tuulr cells, peroxisome prolifertor-ctivted receptor-g gonist ttenuted high glucose-induced TGF- relese. It is not known whether HPMC expressed peroxisome prolifertor-ctivted receptorg nd if it is present, the effect of peroxisome prolifertorctivted receptor-g expression on leptin-induced TGF- relese y HPMC. Further exmintion of these dditionl pthwys in modulting the leptin-induced TGF- relese y HPMC is wrrnted. Leptin is elevted during cute infection, in response to proinflmmtory cytokines including interleukin-1 nd tumour necrosis fctor-. 9 In the kidney, leptin stimultes cell prolifertion, collgen IV nd TGF- synthesis in glomerulr endothelil cells, 33 nd increses the glucose trnsport, upregultes the expression of TGF- type II Kidney Interntionl (2006) 69,
7 o r i g i n l r t i c l e JCK Leung et l.: Leptin induces TGF- synthesis y mesothelil cell receptor nd collgen I synthesis through phosphtidylinositol-3-kinse relted pthwy in glomerulr mesngil cells. 34 These dt suggest tht leptin triggers prcrine interction etween glomerulr endothelil nd mesngil cells through upregultion of TGF- in glomerulr endothelil cells together with incresed TGF- receptor expression in mesngil cells. Whether such prcrine interction is operting etween peritonel dipocytes nd HPMC remins to e explored. Here, we present the first evidence tht dipocyte-derived leptin cn exert prcrine effect on HPMC through upregultion of O-R receptor nd ctivtion of the JAK-STAT pthwy. It must e emphsized tht dt otined from cultured cells model my not exctly reflect in vivo sitution. During CAPD, mesothelil cells nd dipocytes re exposed to unphysiologicl low ph nd high glucose PDF. PDF lso contins toxic sustnces including glucose degrdtion products. All these fctors work together with the cytokines nd dipokines networks from peritonel cells in ffecting the TGF- synthesis y mesothelil cells. For the present study, culture model ws employed to llow exmintion of specific vriles (high glucose, leptin nd O-R expression), nd this will give preliminry ide of wht could e hppened in vivo during peritonel dilysis. It is of importnt to exmine the in vivo expression of O-R nd relted signling pthwy in ptients efore nd under long-term CAPD nd future investigtion is wrrnted. In conclusion, our study provides novel dt tht leptin cn ctivte the JAK-STAT signl trnsduction pthwy nd increse the synthesis of TGF- y HPMC through triggering the functionl O-R receptor. In the presence of high glucose, leptin-induced TGF- synthesis y HPMC is enhnced. Our results implicte tht dipocyte-derived leptin my contriute to the peritonel dysfunction in dilysis through prcrine effect on mesothelil TGF- synthesis. MATERIALS AND METHODS Mterils All regents for tissue culture were otined from Invitogen Co (Crlsd, CA, USA). Monoclonl nti-o-r, neutrlizing nti-leptin receptor ntiody nd leptin protein were otined from R&D System (Minnepolis, MN, USA). Monoclonl mouse nti-ctin ws otined from L Vision (Fremont, CA, USA). Secondry ntiodies for immunohistochemicl stining nd immunolotting were otined from Dko (Crpinteri, CA, USA). Antiodies to phospho-jak2, phospho-stat3, pn-pkc nd c-fos were otined from Cell Signling Technology (Beverly, MA, USA). All other chemicls were otined from Sigm (St Louis, MO, USA). Culture of HPMC The study ws conducted in ccordnce with the Declrtion of Helsinki Principles nd ws pproved y the institutionl ethics committee for studies in humn. Full informed consent for removing smll pieces of omentl tissue for experimentl studies ws otined from ptients. Omentum tissue ws otined from five nonuremic, nondietic ptients (mle, ge 45 55) under elective dominl surgery for erly gstric cncer. The ptients hve not een previously exposed to peritonel dilysis tretment, nd were cliniclly not inflmed. The omentl smples collected were further exmined histologiclly to e free of other pthologicl conditions including inflmmtion, metstsis, nd endometriosis. Mesothelil cells were isolted nd chrcterized using procedures descried previously. 35 Once monolyer of HPMC reched confluence (HPMC of second or third pssge were used in ll experiments), the cells were growth-rrested with serum-free medium for 24 h prior to experiments. Under these conditions, the HPMC remined in nonprolifertive vile condition. Culture of peritonel dipocytes Omentl dipocyte precursors from the stroml vsculr frction were isolted y collgense digestion. 36 For in vitro experiments, dipocytes were differentited y culturing stroml vsculr frction in dipogenic medium (Dulecco s modified Egle s medium/hm s F12 medi supplemented with 10 mg/ml trnsferrin, 100 mm scoric cid 2-sodium, 0.85 mm insulin, 20 nm sodium selenite, 0.2 nm triiodothyronine, 1 mm dexmethsone, 100 mm isoutyl-methylxnthine, nd 1 mm rosiglitzone). The medium ws chnged 3 dys lter (dexmethsone nd isoutyl-methylxnthine were omitted). After 15 dys of differentition, 90% of cells re positively stined with Oil Red O for neutrl lipid ccumultion. These differentited dipocytes were cultured in serum-free M199 medium for 24 h prior to experiment. Immunohistochemicl stining The expression of O-R in 4 mm-thicked omentl prffin sections ws determined y immunohistochemicl stining using mouse nti-o-r (0.5 mg/ml). The ound ntiody ws visulised s rown colour using the Dko Envision Plus System (Dko). Preprtion of M199 medium contining mnnitol