Marcelo Fernandez Vina Conflict of Interest: Co-Founder Sirona Genomics

Marcelo Fernandez Vina Conflict of Interest: Co-Founder Sirona Genomics

Next Generation Sequencing (NGS) and its Role in Transplantation Marcelo A. Fernández Viña, Ph.D. Professor Department of Pathology Stanford School of Medicine Stanford University 2

The HLA system High degree of polymorphism at most of the expressed loci (function) Lack of a single predominant allele, high degree of heterozygosity (function) Strong linkage disequilibrium (unknown, function?)

HLA-Class I

Organization of a class II alpha gene

HLA Nomenclature 2010 (field delimiters) HLA A * 24 : 02 : 01 : 01 HLA A * 24 : 02 : 01 : 02 L Expression variants Locus * Group of alleles (serotype) AA# Silent Mutations Non-coding regions

ARS Identical that are Allele Mismatches A*02:01 A*02:09 These alleles differ in regions that are not thought to affect allorecognition (one amino acid replacement at residue 236) The amino acid sequences distinguishing some alleles may be located in segments of the molecule that are not likely to elicit immune responses (cytoplasmic and trans membrane domains) Antigen Recognition Site

Probability of Overall Survival by HLA Matching for Early Disease Stage 1.0 0.9 S u r v i v a l 0.8 0.7 0.6 0.5 0.4 0.3 0.2 8/8 HLA Matched (n=835) 7/8 HLA Matched (n=379) 6/8 HLA Matched (n=241) 50% 39% 28% 0.1 Log-rank p-value = < 0.0001 0.0 0 12 24 36 48 60 Months after transplant AUD08_14.ppt

Why not whole-genome sequencing? Inadequate coverage of complex genomic regions, such as HLA. Conventional WGS (30x avg. coverage) provides only sparse coverage of HLA. Complexities due to: Indels GC-rich regions, secondary structure Paralogous genes Repeat regions across HLA loci Cost. Using WGS, to achieve adequate coverage of HLA would require >1,000X avg. coverage

Coverage HLA coverage over WGS 180 160 140 120 100 80 60 40 20 0 A B C A B C A B C A B C DRB1 DQB1 DQA1 DPB1 DPA1 Sample 1 Sample 2 Sample 3 Sample 4 Average Minimum DRB1 DQB1 DQA1 DPB1 DPA1 Average Minimum DRB1 DQB1 DQA1 DPB1 DPA1 Average Minimum DRB1 DQB1 DQA1 DPB1 DPA1 Average Minimum

J.Immunol. 1992 Jun 15;148(12):4043-53. HLA-J, a second inactivated class I HLA gene related to HLA-G and HLA-A. Implications for the evolution of the HLA-A-related genes. Messer G, Zemmour J, Orr HT, Parham P, Weiss EH, Girdlestone J. Ragoussis and co-workers described a class I HLA gene that maps to within 50 kb of HLA-A. Comparison of the nucleotide sequences of HLA-J alleles shows this gene is more related to HLA-G, A, and H. All alleles of HLA-J are pseudogenes because of deleterious mutations that produce translation termination either in exon 2 orexon 4. HLA-J appears, like HLA-H, to be an inactivated gene that result from duplication of an Ag-presenting locus related to HLA-A. Evolutionary relationships as assessed by construction of trees suggest the four modern loci: HLA-A, G, H, and J were formed by successive duplications from a common ancestral gene. In this scheme one intermediate locus gave rise to HLA-A and H, the other to HLA-G and J.