The sl glucose concentrtion in M199 medium is 5.6 mm, for ll experiment involving the use of mnnitol s osmolrity control, the concentrtion of mnnitol dded to the M199 medium re 0, 4.4, 14.4, 34.4, nd 74.4 mm (plus 5.6 mm glucose in the M199 medium) to generte different sugr concentrtion (5.6, 10, 20, 40, nd 80 mm). For simplicity, these 5.6 mm glucose þ mnnitol medium re nmed s 5.6, 10, 20, 40, or 80 mm mnnitol. Preprtion of conditioned medium from HPAC exposed to glucose HPAC were cultured with M199 medium contining glucose (40 mm) for 48 h. The conditioned medium (glucose-hpac medium) ws stored t 701C until used. The conditioned medi were centrifuged for 10 min t 2000 g efore experiment. Conditioned medium from HPAC cultured with 5.6 mm sl glucose level (control-hpac medium) ws used s control. Expression of O-R y HPMC exposed to glucose For time response experiment, HPMC ( cells) were exposed to 40 mm glucose or mnnitol for 0, 6, 12, 24, 48, nd 72 h. For dose response experiment, HPMC were cultured with 5.6, 10, 20, 40, nd 80 mm glucose or mnnitol for 24 h (mrna expression) or 48 h (protein relese). At ny prticulr time point or t the end of experiment, cells were hrvested for totl RNA or lyste preprtion for determintion of expression of O-R using RT- PCR or immunolotting Kidney Interntionl (2006) 69,
8 JCK Leung et l.: Leptin induces TGF- synthesis y mesothelil cell o r i g i n l r t i c l e Expression of leptin mrna nd protein y HPAC exposed to glucose For time response experiment, HPAC ( cells) were exposed to 40 mm glucose or mnnitol for 0, 6, 12, 24, 48, nd 72 h. For dose response experiment, HPAC were cultured with 5.6, 10, 20, 40, nd 80 mm glucose or mnnitol for 24 h (mrna expression) or 48 h (protein relese). At ny prticulr time point or t the end of experiment, culture superntnts were collected for ssy of leptin y ELISA nd cells were hrvested for totl RNA preprtion. Effect of leptin on the expression of O-R nd synthesis of TGF- y HPMC HPMC were exposed to 0, 5, 10, 20, nd 40 ng/ml leptin for 24 h (mrna) or 48 h (protein). At the end of experiment, culture superntnts were collected for ssy of TGF- y n ELISA nd cells were hrvested for totl RNA or cell lyste preprtions. O-R or TGF- mrna expression ws determined y RT-PCR nd O-R protein expression ws ssyed y immunolotting. Activtion of JAK-STAT nd PKC signl trnsduction pthwys HPMC/HPAC were exposed to glucose ( mm), leptin (0 40 ng/ml), glucose-hpac medium, or control medium for 30 min. The expression of phospho-jak2, phospho-stat3, nd phospho-pkc y HPMC ws determined using immunolotting. In nother sets of experiment, HPMC were cultured with M199 contining (i) 5.6 mm glucose, (ii) 40 mm glucose, (iii) 40 mm glucose plus 20 ng/ml leptin, or (iv) glucose-hpac medium in the sence or presence of inhiitor to JAK2 (AG490; 10 mm) nd/or PKC (clphostin; 100 nm); or nti-leptin receptor ntiody for 48 h (the inhiitors or ntiody were dded 1 h efore experiment strted). At the end of experiment, the TGF- concentrtion in the culture superntnt ws ssyed y ELISA. Gene expression study Cells were hrvested nd totl cellulr RT-PCR ws performed s previously descried. 37 The heptocellulr line HepG2 ws otined from Americn Type Culture Collection (ATCC; Rockville, MD, USA) nd the humn peripherl lood mononucler cells were isolted from helthy donors y Ficoll grdient seprtion s previously descried. 38 The RNAs otined from these cells were used s positive control for O-R expression. Primers for O-R, leptin, TGF-, nd glycerldehyde-3-phosphte dehydrogense were designed from GeneBnk sequences (O-R U43168; leptin D49487; TGF- X02812 nd glycerldehyde-3-phosphte dehydrogense AF261085). The sequences of primers (sense nd ntisense) re: (i) O-R, 5 0 -TCACCCAGTGATTACAAGCT nd 5 0 -CTGGAGAACTCT GATGTCCG; (ii) leptin, 5 0 -GCTGTGCCCATCCAAAAAGT nd ACTGCCAGTGTCTGGTCCAT; (iii) TGF-, 5 0 -GCCCTGGACAC CAACTATTGCT nd 5 0 -AGGCTCCAAATGTAGGGGCAGG; (iv) glycerldehyde-3-phosphte dehydrogense, 5 0 -TGAAGGTCGGAGT CAACGGATTTGGT nd 5 0 -CATGTGGGCCATGAGGTCCACCAC. The PCR products for O-R, leptin, or TGF- (1071, 179, or 161 p) nd control (glyurldehyde-3 phosphte dehydrogense; 452 p) were mixed nd seprted y 1.5% wt/vol grose gels. The results ws nlysed using the Gel Doc 1000 Gel Documenttion System (Bio-Rd Lortories Ltd., Hercules, CA, USA). Immunolotting Cells were lysed with uffer contining protese inhiitor cocktils (Sigm). The protein concentrtions in cell extrcts were mesured y modified Lowry method (DC protein ssy kit, BioRd). A totl of 10 mg of totl protein from the extrct ws electrophoresed nd then trnsferred onto polyvinylidine difluoride memrne. The memrne ws incuted with mouse nti-o-r ntiody (1:1000), nti-ctin ntiody (1:1000); rit nti-phospho JAK-2 (1:1000), nti-phospho STAT3 (1:1000) or nti-phospho pn-pkc ntiody (1:4000). The memrne ws incuted with peroxidseleled got nti-rit or nti-mouse immunogloulin (Dko) efore detection with enhnced chemiluminescence (Amershm Phrmci Biotech, Arlington, IL, USA). The immunolot imges were quntitted using ImgeQunt softwre (Moleculr Dynmic, Sunnyvle, CA, USA). Densitometry results were reported s % of control fter normliztion with the verge ritrry integrted vlues of the ctin signl. Mesurement of TGF- or leptin in culture superntnt The concentrtion of TGF- or leptin in superntnt ws mesured y ELISA (R&D System) with detection limit of 32 or 20 pg/ml nd coefficient of vrition of 8.5 or 7.6%, respectively. Sttisticl nlysis All dt were expressed s mens7s.d. Intergroup differences etween two vriles were ssessed y the unpired t-test. The dt from more thn two study groups were nlyzed using multivrite nlysis of vrince followed y Bonferroni correction. All P -vlues quoted re two-tiled nd the significnce is defined s Po ACKNOWLEDGMENTS The study ws supported y the Reserch Grnt Committee (Hong Kong SAR) [HKU7415/04] nd the Seed Funding for Bsic Reserch [No ] of the University of Hong Kong. JCK Leung is supported y the L&T Chritle Fund nd INDOCAFE. REFERENCES 1. Di Polo N, Scchi G, De Mi M et l. Morphology of the peritonel memrne during continuous multory peritonel dilysis. Nephron 1986; 44: Ruin J, Herrer GA, Collins D. An utopsy study of the peritonel cvity from ptients on continuous multory peritonel dilysis. Am J Kidney Dis 1991; 18: Friedmn JM. Oesity in the new millennium. Nture 2000; 404: Myers Jr MG. Leptin receptor signling nd the regultion of mmmlin physiology. Recent Prog Horm Res 2004; 59: Di Polo N, Scchi G. Atls of peritonel histology. Perit Dil Int 2000; 20(Suppl 3): S Pond CM. Adipose tissue nd the immune system. Prostglndins Leukot Essent Ftty Acids 2005; 73: Ahim RS, Osei SY. Leptin signling. Physiol Behv 2004; 81: Fruheck G, Gomez-Amrosi J, Muruzl FJ, Burrell MA. The dipocyte: model for integrtion of endocrine nd metolic signling in energy metolism regultion. Am J Physiol Endocrinol Met 2001; 280: E Wolf G, Chen S, Hn DC, Ziydeh FN. Leptin nd renl disese. Am J Kidney Dis 2002; 39: Tsujimoto Y, Shoji T, Tt T et l. Leptin in peritonel dilyste from continuous multory peritonel dilysis ptients. Am J Kidney Dis 1999; 34: Tet D, Tedjni A, Burnier M et l. -contining peritonel dilysis fluids regulte leptin secretion from 3T3-L1 dipocytes. Nephrol Dil Trnsplnt 2005; 20: Zrkesh-Esfhni H, Pockley G, Metclfe RA et l. High-dose leptin ctivtes humn leukocytes vi receptor expression on monocytes. J Immunol 2001; 167: Liu ZJ, Endoh A, Li R, Ohzeki T. Effects of leptin nd dexmethsone on long nd short leptin receptor mrna. Peditr Int 2004; 46: H H, Lee HB. Effect of high glucose on peritonel mesothelil cell iology. Perit Dil Int 2000; 20(Suppl 2): S15 S Di Polo N, Scchi G. Peritonel vsculr chnges in continuous multory peritonel dilysis (CAPD): n in vivo model for the study of dietic microngiopthy. Perit Dil Int 1989; 9: Kidney Interntionl (2006) 69,
9 o r i g i n l r t i c l e JCK Leung et l.: Leptin induces TGF- synthesis y mesothelil cell 16. Ito T, Yoriok N, Ymmoto M et l. Effect of glucose on intercellulr junctions of cultured humn peritonel mesothelil cells. J Am Soc Nephrol 2000; 11: Noh H,H H,Yu MR et l. Angiotensin II medites high glucose-induced TGF-et1 nd fironectin upregultion in HPMC through rective oxygen species. Perit Dil Int 2005; 25: H H, Yu MR, Lee HB. High glucose-induced PKC ctivtion medites TGF-et 1 nd fironectin synthesis y peritonel mesothelil cells. Kidney Int 2001; 59: Ihn H. Pthogenesis of firosis: role of TGF-et nd CTGF. Curr Opin Rheumtol 2002; 14: Mrgetts PJ, Kol M, Glt T et l. Gene trnsfer of trnsforming growth fctor-et1 to the rt peritoneum: effects on memrne function. J Am Soc Nephrol 2001; 12: Mrgetts PJ, Gyorffy S, Kol M et l. Antingiogenic nd ntifirotic gene therpy in chronic infusion model of peritonel dilysis in rts. J Am Soc Nephrol 2002; 13: Hned M, Koy D, Isono M, Kikkw R. Overview of glucose signling in mesngil cells in dietic nephropthy. J Am Soc Nephrol 2003; 14: Inoguchi T, Xi P, Kuniski M et l. Insulin s effect on protein kinse C nd dicylglycerol induced y dietes nd glucose in vsculr tissues. Am J Physiol 1994; 267: E369 E Kreiserg JI, Rdnik RA, Ayo SH et l. High glucose elevtes c-fos nd c-jun trnscripts nd proteins in mesngil cell cultures. Kidney Int 1994; 46: Hlzonetis TD, Georgopoulos K, Greenerg ME, Leder P. c-jun dimerizes with itself nd with c-fos, forming complexes of different DNA inding ffinities. Cell 1988; 55: Weigert C, Suer U, Brodeck K et l. AP-1 proteins medite hyperglycemi-induced ctivtion of the humn TGF-et1 promoter in mesngil cells. J Am Soc Nephrol 2000; 11: Weigert C, Brodeck K, Hring HU et l. Low-moleculr-weight heprin prevents high glucose- nd phorol ester-induced TGF-et 1 gene ctivtion. Kidney Int 2001; 60: Ctlno S, Mrsico S, Giordno C et l. Leptin enhnces, vi AP-1, expression of romtse in the MCF-7 cell line. J Biol Chem 2003; 278: Morishit R, Gions GH, Horiuchi M et l. Role of AP-1 complex in ngiotensin II-medited trnsforming growth fctor-et expression nd growth of smooth muscle cells: using decoy pproch ginst AP-1 inding site. Biochem Biophys Res Commun 1998; 243: Wng X, Shw S, Amiri F et l. Inhiition of the Jk/STAT signling pthwy prevents the high glucose-induced increse in tgf-et nd fironectin synthesis in mesngil cells. Dietes 2002; 51: Yng E, Lerner L, Besser D, Drnell Jr JE. Independent nd coopertive ctivtion of chromosoml c-fos promoter y STAT3. J Biol Chem 2003; 278: Mrtin-Romero C, Snchez-Mrglet V. Humn leptin ctivtes PI3K nd MAPK pthwys in humn peripherl lood mononucler cells: possile role of Sm68. Cell Immunol 2001; 212: Wolf G, Hmnn A, Hn DC et l. Leptin stimultes prolifertion nd TGF-et expression in renl glomerulr endothelil cells: potentil role in glomerulosclerosis. Kidney Int 1999; 56: Hn DC, Isono M, Chen S et l. Leptin