Alleles at different HLA loci (genes and pseudogenes) share nucleotide sequences HLA_A and HLA-H (pseudogene) AA Codon 30 35 40 45 50 A*24:02:01:01 GGC TAC GTG GAC GAC ACG CAG TTC GTG CGG TTC GAC AGC GAC GCC GCG AGC CAG AGG ATG GAG CCG CGG GCG CCG A*01:01:01:01 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- -A- --- --- --- --- --- --- A*02:01:01:01 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- A*25:01:01 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- A*32:01:01 --- --- --- --- --- --- --- --- --- --- --T --- --- --- --- --- --- --- --- --- --- --- --- --- --- H*01:01:01:01 GGC TAC GTG GAC GAT ACG CAG TTC GTG CGG TTC GAC AGC GAC GCC GCG AGC CAG AGG ATG GAG CCG CGG GCG CCG HLA-A, B and HLA-H (pseudogene) AA Codon 80 85 90 B*57:01:01 GAG AAC CTG CGG ATC GCG CTC CGC TAC TAC AAC CAG AGC GAG GCC G B*07:02:01 --- -G- --- --- -A- CT- -G- G-- --- --- --- --- --- --- --- - B*08:01:01 --- -G- --- --- -A- CT- -G- G-- --- --- --- --- --- --- --- - B*15:17:01:01 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- - B*35:01:01:01 --- -G- --- --- -A- CT- -G- G-- --- --- --- --- --- --- --- - B*44:02:01:01 --- --- --- --C -C- --- --- --- --- --- --- --- --- --- --- - B*51:01:01:01 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- - AA Codon 80 85 90 H*01:01:01:01 GAG AAC CTG CGG ATC GCG CTC CGC TAC TAC AAC CAG AGC GAG GGC G AA Codon 80 85 90 A*24:02:01:01 GAG AAC CTG CGG ATC GCG CTC CGC TAC TAC AAC CAG AGC GAG GCC G A*01:01:01:01 -C- --- --- G-- -C- CT- -G- G-- --- --- --- --- --- --- -A- - A*02:01:01:01 -T- G-- --- G-- -C- CT- -G- G-- --- --- --- --- --- --- --- - A*25:01:01 --- -G- --- --- --- --- --- --- --- --- --- --- --- --- -A- - A*32:01:01 --- -G- --- --- --- --- --- --- --- --- --- --- --- --- --- -

Polymorphic nucleotide positions: two hybrid alleles

HLA typing using high throughput sequencing technologies. Exon-wise amplification of few exons. Whole-gene amplification. 18

HLA Typing by NGS Wang C, Krishnakumar S, Wilhelmy J, Babrzadeh F, Stepanyan L, Su LF, Levinson D, Fernandez-Viña MA, Davis RW, Davis MM, Mindrinos M High-throughput, high-fidelity HLA genotyping with deep sequencing. Proc Natl Acad Sci U S A. 2012May 29;109(22):8676-81. doi: 10.1073/pnas.1206614109. Epub 2012 May 15. PubMed PMID: 22589303; PubMed Central PMCID: PMC3365218. New methodology that leverages the power of Next Generation Sequencing (NGS) and long range PCR Interrogated the entire sequences of the class I genes and most of the extent Class II genes in more than 9,000 subjects

Potential benefits of next-generation sequencing for HLA typing Clonal template amplification in vitro to eliminate problem of sequencing heterozygous DNA Sufficiently long read length (300+ bp) to cover entire exon (or more) in phase Increased sequence coverage of HLA genes Capability to multiplex patient specimens Potential to complete run and data analysis within one week 20

Practical Advantages or of Extending Test complete gene No Assumptions made Sequence Coverage Transplantation: Detect mismatches thought to be absent Mapping of Disease Susceptibility Factors

NGS HLA TYPING SYSTEM 7. Data analysis 1. Sample Collection 5 UTR 1 2 3 4 5 6 7 8 3 UTR HLA-A 5 UTR 1 2 3 4 5 6 7 8 3 UTR HLA-B 6. Sequencing 5 UTR 1 2 3 4 5 6 7 8 3 UTR 5 UTR 1 2 3 4 3 UTR 5 UTR 1 2 3 4 5 6 3 UTR HLA-C HLA-DQA1 HLA-DQB1 2. Long-Range PCR Single amplification condition 5 UTR 1 2 3 4 5 3 UTR HLA-DPB1 5 UTR 1 2 3 4 3 UTR HLA-DPA1 5 UTR 1 2 3 4 5 6 3 UTR HLA-DRB1, 3, 4, 5 5. Library preparation 3. Quantification & Pooling 4. Fragmentation

Applicatications of NGS in Clinical Histocompatibility Practice Identification of a novel allele that results in one mismatch Detection of null alleles (resulting from mutations in untested/uncovered areas; no a priori assumptions made) Identification of null alleles allows the identification of nonself epitopes that may be recognized as foreign Identification of mismatches: Immediate identification and characterization of novel alleles; interpretation of clinical significance if mismatched Detection of sequence variations that regulate expression levels (permissible and deleterious if alleles are mismatched)