stimultes type I collgen production in d/d mesngil cells: glucose uptke nd TGF-et type II receptor expression. Kidney Int 2001; 59: Leung JC, Chn LY, Li FF et l. degrdtion products downregulte ZO-1 expression in humn peritonel mesothelil cells: the role of VEGF. Nephrol Dil Trnsplnt 2005; 20: Rodriguez AM, Pisni D, Dechesne CA et l. Trnsplnttion of multipotent cell popultion from humn dipose tissue induces dystrophin expression in the immunocompetent mdx mouse. J Exp Med 2005; 201: Li KN, Li FK, Ln HY et l. Expression of quporin-1 in humn peritonel mesothelil cells nd its upregultion y glucose in vitro. J Am Soc Nephrol 2001; 12: Chn LY, Leung JC, Tsng AW et l. Activtion of tuulr epithelil cells y mesngil-derived TNF-: Glomerulotuulr communiction in IgA nephropthy. Kidney Int 2005; 67: Kidney Interntionl (2006) 69,
Supplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationTNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More informationAcute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
More informationSupplementary Figure 1
Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationSupplementary Figure 1
doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nture1188 1mM CCl 2 (min) 3 4 6 CCl 2 (mm) for 4min.1. 1 (mm) Pro- d WT GdCl 3 R-68 -/- P2x7r -/- -/- Csp1 -/- WT -/- P2x7r -/- -/- Csp1 -/- Csp1 (p2) (p17) Pro-Csp1
More informationThe effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat
The effect of dietry α-linolenic cid levels on regultion of omeg-3 lipid synthesis in rt Wei-Chun Tu School of Agriculture Food nd Wine The University of Adelide Conversion of PUFA to LCPUFA PUFA LCPUFA
More informationExpression of Three Cell Cycle Inhibitors during Development of Adipose Tissue
Expression of Three Cell Cycle Inhiitors during Development of Adipose Tissue Jiin Zhng Deprtment of Animl Sciences Advisor: Michel E. Dvis Co-dvisor: Kichoon Lee Development of niml dipose tissue Hypertrophy
More informationHeparanase promotes tumor infiltration and antitumor activity of CAR-redirected T- lymphocytes
Supporting Online Mteril for Heprnse promotes tumor infiltrtion nd ntitumor ctivity of -redirected T- lymphocytes IgnzioCrun, Brr Svoldo, VlentinHoyos, Gerrit Weer, Ho Liu, Eugene S. Kim, Michel M. Ittmnn,
More information% Inhibition of MERS pseudovirus infection. 0 h 0.5 h 1 h 2 h 4 h 6 h Time after virus addition
% Inhiition of MERS pseudovirus infection 1 8 h.5 h 1 h 2 h 4 h 6 h Time fter virus ddition Supplementry Figure S1. Inhiition of on MERS pseudovirus infection t the different intervls postinfection. A
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB:
More informationThe intrinsic prostaglandin E 2 EP 4 system of the renal tubular epithelium limits the development of tubulointerstitial fibrosis in mice
originl rticle http://www.kidney-interntionl.org & 1 Interntionl Society of Nephrology see commentry on pge 13 The intrinsic prostglndin E EP system of the renl tuulr epithelium limits the development
More informationIN-1130, a novel transforming growth factor-b type I receptor kinase (ALK5) inhibitor, suppresses renal fibrosis in obstructive nephropathy
originl rticle http://www.kidney-interntionl.org & 26 Interntionl Society of Nephrology see commentry on pge 12 IN-113, novel trnsforming growth fctor- type I receptor kinse (ALK) inhiitor, suppresses
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationTLR7 induces anergy in human CD4 + T cells
TLR7 induces nergy in humn CD T cells Mrgrit Dominguez-Villr 1, Anne-Sophie Gutron 1, Mrine de Mrcken 1, Mrl J Keller & Dvid A Hfler 1 The recognition of microil ptterns y Toll-like receptors (TLRs) is
More informationSUPPLEMENTARY INFORMATION
doi:0.08/nture078 RNse VifHA VifHA βctin 6 Cell lyste IP: ntiha MG VifHA VifHA β ctin 6 7 Cell lyste IP: ntiha Supplementry Figure. Effect of RNse nd MG tretment on the Vif interction., RNse tretment does
More informationThe protective roles of GLP-1R signaling in diabetic nephropathy: possible mechanism and therapeutic potential
http://www.kidney-interntionl.org & 213 Interntionl Society of Nephrology sic reserch The protective roles of GLP-1R signling in dietic nephropthy: possile mechnism nd therpeutic potentil Hiroki Fujit
More informationEffects of physical exercise on working memory and prefrontal cortex function in post-stroke patients
Effects of physicl exercise on working memory nd prefrontl cortex function in post-stroke ptients M Moriy, C Aoki, K Sktni Grdute School of Helth Sciences Reserch, Mjor of Physicl Therpy, TeikyoHeisei
More informationIGF-1 vs insulin: Respective roles in modulating sodium transport via the PI-3 kinase/sgk1 pathway in a cortical collecting duct cell line
originl rticle http://www.kidney-interntionl.org & 27 Interntionl Society of Nephrology IGF-1 vs insulin: Respective roles in modulting sodium trnsport vi the PI-3 kinse/sgk1 pthwy in corticl collecting
More informationInterleukin-4 Restores Insulin Sensitivity in Lipid-Induced Insulin-Resistant Adipocytes
ISSN 6-2979, Biochemistry (Moscow), 21, Vol. 3, No. 5, pp. 49-56. Pleides Pulishing, Ltd., 21. Originl Russin Text I. S. Stfeev, S. S. Michurin,3, N. V. Podkuychenko, A. V. Vorotnikov, M. Yu. Menshikov,
More informationESM Table 1. Characterisation of the human non-diabetic cohort used for MRIbased assessment of pancreatic fat and insulin secretion via OGTT.
ESM Tle 1. Chrcteristion of the humn non-dietic cohort used for MRIsed ssessment of pncretic ft nd insulin secretion vi OGTT. Trit sex Medin (IQR) 86 femles, 5 mles ge (yers) 4.4 (.5-5.57) BMI (kg/m²).62
More informationPDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis
Supplementry Informtion PDGF-BB secreted y preosteoclsts induces ngiogenesis during coupling with osteogenesis Hui Xie, Zhung Cui, Long Wng, Zhuying Xi, Yin Hu, Lingling Xin, Chngjun Li, Ling Xie, Jnet
More informationCheck your understanding 3
1 Wht is the difference etween pssive trnsport nd ctive trnsport? Pssive trnsport is the movement of prticles not requiring energy. Movement of prticles in ctive trnsport uses energy. 2 A gs tp in the
More informationSupplemental Materials
Supplementl Mterils Cellulose deficiency of shv3svl1 is enhnced y hyper ccumultion of exogenous sucrose vi the plsm memrne sucrose/h symporter SUC1 Trevor H. Yets, Hgit Sorek, Dvid E. Wemmer, Chris R.
More informationSUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
More informationRho kinase inhibition protects kidneys from diabetic nephropathy without reducing blood pressure
originl rticle http://www.kidney-interntionl.org & 211 Interntionl Society of Nephrology Rho kinse inhiition protects kidneys from dietic nephropthy without reducing lood pressure Rdko Komers 1, Terry
More informationSUPPLEMENTARY INFORMATION
SUPPLEMEARY IFORMAIO doi:./nture correction to Supplementry Informtion Adenom-linked rrier defects nd microil products drive IL-/IL-7-medited tumour growth Sergei I. Grivennikov, Kepeng Wng, Dniel Mucid,
More informationThe parathyroid hormone-related protein system and diabetic nephropathy outcome in streptozotocin-induced diabetes
http://www.kidney-interntionl.org & 26 Interntionl Society of Nephrology originl rticle The prthyroid hormone-relted protein system nd dietic nephropthy outcome in streptozotocin-induced dietes A Izquierdo
More informationSupplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
More informationCyanidin-3-O-glucoside ameliorates lipid and glucose accumulation in C57BL/6J mice via activation of PPAR-α and AMPK
3 rd Interntionl Conference nd Exhiition on Nutrition & Food Sciences Septemer 23-25, 214 Vlenci, Spin Cynidin-3-O-glucoside meliortes lipid nd glucose ccumultion in C57BL/6J mice vi ctivtion of PPAR-α
More informationNorthern blot analysis
Northern blot nlysis RNA SCD RNA SCD FAS C c-9 t-1 C c-9 t-1 PRE PI PDMI PRE PI PDMI PRE PDMI PIM An W c-9, t-11 t-1, c-12 C 5 2 4 1 um C 5 2 4 1 um Angus dipocytes expressed SCD higher thn Wgyu dipocyte
More informationSignificance of Expression of TGF- in Pulmonary Metastasis in Non-small Cell Lung Cancer Tissues
Originl Article Significnce of Expression of in Pulmonry Metstsis in Non-smll Cell Lung Cncer Tissues Hisshi Sji, Hruhiko Nkmur, Idiris Awut, Norihito Kwski, Msru Hgiwr, Akihiko Ogt, Mkoto Hosk, Tkmoto
More informationAdipocyte in vascular wall can induce the rupture of abdominal aortic aneurysm
Adipocyte in vsculr wll cn induce the rupture of dominl ortic neurysm Hiron Kugo 1 *, Nouhiro Zim 1 *, Hiroki Tnk 2 *, Youhei Mouri 1, Kenichi Yngimoto 3, Kohsuke Hymizu 3,4, Keisuke Hshimoto 1, Tkeshi
More informationMicrotubule-driven spatial arrangement of mitochondria promotes activation of the NLRP3 inflammasome
Supplementry Informtion Microtuule-driven sptil rrngement of mitochondri promotes ctivtion of the NLRP3 inflmmsome Tkum Misw 1,2, Michihiro Tkhm 1,2, Ttsuy Kozki 1,2, Hnn Lee 1,2, Jin Zou 1,2, Ttsuy Sitoh
More informationAbstract. Introduction. V.I. Lushchak 1,*, T.V. Bagnyukova 1,*, J.M. Storey 2 and K.B. Storey 2
Brzilin Journl of Medicl nd Biologicl Reserch (2001) 34: 1055-1064 Effect of exercise on glycolytic enzymes in fish tissues ISSN 0100-879X 1055 Influence of exercise on the ctivity nd the distriution etween
More informationIL-18 induction of IgE: dependence on CD4 + T cells, IL-4 and STAT6
ARTICLES IL-18 induction of IgE: dependence on CD4 + T cells, IL-4 nd STAT6 Tomohiro Yoshimoto 1,2,7, Hitoshi Mizutni 3, Hiroko Tsutsui 1, Nncy Noen-Truth 6, Kei-ichi Ymnk 3, Minoru Tnk 4, Shinzo Izumi
More informationIGF-I and IGFBP-3 augment transforming growth factor-b actions in human renal carcinoma cells
originl rticle http://www.kidney-interntionl.org & Interntionl Society of Nephrology IGF-I nd IGFBP-3 ugment trnsforming growth fctor-b ctions in humn renl crcinom cells AH Rosendhl 1, nd G Forsberg 1
More information* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More informationCD160 inhibits activation of human CD4 + T cells through interaction with herpesvirus entry mediator
CD16 inhiits ctivtion of humn CD4 + T cells through interction with herpesvirus entry meditor Guifng Ci, Anuknth Anumnthn, Juli A Brown, Edwrd A Greenfield, Bogong Zhu & Gordon J Freemn CD16, glycosylphosphtidylinositol-nchored
More informationARTICLE. J. E. Bowe & A. Chander & B. Liu & S. J. Persaud & P. M. Jones
Dietologi (23) 56:783 79 DOI.7/s25-2-2828-2 ARTICLE The permissive effects of glucose on receptor-operted potentition of insulin secretion from mouse islets: role for ERK/2 ctivtion nd cytoskeletl remodelling
More informationHypoxia-induced inflammatory cytokine secretion in human adipose tissue stromovascular cells
Dietologi (211) 54:148 149 DOI 1.17/s125-11-213-y ARTICLE Hypoxi-induced inflmmtory cytokine secretion in humn dipose tissue stromovsculr cells R. W. O Rourke & A. E. White & M. D. Metclf & A. S. Olivs
More informationIntrinsic renal cell and leukocyte-derived TLR4 aggravate experimental anti-mpo glomerulonephritis
http://www.kidney-interntionl.org & Interntionl Society of Nephrology originl rticle Intrinsic renl cell nd leukocyte-derived TLR4 ggrvte experimentl nti-mpo glomerulonephritis Shun A. Summers, Betty S.