Identification of Novel alleles

Patient and Donor are Heterozygous in all HLA loci Difference (mismatch) in one allele of HLA-A Molecules encoded in the HLA system PATIENT Molecules encoded in the HLA system DONOR Encoded in HLA-A locus (Class I) Encoded in HLA-A locus (Class I) Encoded in HLA-B locus (Class I) Encoded in HLA-DRB1 locus (Class II) Paternal origin Maternal origin 3 Encoded in HLA-B locus (Class I) Encoded in HLA-DRB1 locus (Class II) Paternal origin Maternal origin 3 The HLA-A mismatched antigen in the Donor can be recognized as foreign by the Patient s Immune System (Host versus Graft; rejection) The HLA-A mismatched antigen in the Patient can be recognized as foreign by the Donor s Immune System (Graft versus Host; GvHD and GvL)

S-17 SBT: B*45:01, B*40@ NGS: B*45:01,B*40:02:01e1_Exon3, C to G, codon 127 ASN TO LYS.

S-108 SBT: DQA1*02:01, DQA1*04:01@ NGS: DQA1*02:01, DQA1*04:01:01i1_Ex3Var C to A substitution codon 180 His to Gln, IV1_x2_IV3_x1.

ARS Identical that are Allele Mismatches A*0201 A*0209 These alleles differ in regions that are not thought to affect allorecognition (one amino acid replacement at residue 236) The amino acid sequences distinguishing some alleles may be located in segments of the molecule that are not likely to elicit immune responses (cytoplasmic and trans membrane domains) Antigen Recognition Site

Clinical Implications of null alleles In bone marrow transplantation, assuming that a donor carries an expressed allele when in fact the allele is not expressed results in a mismatch in the graft-versus host direction Patient: A*02:01, 24:02/24:09N Donor A*02:01, 24:02/24:09N 29

BS-25 DQA1*05:05:01:01, Exon 3 variant, insertion of T, codon 135 (Null allele)

BS-25 DQA1*05:05:01:01, Exon 3 variant, insertion of T, codon 135; frame shift mutation-> PTC (DQA1*05- Null) TGA = PTC

Molecules encoded in the HLA system Encoded in HLA-A locus (Class I) Encoded in HLA-B locus (Class I) Encoded in HLA-DRB1 locus (Class II) Paternal origin Maternal origin 72

Molecules encoded in the HLA system Encoded in HLA-A locus (Class I) x Encoded in HLA-B locus (Class I) Encoded in HLA-DRB1 locus (Class II) Paternal origin Maternal origin 33

Molecules encoded in the HLA system Encoded in HLA-A locus (Class I) x Encoded in HLA-B locus (Class I) Encoded in HLA-DRB1 locus (Class II) Paternal origin Maternal origin 34

Clinical Implications of null alleles Null alleles are not expressed: e.g. a subject carrying A*02:01, A*24:09N, has a phenotype of A*02:01, - Assuming that a patient carries an expressed allele when in fact the allele is not expressed results in a mismatch in the rejection direction Patient: Donor A*02:01, 24:02/24:09N A*02:01, 24:02/24:09N 35

Identifying a Null allele (formerly Q ) allele and its biological relevance

C*16:01 C*03:04 B*08:01 B*45:01 A*02:01 A*23:01 A*24:02 A*24:03 B*15:02 B*15:13 A*68:01 B*15:01 B*15:10 A*34:02 B*51:02 A*68:02 B*15:11 A*33:03 C*07:02 B*57:01 B*35:01 B*53:01 Fluorescence Intensity A B C DRB1 DRB3 DQB1 2 08 10 13 DR52 2 23 45 16 8 7 10000 9000 8000 7000 6000 5000 4000 3000 2000 1000 0 Normalized MFI Self

C*16:01 C*03:04 B*08:01 B*45:01 A*02:01 A*23:01 A*24:02 A*24:03 B*15:02 B*15:13 A*68:01 B*15:01 B*15:10 A*34:02 B*51:02 A*68:02 B*15:11 A*33:03 C*07:02 B*57:01 B*35:01 B*53:01 Fluorescence Intensity 10000 9000 8000 7000 6000 5000 4000 3000 2000 1000 0 A B C DRB1 DRB3 DQB1 02:KRUH 08 10 13 DR52 2 23:KKVU 45 16 8 7 Normalized MFI 23:KKVU = 23:01/23:07N/23:17/23:18/23:19Q/23:20/23:23/23:26/23:30/23: 32/23:33/23:34/23:35 Self