More informationCopy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2
Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry
More informationInterleukin-17F increases the secretion of interleukin-8 and the expression of cyclooxygenase 2 in endometriosis
Interleukin-17F increses the secretion of interleukin-8 nd the expression of cyclooxygense in endometriosis Tetsuy Hirt, M.D., Ph.D., Yutk Osug, M.D., Ph.D., Msshi Tkmur, M.D., Ako Sito, M.D., Ph.D., Akiko
More informationPNEUMOVAX 23 is recommended by the CDC for all your appropriate adult patients at increased risk for pneumococcal disease 1,2 :
PNEUMOVAX 23 is recommended y the CDC for ll your pproprite dult ptients t incresed risk for pneumococcl disese 1,2 : Adults ged
More informationCatalase overexpression prevents hypertension and tubular apoptosis in angiotensinogen transgenic mice
http://www.kidney-interntionl.org & 2010 Interntionl Society of Nephrology see commentry on pge 1060 tlse overexpression prevents hypertension nd tuulr poptosis in ngiotensinogen trnsgenic mice Nicols
More informationArachidonic acid induces ERK activation via Src SH2 domain association with the epidermal growth factor receptor
http://www.kidney-interntionl.org & 6 Interntionl Society of Nephrology originl rticle Archidonic cid induces ERK ctivtion vi Src SH2 domin ssocition with the epiderml growth fctor receptor LD Alexnder
More informationSupplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage
Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,
More informationWnt signaling enhances the activation and survival of human hepatic stellate cells
FEBS Letters 581 (2007) 2954 2958 Wnt signling enhnces the ctivtion nd survivl of humn heptic stellte cells Sun Jung Myung, Jung-Hwn Yoon, *, Geum-Youn Gwk, Won Kim, Jeong-Hoon Lee, Kng Mo Kim, Chn Soo
More informationEffect of Aqueous Extract of Carica papaya Dry Root Powder on Lactation of Albino Rats
Effect of Aqueous Extrct of Cric ppy Dry Root Powder on Lcttion of Alino Rts G. Tosswnchuntr nd S. Aritjt Deprtment of Biology Fculty of Science Ching Mi University Ching Mi 50200 Thilnd Keywords: mmmry
More informationInhibition of ceramide redox signaling pathway blocks glomerular injury in hyperhomocysteinemic rats
originl rticle http://www.kidney-interntionl.org & 6 Interntionl Society of Nephrology Inhiition of cermide redox signling pthwy locks glomerulr injury in hyperhomocysteinemic rts FYi 1, AY Zhng 1,NLi
More informationThe Journal of Physiology
J Physiol 595.13 (2017) pp 4379 4398 4379 Impct of perintl exposure to sucrose or high fructose corn syrup (HFCS-55) on diposity nd heptic lipid composition in rt offspring Crl R. Toop 1, Beverly S. Muhlhusler
More informationSUPPLEMENTARY INFORMATION
DOI:.38/nc393 Nnog DAPI Nnog/DAPI c-jun DAPI c-jun/dapi c e Reltive expression to Gpdh mescs ( Feeder free) mescs ( Feeder) MEFs.5 MEFs ipscs ESCs..5 p=.24 p=.483 p=.22. JunB JunD Fos Fr Fr2 ATF2 ATF3
More informationPlatelet-derived growth factor-a receptor activation is required for human cytomegalovirus infection
Vol 455 18 Septemer 28 doi:1.138/nture729 LETTERS Pltelet-derived growth fctor- receptor ctivtion is required for humn cytomeglovirus infection Lilin Sorocenu 1, Armin Akhvn 1 & Chrles S. Cos 1,2 Humn
More information*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU
RLU Events 1 1 1 Luciferin (μm) T-cells T-ALL 1 1 Time (min) T-cells T-ALL 1 1 1 1 DCF-DA Reltive ATP content....1.1.. T-cells T-ALL RLU 1 1 T-cells T-ALL Luciferin (μm) 1 1 Time (min) c d Control e DCFH-DA
More information2018 American Diabetes Association. Published online at
Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison
More informationThe effect of encapsulated butyric acid and zinc on performance, gut integrity and meat quality in male broiler chickens 1
The effect of encpsulted utyric cid nd zinc on performnce, gut integrity nd met qulity in mle roiler chickens 1 Astrct This study evluted the impct of encpsulted utyric cid nd zinc (ButiPEARL Z) on performnce
More informationTREM-1 regulates macrophage polarization in ureteral obstruction
sic reserch http://www.kidney-interntionl.org & 1 Interntionl Society of Nephrology regultes mcrophge polriztion in ureterl ostruction Tzu-Hn Lo 1,1, Ki-Yu Tseng,1, Wen-Shn Tso, Chih-Y Yng,3, Shie-Ling
More informationEffect of supplemental fat from dried distillers grains with solubles or corn oil on cow performance, IGF-1, GH, and NEFA concentrations 1
Effect of supplementl ft from dried distillers grins with solules or corn oil on cow performnce, IGF-1, GH, nd NEFA concentrtions 1 Aigil Brtosh 2, Cody Wright 3, Aimee Wertz-Lutz 4, nd George Perry 5
More informationNdfip-mediated degradation of Jak1 tunes cytokine signalling to limit expansion of CD4 þ effector T cells
Received 4 Jul 15 Accepted 9 Fe 16 Pulished 18 Apr 16 DOI: 1.138/ncomms116 OPEN Ndfip-medited degrdtion of Jk1 tunes cytokine signlling to limit expnsion of CD4 þ effector T cells Clire E. O Lery 1, Christopher
More informationKeywords ATP. GK rat. Na + /K + -ATPase. Pancreatic islet. ROS. Src
Dietologi (28) 51:1226 1235 DOI 1.17/s125-8-18-x ARTICLE ctivtion genertes rective oxygen species nd impirs metolism secretion coupling in dietic Goto Kkizki nd ouin-treted rt pncretic islets R. Kominto
More informationOptimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality
Optimistion of diets for Atlntic cod (Gdus morhu) roodstock: effect of rchidonic cid on egg & lrvl qulity Dr Gordon Bell, Ms. An Blnco, Dr Bill Roy, Dr Derek Roertson, Dr Jim Henderson nd Mr Richrd Prickett,
More informationDOI: 10.1038/nc2331 PCre;Ros26R 12 h induction 48 h induction Vegfr3 i EC c d ib4 24 h induction VEGFR3 e Fold chnge 1.0 0.5 P < 0.05 Vegfr3 i EC Vegfr3 Figure S1 Cre ctivtion leds to genetic deletion
More informationHormonal networks involved in phosphate deficiencyinduced cluster root formation of Lupinus albus L.