C*16:01 C*03:04 B*08:01 B*45:01 A*02:01 A*23:01 A*24:02 A*24:03 B*15:02 B*15:13 A*68:01 B*15:01 B*15:10 A*34:02 B*51:02 A*68:02 B*15:11 A*33:03 C*07:02 B*57:01 B*35:01 B*53:01 Fluorescence Intensity A B C DRB1 DRB3 DQB1 DPB1 02:01 08:01 03:04 13:01 02:02P 02:01 01:01 23:19N 45:01 16:01 08:04 03:19 01:01 10000 9000 8000 7000 6000 5000 4000 3000 2000 1000 0 Normalized MFI Self

A*01:01:01 GT TCT CAC ACC ATC CAG ATA ATG TAT GGC TGC GAC GTG GGG CCG GAC GGG CGC TTC CTC CGC GGG TAC CGG CAG A*23:01:01 -- --- --- --- C-- --- --G --- -T- --- --- --- --- --- T-- --- --- --- --- --- --- --- --- -AC --- A*23:19Q -- --- --- --- C-- --- --G --- -T- --- --- --- --- --- T-- --- --- --- --- --- --- --- --- -AC --- A*01:01:01 GAC GCC TAC GAC GGC AAG GAT TAC ATC GCC CTG AAC GAG GAC CTG CGC TCT TGG ACC GCG GCG GAC ATG GCA GCT A*23:01:01 T-- --- --- --- --- --- --- --- --- --- --- --A --- --- --- --- --- --- --- --- --- --- --- --G --- A*23:19Q T-- --- --- --- --- --- --- --- --- --- --- --A --- --- --- --- --- --- --- --- --- --- --- --G --- A*01:01:01 CAG ATC ACC AAG CGC AAG TGG GAG GCG GTC CAT GCG GCG GAG CAG CGG AGA GTC TAC CTG GAG GGC CGG TGC GTG A*23:01:01 --- --- --- C-- --- --- --- --- --- -C- -G- -T- --- --- --- TT- --- -C- --- --- --- --- AC- --- --- A*23:19Q --- --- --- C-- --- --- --- --- --- -C- -G- -T- --- --- --- TT- --- -C- --- --- --- --- AC- --- --- A*01:01:01 GAC GGG CTC CGC AGA TAC CTG GAG AAC GGG AAG GAG ACG CTG CAG CGC ACG G A*23:01:01 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- - A*23:19Q --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- A A*23:01:01 and A*23:19N (Q) differ by one nucleotide replacement at the end of exon-3; replacement alters a splicing site, patient typed as A2, -. This data and previously reported data (13IHWS)indicate that A*23:19Q is null. A*23:19Q is now in the CWD

What Mutations affect and abrogate expression of HLA alleles A single nucleotide mutation that introduces a Premature Termination Codon (TAA, TAG, TGA) results in a truncated, often non functional, protein Mutations in sequences of splicing elements (intron-exon junctions) affect or fully abrogate expression of a functional protein Insertion(s)/deletion(s) in exons that change the reading frame for codons result in a non functional and/or truncated protein

Splicing modifications that abrogate or diminish HLA expression B*15010102N (STOP : 5) A*24020102L (STOP: 195) A*29010102N (STOP : retained intron 4) B*44020102S (soluble molecule) B*15010102N intron 1 retention A*24020102L use of a cryptic site located 15 nt downstream of the 5' end of exon 3 A*29010102N intron 4 retention B*44020102S exon 5 skipping Exon 1 AG EXON 2 EXON 3 GT G AG AG GGT AG EXON 4 GT AG Exon 5 Enh B A*02010102L (mutation in the promoter CAT box B) B*15010102N (del. 10 nt 17 nt upstream exon 2) A*24020102L (G -> A 7 nt upstream exon 3) A*23N or L (G -> A) A*29010102N (G -> T) B*44020102S (A->G) 42

Exonic Insertions and Deletions: change the sequence reading frame that introduce PMT A*2311N (STOP : 60 A*6818N (STOP : 59) B*1579N (STOP : 127) A*2611N (STOP: 190) A*0104N A*2307N A*2411N B*5111N (STOP: 196) A*0243N (STOP: 264) Exon 1 EXON 2 EXON 3 EXON 4 A*2311N ins. 23 nt : 25 A*6818N ins. 20 nt : 48 B*1579N ins. 2nt : 86 A*2611N ins. CC : 150 A*0104N A*2307N A*2411N B*5111N ins. C : 183-185 A*0243N ins. C : 236 43

Patient and Donor appear as Heterozygous and Matched at all HLA loci Molecules encoded in the HLA system PATIENT Molecules encoded in the HLA system DONOR Encoded in HLA-A locus (Class I) Encoded in HLA-A locus (Class I) Encoded in HLA-B locus (Class I) Encoded in HLA-DRB1 locus (Class II) Paternal origin Maternal origin 3 Encoded in HLA-B locus (Class I) Encoded in HLA-DRB1 locus (Class II) Paternal origin Maternal origin 3 The HLA-A mismatched antigen in the Donor can be recognized as foreign by the Patient s Immune System (Host versus Graft; rejection) The HLA-A mismatched antigen in the Patient can be recognized as foreign by the Donor s Immune System (Graft versus Host; GvHD and GvL)

Patient is Hemzygous in HLA-A and Donor is Heterozygous in HLA-A; One Difference (mismatch) HLA-A in the HvG direction Molecules encoded in the HLA system Encoded in HLA-A locus (Class I) PATIENT Molecules encoded in the HLA system Encoded in HLA-A locus (Class I) DONOR Encoded in HLA-B locus (Class I) Encoded in HLA-DRB1 locus (Class II) Paternal origin Maternal origin 3 Encoded in HLA-B locus (Class I) Encoded in HLA-DRB1 locus (Class II) Paternal origin Maternal origin 3 The HLA-A mismatched antigen in the Donor can be recognized as foreign by the Patient s Immune System (Host versus Graft; rejection) No mismatch in the Graft versus host direction (No Graft versus Host; No GvHD/ No GvL)

Typing two DRB5 alleles All reads need to be accounted Correct genotype: DRB5*01:01:01, DRB5*01:08N DRB5*01:02, 0108N DRB5*01:01:01, 01:02 DRB5*01:01:01, 01:08N DRB5*01:02/01:08N identical in exon 2, differ by 19 nt indel in exon 3 DRB5*01:01:01/01:02 identical in exon 3, differ by 3 nt substitutions in exon 2

Many allele groups in HLA-A show one allele with an insertion of an extra C after seven C A*01010101 AC CCC CCC.AAG ACA CAT ATG ACC CAC CAC A*0104N -- --- --- C--- --- --- --- --- --- --- A*02010101 -- G-- ---.--A --G --- --- --T --- --- A*03010101 -- --- ---.--- --- --- --- --- --- --- A*0321N -- --- --- C--- --- --- --- --- --- --- A*310102 -- --- ---.--- --G --- --- --T --- --- A*3114N -- --- --- C--- --G --- --- --T --- --- C A*02010101 AAAACGCATATGACTCACCAC A*0321N CAAGACACATATGACCCACCA MAARMSMMWWWK A*03010101 AAGACACATATGACCCACCAC A*02null CAAAACGCATATGACTCACCA MARAMMSMWWWK

Resolution of common and well documented null- alleles ( clinically relevant) Locus Allele related allele Difference Change Resolution Alternative A 0104N 010101 EXON 4 ins 1 routine SBT A 0253N 020101 EXON 2 PTC routine SBT A 2409N 240201 EXON 4 PTC routine SBT A 2411N 240201 EXON 4 ins 1 routine SBT A 6811N 680102 EXON 1 del 1 ad hoc SSP B 15010102N 150101 INTRON 1 del 10 ad hoc SSP extend reading by SBT B 4022N 400201 EXON 3 PTC routine SBT B 4423N 440201 EXON 3 PTC routine SBT B 5111N 510101 EXON 4 ins 1 routine SBT Cw 0409N 040101 EXON 7 del 1 ad hoc SSP Cw 0507N 050101 EXON 3 del 2 routine SBT DRB4 01030102N 010301 INTRON 1 splicing site ad hoc SSP extend reading by SBT DRB5 0108N 0102 EXON 3 del 19 ad hoc SSP DRB5 0110N 0102 EXON 2 del 2 routine SBT del = nuc. deletion ins = nuc. insertion PTC = premature termination codon Cw*0401/Cw*0409N if B*4403 is present DRB5*0102/0108N if possible haplotype is DRB1*1502-DQB1*0501