Institute of Crop Science (34h) Hormonl networks involved in phosphte deficiencyinduced cluster root formtion of Lupinus lus L. For PSP5 in Montpellier, 214 Zhengrui Wng, A.B.M. Moshiur Rhmn, Guoying Wng,
More informationA rt i c l e s. a Events (% of max)
Continuous requirement for the TCR in regultory T cell function Andrew G Levine 1,, Aron Arvey 1,,4, Wei Jin 1,,4 & Alexnder Y Rudensky 1 3 14 Nture Americ, Inc. All rights reserved. Foxp3 + regultory
More informationA critical role for interleukin 4 in activating alloreactive CD4 T cells
A criticl role for interleukin 4 in ctivting llorective CD4 T cells Jessmyn Bgley,Tokihiko Swd*,Yin Wu nd John Icomini To generte ntigen-specific responses, T cells nd ntigen presenting cells (APCs) must
More informationSupplementary Information. SAMHD1 Restricts HIV-1 Infection in Resting CD4 + T Cells
Supplementry Informtion SAMHD Restricts HIV- Infection in Resting CD T Cells Hnn-Mri Blduf,2,, Xioyu Pn,, Elin Erikson,2, Srh Schmidt, Wqo Dddch 3, Mnj Burggrf, Kristin Schenkov, In Amiel,2, Guido Wnitz
More informationUsing Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids
Using Pcloutrzol to Suppress Inflorescence Height of Potted Phlenopsis Orchids A REPORT SUBMITTED TO FINE AMERICAS Linsey Newton nd Erik Runkle Deprtment of Horticulture Spring 28 Using Pcloutrzol to Suppress
More informationType II monocytes modulate T cell-mediated central nervous system autoimmunity
Type II monocytes modulte T cell-medited centrl nervous system utoimmunity Mrtin S. Weer, Thoms Prod homme, Swsn Youssef, Shnnon E. Dunn, Cynthi D. Rundle, Lind Lee, Jun C. Ptrroyo, Olf Stüve, Rymond A.
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture09973 Plsm Memrne Phgosome TLR1/2/4 ROS Mitochondrion ROS OXPHOS Complex I ROS TRAF6 NADPH Oxidse Supplementry Figure 1 Model detiling the roles of mitochondril ROS in mcrophge cteril
More informationResponses of skeletal muscle lipid metabolism in rat gastrocnemius to hypothyroidism and iodothyronine administration: a putative role for FAT/CD36
Am J Physiol Endocrinol Met 33: E1222 E1233, 212. First pulished Septemer 11, 212; doi:1.1152/jpendo.37.212. Responses of skeletl muscle lipid metolism in rt gstrocnemius to hypothyroidism nd iodothyronine
More informationPHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES
PHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES Rent Bi Deprtment of Biology, Fculty of Science, University of Zgre INTRODUCTION Nnoprticles (NPs) Silver nnoprticles
More informationAdenosine A1 receptor antagonist improves intradialytic hypotension
http://www.kidney-interntionl.org & 26 Interntionl Society of Nephrology originl rticle see commentry on pge 789 Adenosine A1 receptor ntgonist improves intrdilytic hypotension E Imi 1, M Fujii 2, Y Kohno
More informationLocal IL-21 Promotes the Therapeutic Activity of Effector T cells by Decreasing Regulatory T Cells Within the Tumor Microenvironment
originl rticle Locl IL- Promotes the Therpeutic Activity of Effector T cells y Decresing Regultory T Cells Within the Tumor Microenvironment Seunghee Kim-Schulze, Hong Sung Kim, Qing Fn, De Won Kim nd
More informationFeeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens
Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler
More informationReduced WIF-1 Expression Stimulates Skin Hyperpigmentation in Patients with Melasma
See relted commentry on pg ORIGINAL ARTICLE Reduced WIF- Expression Stimultes Skin Hyperpigmenttion in Ptients with Melsm Ji-Young Kim, Te-Ryong Lee nd Ai-Young Lee The expression of Wnt inhiitory fctor-
More informationExtraction and Some Functional Properties of Protein Extract from Rice Bran
Ksetsrt J. (Nt. Sci.) 40 : 209-214 (2006) Extrction nd Some Functionl Properties of Protein Extrct from Rice Brn Chockchi Theerkulkit*, Siree Chiseri nd Siriwt Mongkolknchnsiri ABSTRACT Rice brn protein
More informationSupplementary Figure S1
Supplementry Figure S Connexin4 TroponinI Merge Plsm memrne Met Intrcellulr Met Supplementry Figure S H9c rt crdiomyolsts cell line. () Immunofluorescence of crdic mrkers: Connexin4 (green) nd TroponinI
More informationIrs-2 coordinates Igf-1 receptor-mediated β-cell development and peripheral insulin signalling
Irs-2 coordintes Igf-1 receptor-medited β-cell development nd peripherl insulin signlling Dominic J. Withers 1,2 *, Deorh J. Burks 1 *, Hether H. Towery 1, Shri L. Altmuro 1, Crrie L. Flint 1 & Morris
More informationExpression of functional NK 1 receptors in human alveolar macrophages: superoxide anion production, cytokine release and involvement of NF-jB pathway
British Journl of Phrmcology (25) 45, 385 396 & 25 Nture Pulishing Group All rights reserved 7 88/5 $3. www.nture.com/jp Expression of functionl NK receptors in humn lveolr mcrophges: superoxide nion production,
More informationSupplementary Materials. Viral delivery of mir-196a ameliorates the SBMA phenotype via the silencing of CELF2