Detection of C*04:09N (common) and A*31:14N(rare) allele in single pass A*31:01:02 (red line) shows interrupted coverage at the beginning of Exon 4, while A*31:14N (blue line), which differs from A*31:01:02 with one base insertion, show continuous coverage. C*04:01:01:01 (red line) shows interrupted coverage at the end of Exon 7, while C*04:09N(blue line), which differs from C*04:01:01:01 with one base deletion, show continuous coverage.

Advantages of NGS Detecting Null Alleles is Clinically Important Current methods assume that most alleles are expressed even when only partial gene region are tested For some well-known and common null alleles, additional specialized testing is required when potentially present No ad hoc testing for rare or new null alleles. Assumptions may be wrong The NGS comprehensive approach described here can detect null alleles routinely in single pass

The application of NGS for Optimal Donor Selection (unrelated donors) Criteria for donor selection: Minimal number of mismatches GvH HvG Equally mismatched donors: Quality of the mismatch Permissible (C*03:03?C*03:04) DPB1 TCE-Permissive Low expression GvH target (C, DPB1)

Nature Genetics 41, 591-595 (2009) A genome-wide association study identifies variants in the HLA-DP locus associated with chronic hepatitis B in Asians Yoichiro Kamatani, Sukanya Wattanapokayakit, Hidenori Ochi, Takahisa Kawaguchi, Atsushi Takahashi, Naoya Hosono, Michiaki Kubo, Tatsuhiko Tsunoda, Naoyuki Kamatani, Hiromitsu Kumada, Aekkachai Puseenam, Thanyachai Sura, Yataro Daigo 1, Kazuaki Chayama, Wasun Chantratita, Yusuke Nakamura & Koichi Matsuda

A Novel Variant Marking HLA-DP Expression Levels Predicts Recovery from Hepatitis B Virus Infection Rasmi Thomasa, Chloe L. Thio, Richard Apps,Ying Qa, Xiaojiang Gao, Darlene Marti, Judy L. Stein, Kelly A. Soderberg, M. Anthony Moody, James J. Goedert, Gregory D. Kirk, W. Keith Hoots, Steven Wolinsky and Mary Carrington Variation in the 3 untranslated region of HLA-DPB1 is associated with spontaneous clearance of hepatitis B virus in both Japanese and U.S. populations. The mechanism facilitating viral clearance may be related to the A G single-nucleotide polymorphism rs9277534, which marks HLA-DP cellsurface expression. The rs9277534g allele is associated with high expression of HLA-DP, and the rs9277534a allele is associated with low expression. The 496GG genotype, which confers recessive susceptibility to HBV persistence, also associates in a recessive manner with significantly higher levels of HLA-DP surface protein and transcript level expression in healthy donors, suggesting that differences in expression of HLA-DP may increase the risk of persistent HBV infection.

HLA-DP surface protein levels correlate with the 496A/G genotype in the 3 UTR region of HLA- DPB1. Rasmi Thomas et al. J. Virol. 2012;86:6979-6985

HLA-DPB1 mrna levels correlate significantly with the 496A/G variant in the 3 UTR region of HLA- DPB1. Rasmi Thomas et al. J. Virol. 2012;86:6979-6985

DPB1 Genomic Structure, Associated DPB1 Single-Nucleotide- Polymorphism Haplotypes, and Resulting HLA-DP Expression. Fleischhauer K. N Engl J Med 2015;373:669-672.

High HLA-DP Expression and Graft-versus-Host Disease Effie W. Petersdorf, M.D., Mari Malkki, Ph.D., Colm O huigin, Ph.D., Mary Carrington, Ph.D., Ted Gooley, Ph.D., Michael D. Haagenson, M.S., Mary M. Horowitz, M.D., Stephen R. Spellman, M.B.S., Tao Wang, Ph.D., and Philip Stevenson, M.S. N Engl J Med 2015; 373:599-609August 13, 2015DOI: 10.1056/NEJMoa1500140

The linkage of HLA-DPB1 and rs9277534 was used to assign the rs9277534 allele to the mismatched HLA-DPB1 allele in recipients and donors. rs2281389 is included in the haplotype to show that rs2281389a haplotypes can encode either rs9277534a or G.

Multivariable Models of Transplant Outcomes for rs9277534g-linked HLA-DPB1 Mismatches Relative to rs9277534a-linked HLA-DPB1 Mismatches in Recipients. N = 744 rs9277534a recipients; 693 rs9277534g recipients.

Hazard Ratios for Outcomes of HLA-DPB1 Mismatches in Transplant Recipients, According to the rs9277534 Allele Linked to the Mismatch. Petersdorf EW et al. N Engl J Med 2015;373:599-609.

Probability of Grade II, III, or IV Acute Graft-versus-Host Disease. Petersdorf EW et al. N Engl J Med 2015;373:599-609.

Our Work in Characterization of DP variation Cloning and Sequencing: 16 DPA1 52 DPB1

100 74 100 DPB1*02:01:04e1 L_AA DPB1*02:01:02v5 L_AA DPB1*02:01:02v6 L_AA 42 DPB1*02:01:02 L_AA DPB1*02:01:02v3 L_AA DPB1*02:01:02v7 L_AA 32 DPB1*02:02 L_AA DPB1*02:01:02v2 L_AA 49 DPB1*02:01:02v1 L_AA 68 DPB1*02:01:02v4 L_AA DPB1*04:02:01:01 L_AA 86 DPB1*04:02:01:02 L_AA DPB1*04:01:01:01v1 L_AA DPB1*04:01:31 L_AA 54 DPB1*04:01:31 L_AA DPB1*04:01:01:01v4 L_AA DPB1*04:01:01:01v5 L_AA DPB1*04:01:01:01 L_AA DPB1*04:01:01:01v3 L_AA DPB1*464:01 DPB1*04:01:01:02 L_AA DPB1*398:01 97 DPB1*30:01 DPB1*58:01e1 100 DPB1*17:01e1 L_AA 99 DPB1*17:01x1 DPB1*19:01e1 H_GA DPB1*39:01x1 DPB1*11:01:01e1 H_GA 69 DPB1*27:01e1 96 DPB1*13:01:01/DPB1*107:01e1 H_GA 94 DPB1*85:01e1 H_GA 40 DPB1*01:01:01e1 H_GA DPB1*296:01e1 98 DPB1*15:01:01e1 H_GA 99 DPB1*18:01e1 H_GA 100 45 DPB1*05:01:01e1 H_GA DPB1*414:01e1 48 DPB1*463:01 DPB1*16:01:01 H_GG 64 DPB1*21:01e1 68 DPB1*06:01e1 H_GG 76 DPB1*09:01:01e1 H_GG 91 DPB1*104:01e1 74 DPB1*03:01:01 H_GG 55 DPB1*14:01:01e1 H_GG exon 2 to exon4 phylogenetic analysis rs9277534 rs22811389 HLA-DP Expression levels A A Low A G High G G High

42 DPB1*02:01:04e1 L_AA DPB1*02:01:02v5 L_AA DPB1*02:01:02v6 L_AA DPB1*02:01:02 L_AA Intron 2 Deletion Low 32 49 DPB1*02:01:02v3 L_AA DPB1*02:01:02v7 L_AA DPB1*02:02 L_AA DPB1*02:01:02v2 L_AA DPB1*02:01:02v1 L_AA 68 DPB1*02:01:02v4 L_AA DPB1*04:02:01:01 L_AA 86 DPB1*04:02:01:02 L_AA DPB1*04:01:01:01v1 L_AA 54 DPB1*04:01:31 L_AA DPB1*04:01:31 L_AA DPB1*04:01:01:01v4 L_AA DPB1*04:01:01:01v5 L_AA 74 DPB1*04:01:01:01 L_AA DPB1*04:01:01:01v3 L_AA DPB1*464:01 100 DPB1*04:01:01:02 L_AA DPB1*398:01 97 DPB1*30:01 DPB1*58:01e1 100 DPB1*17:01e1 L_AA 99 DPB1*17:01x1 DPB1*19:01e1 H_GA DPB1*39:01x1 100 40 94 69 96 DPB1*11:01:01e1 H_GA DPB1*27:01e1 DPB1*13:01:01/DPB1*107:01e1 H_GA DPB1*85:01e1 H_GA DPB1*01:01:01e1 H_GA DPB1*296:01e1 100 45 98 DPB1*15:01:01e1 H_GA 99 DPB1*18:01e1 H_GA DPB1*05:01:01e1 H_GA DPB1*414:01e1 High 48 DPB1*463:01 DPB1*16:01:01 H_GG 64 DPB1*21:01e1 68 DPB1*06:01e1 H_GG 76 DPB1*09:01:01e1 H_GG 91 DPB1*104:01e1 74 DPB1*03:01:01 H_GG 55 DPB1*14:01:01e1 H_GG