Supplementry Mterils Virl delivery of mir-96 meliortes the SBMA phenotype vi the silencing of CELF2 Yu Miyzki, Hiroki Adchi, Mshis Ktsuno, Mkoto Minmiym, Yue-Mei Jing, Zhe Hung, Hideki Doi, Shinjiro Mtsumoto,
More informationRole of EP2 and EP4 receptor-selective agonists of prostaglandin E 2 in acute and chronic kidney failure
http://www.kidney-interntionl.org & 26 Interntionl Society of Nephrology originl rticle Role of EP2 nd EP4 receptor-selective gonists of prostglndin E 2 in cute nd chronic kidney filure S Vukicevic 1,
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture17 Men tumour dimeter (mm) 2 Rg2-/- 2 1 2 2 1 Control IgG!-CD8!-CD4 1 2 3 1 2 3 c Men tumour dimeter (mm) 2 2 1 d Ifnr1-/- Rg2-/- 2 2 1 Ifngr1-/- d42m1!ic 1 2 3 Dys post trnsplnt 1 2 3 Supplementry
More informationResearch Article Protective Effect of Short-Term Genistein Supplementation on the Early Stage in Diabetes-Induced Renal Damage
Meditors of Inflmmtion Volume 2013, rticle ID 510212, 14 pges http://dx.doi.org/10.1155/2013/510212 Reserch rticle Protective Effect of Short-Term Genistein Supplementtion on the Erly Stge in Dibetes-Induced
More informationConnexin 30 sets synaptic strength. by controlling astroglial synapse invasion
Connexin 3 sets synptic strength y controlling stroglil synpse invsion Ulrike Pnnsch, Dominik Freche, Glenn Dllérc, Grégory Ghézli,, Crole Escrtin, Pscl Ezn, Mrtine Cohen-Slmon, Krim Benchenne, Veronic
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1228 Totl Cell Numer (cells/μl of lood) 12 1 8 6 4 2 d Peripherl Blood 2 4 7 Time (d) fter nti-cd3 i.p. + TCRβ + IL17A + cells (%) 7 6 5 4 3 2 1 Totl Cell Numer (x1 3 ) 8 7 6 5 4 3 2 1 %
More informationInflammation adversely affects arterial wall biology. 1,2 Much
Ftty cids Regulte Endothelil Lipse nd Inflmmtory Mrkers in Mcrophges nd in Mouse ort Role for PPRγ Un Ju Jung, Cludi Torrejon, Chuchun L. Chng, Hiroko Hmi, Till S. Worgll, Richrd J. Deckelum Ojective Mcrophge
More informationInhibition of adipocyte differentiation in 3T3-L1 cell line by quercetin or isorhamnetin
Louisin Stte University LSU Digitl Commons LSU Mster's Theses Grdute School 2012 Inhibition of dipocyte differentition in 3T3-L1 cell line by quercetin or isorhmnetin Din Gbriel Crvjl-Aldz Louisin Stte
More informationSystemic Anti-TNFa Treatment Restores Diabetes-Impaired Skin Repair in ob/ob Mice by Inactivation of Macrophages
ORIGINAL ARTICLE Systemic Anti-TNF Tretment Restores Dietes-Impired Skin Repir in o/o Mice y Inctivtion of Mcrophges Itmr Goren 1, Elke Müller 1, Dn Schiefelein 1, Urs Christen 1, Josef Pfeilschifter 1,
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
More informationPro-inflammatory effects of early non-enzymatic glycated proteins in human mesothelial cells vary with cell donor s age
British Journl of Phrmcology (26) 149, 9 987 & 26 Nture Pulishing Group All rights reserved 7 1188/6 $3. www.rjphrmcol.org RESEARCH PAPER Pro-inflmmtory effects of erly non-enzymtic glycted proteins in
More informationQuercetin modulates Nrf2 and glutathione-related defenses in HepG2. cells. Involvement of p38
Quercetin modultes Nrf2 nd glutthione-relted defenses in HepG2 cells. Involvement of p38 An Belén Grndo-Serrno, Mrí Angeles Mrtín, Lur Brvo, Luis Goy nd Soni Rmos* Deprtment of Metolism nd Nutrition Institute
More informationNatural killer cells determine the outcome of B cell mediated autoimmunity
Nturl killer cells determine the outcome of B cell medited utoimmunity Fu-Dong Shi 1, *, Hu-Bing Wng 2, *, Hulun Li 2, *, Seokmnn Hong 3, Msru Tniguchi 4, Hns Link 2, Luc Vn Ker 3 nd Hns-Gustf Ljunggren
More informationThe effect of thalidomide on non-small cell lung cancer (NSCLC) cell lines: possible involvement in the PPARg pathway
Crcinogenesis vol.25 no.10 pp.1805--1812, 2004 doi:10.1093/crcin/gh210 The effect of thlidomide on non-smll cell lung cncer (NSCLC) cell lines: possile involvement in the PPARg pthwy Kthleen L.DeCicco,
More informationComparison of pro- and anti-inflammatory responses in paired human primary airway epithelial cells and alveolar macrophages
Murk et l. Respirtory Reserch (2018) 19:126 https://doi.org/10.1186/s12931-018-0825-9 RESEARCH Comprison of pro- nd nti-inflmmtory responses in pired humn primry irwy epithelil cells nd lveolr mcrophges
More informationmir-155 is dispensable in monosodium urate-induced gouty inflammation in mice
Yng et l. Arthritis Reserch & Therpy (2018) 20:144 https://doi.org/10.1186/s13075-018-1550-y RESEARCH ARTICLE mir-155 is dispensle in monosodium urte-induced gouty inflmmtion in mice Qiin Yng 1,3,4, Quno
More informationRas enhances TGF-β signaling by decreasing cellular protein levels of its type II receptor negative regulator SPSB1
Liu et l. Cell Communiction nd Signling (2018) 16:10 https://doi.org/10.1186/s12964-018-0223-4 RESEARCH Open Access Rs enhnces TGF-β signling y decresing cellulr protein levels of its type II receptor
More information