Low High 100 74 100 DPB1*02:01:04e1 L_AA DPB1*02:01:02v5 L_AA DPB1*02:01:02v6 L_AA 42 DPB1*02:01:02 L_AA DPB1*02:01:02v3 L_AA DPB1*02:01:02v7 L_AA 32 DPB1*02:02 L_AA DPB1*02:01:02v2 L_AA 49 DPB1*02:01:02v1 L_AA 68 DPB1*02:01:02v4 L_AA DPB1*04:02:01:01 L_AA 86 DPB1*04:02:01:02 L_AA DPB1*04:01:01:01v1 L_AA DPB1*04:01:31 L_AA 54 DPB1*04:01:31 L_AA DPB1*04:01:01:01v4 L_AA DPB1*04:01:01:01v5 L_AA DPB1*04:01:01:01 L_AA DPB1*04:01:01:01v3 L_AA DPB1*464:01 DPB1*04:01:01:02 L_AA DPB1*398:01 97 DPB1*30:01 DPB1*58:01e1 100 DPB1*17:01e1 L_AA 99 DPB1*17:01x1 DPB1*19:01e1 H_GA DPB1*39:01x1 DPB1*11:01:01e1 H_GA 69 DPB1*27:01e1 96 DPB1*13:01:01/DPB1*107:01e1 H_GA 94 DPB1*85:01e1 H_GA 40 DPB1*01:01:01e1 H_GA DPB1*296:01e1 98 DPB1*15:01:01e1 H_GA 99 DPB1*18:01e1 H_GA 100 45 DPB1*05:01:01e1 H_GA DPB1*414:01e1 48 DPB1*463:01 DPB1*16:01:01 H_GG 64 DPB1*21:01e1 68 DPB1*06:01e1 H_GG 76 DPB1*09:01:01e1 H_GG 91 DPB1*104:01e1 74 DPB1*03:01:01 H_GG 55 DPB1*14:01:01e1 H_GG

E2 264 X(AAGG) E3 282 E4 111 I2 4172 4227 bp I3 F_DPB1 DPB1 Fragment E2/E4 (5.1kb) R_DPB1 Figure 1: Schematic illustration of DPB1*04:01:01:01 allele. Exons are represented by black boxes. E2 E4 Exons 2 4. I2 I3 introns 2 3 and STRs location. The numbers represent the exon length in base pairs. primers F_DPB1 and R_DPB1 were used to amplify the DPB1 fragment E2/E4.

STR Analysis : Short - Short DPB1* 01:01:01e1, 05:01:01e1

STR Analysis : Short - Long DPB1* 02:01:02, 13:01:01e1

STR Analysis : Long - Long DPB1* 02:01:02, 02:01:02v3

Clinical HLA Typing by NGS in Transplantation Extended gene sequence coverage Identification of functional variants (known and novel) Self and non-self alleles (proteins) Evaluation of antibody reactivity in light of self and non-self antigens Accurate assessment of patient-donor compatibility (match grade) Identification of expression determinants and expression variants Optimization of donor selection (Hematopoietic and Solid Organ Transplantation) Bone Marrow Registry: all loci typed at full or extended coverage Immediate identification of eligible donors or indication that no donor is available Shortened Donor Search Process Early Decisions about treatment options and alternative therapies

Acknowledgements Lisa Creary Konstantinos Barsakis Kalyan Mallemapati, Sridevi Gangavarapu Dolly Tyan Michael Mindrinos, Sujatha Krishnakumar, Chunlin Wang, Ming Li, Mark Davis, Ronald Davis Stanford HIDPL Sirona Genomics Immucor