Evaluation of MIA FORA NGS HLA test and software. Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group
|
|
- Sherilyn Reeves
- 5 years ago
- Views:
Transcription
1 Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group
2 Disclosure Alpha and Beta Studies Sirona Genomics Reagents, *Equipment, and Software supplied by Sirona Genomics *Thermal cyclers, Biomek 4000, and Illumina MiSeq
3 NGS-HLA typing requirements for the Stanford Blood Center Unambiguous phased genotypes Automated methods Accurate unedited genotype calls Easy to perform Easy intuitive software Cost effective No reflexive testing 3-4 day TAT
4 MIA FORA NGS HLA TECHNOLOGY Comprehensive coverage of class I (HLA-A, -B, -C) and class II (DPA, -DPB, -DQA, -DQB, -DRB1, -DRB3, - DRB4, -DRB5) genes using long range PCR Multiplexed x24 samples per Illumina MiSeq run Unambiguous phased genotypes at the 4-field level of resolution in a single pass Detection of novel and null alleles Automated and Manual methods developed
5 MIA FORA NGS HLA typing solution Low Throughput kit: 24 samples PCR Master mixes x 1 box, 9 tubes Post PCR x 1 box, 12 tubes x 1 96-well plate (indexes) Compact Easy Storage
6 Alpha Study Conducted from March 2015 to May 2015 On-site training by Sirona Genomics Biomek 4000 programs written and installed by Sirona Genomics Evaluated control DNA samples (x12) supplied by Sirona Genomics using both manual and automated methods Evaluated 138 Stanford Blood Center DNA samples x 2 runs using the manual protocol x 4 runs using the automated protocol
7 Liquid handling workstations Pre-PCR Post-PCR Perkin Elmer NGS Express Biomek 4000
8 Long Range Amplification , 5.6 Single PCR condition used for all loci Optimized extensively to preserve allele balance and prevent allele dropout
9 Pool Sirona Workflow Day 1 (~5 hours) Long Range PCR Samples 1-8 Samples 9-16 Samples Quantification, Balancing and Pooling amplicons Day 2 3 Library prep Enzymatic Fragmentation, End repair, A tailing Index adaptor ligation Pooling, Size Selection, qpcr Day 4 (24 hours) Sequencing Day 5 (4 hours) HLA genotype Assignment 2 x 150 bp paired end reads
10 Alpha study Concordance results of Sirona Control DNA samples Total alleles N = 216 A B C DPA1 DPB1 DQA1 DQB1 DRB1 DRB3 DRB4 DRB5 Manual 100% 100% 100% 100% 100% 100% 100% 100% 100% 100% 100% Automated 100% 100% 100% 100% 100% 100% 100% 100% 100% 100% 100% Unambiguous typing at 2-field level of resolution using both manual and automated methods
11 Alpha Study Stanford Blood Center Samples Unedited Genotype Calls Overall Concordance 99.1% Edited Genotype Calls Overall Concordance 99.9% Identical Identical 25.3 Ambiguous Reference, Unambiguous NGS 25.4 Ambiguous Reference, Unambiguous NGS 73.0 Ambiguous Reference, Ambiguous NGS 73.6 Ambiguous Reference, Ambiguous NGS Unambiguous Reference, Ambiguous NGS Unambiguous Reference, Ambiguous NGS Total Samples Alleles with SBT/SSP/SSO reference genotypes Number of NGS alleles
12 Alpha Study Stanford Blood Center Samples Unedited genotypes Edited genotypes A B C DPA1 DPB1 DQA1 DQB1 DRB1 DRB3 DRB4 DRB5 0 A B C DPA1 DPB1 DQA1 DQB1 DRB1 DRB3 DRB4 DRB5
13 Alpha Study Sources of discordance (Edited Results) NGS Novel alleles (exon variants) BS-25: DQA1*05:05:01:01_Exon 3 Variant, insertion of T, codon 135, frameshift mutation. S-70: DQB1*05:01:01:01_Exon 1 Variant, C to T, Ser to Ser, codon -6. S-100: Novel allele by SBT reported as C*03@/C*14 hybrid. Novel allele by NGS is hybrid of C*07:02:01:01 exon 1-intron2/C*14:02:01 exon 3-3 UTR.
14 Improvements at end of Alpha study Laboratory work Increased pooling amount of DRB amplicons to improve balancing Software database Cloned and sequenced all alleles of IHWG 50 cell lines Included reference sequences for all DPA1 and DPB1 alleles Genotype calling algorithms enhanced to improve accuracy of automatic calls
15 Beta Study Conducted from August 2015 to October 2015 Evaluated 69 Stanford Blood Center DNA samples x 3 runs using the automated protocol
16 Beta Study Stanford Blood Center Samples Unedited Genotype Calls Overall Concordance 99.3% Edited Genotype Calls Overall Concordance 99.5% Identical Ambiguous Reference, Unambiguous NGS Ambiguous Reference, Ambiguous NGS Unambiguous Reference, Ambiguous NGS Identical Ambiguous Reference, Unambiguous NGS Ambiguous Reference, Ambiguous NGS Unambiguous Reference, Ambiguous NGS Disconcordant Disconcordant Total Samples Alleles with SBT/SSP/SSO reference genotypes Number of NGS alleles
17 Beta Study Stanford Blood Center Samples Unedited genotypes Edited genotypes A B C DPA1 DPB1 DQA1 DQB1 DRB1 DRB3 DRB4 DRB5 0 A B C DPA1 DPB1 DQA1 DQB1 DRB1 DRB3 DRB4 DRB5
18 Beta Study Reasons for discordance (Edited Results) NGS Novel alleles (exon variants) BS-72: A*23:01:01_Exon 4 Variant, C to T, Ala to Val, codon 211. SBC-200: B*40:02:01e1_Exon 3 Variant, T to G, Leu to Arg, codon 95. SBC-202: DQB1*05:01:01:01_Exon 1 Variant, C to T, Ser to Ser, codon -6. SBC-207: DPA1*02:02:02e1_Exon 3 Variant, C to G, Pro to Ala, codon 96. SBC-223: DQB1*05:01:01:01_Exon 1 Variant, C to T, Ser to Ser, codon -6.
19 MIA FORA NGS Software Accurate phase defined unambiguous HLA genotypes Three complementary algorithms: 1) Expected-Maximization to rank alleles based on coverage metrics: Coverage calculated from competitive alignment of PE reads with HLA reference sequences from the IMGT/HLA database and in-house reference sequences 2) Phasing assembly algorithm 3) Bayesian consensus algorithm High Performance server, multiple user access
20 MIA FORA NGS Software
21 MIA FORA NGS Software
22 MIA FORA NGS Software Confidence >=90 Confidence >=70 Confidence >=50 Confidence >=0 non-cwd CWD Overwritten Automatic Call Not found in LD DB Found in LD DB 1/2 1/2 Number of contigs different from that of alleles Number of contigs same as that of alleles? Inconsistence between genotype derived from phased and EM result.
23 SBT/SSO vs NGS Resolving an allele ambiguity Reference genotype: A*23:01/A*23:17, A*29:02 NGS genotype: A*23:17, A*29:02 A*23:01:01 x1 M/M in exon 5 S-225
24 SBT/SSO vs NGS Resolving a phase ambiguity and identifying a novel allele BS-72 Reference genotype: A*03:78, A*23:01 A*03:78 / A*03:01:01:01 1 nt difference in Exon 4
25 SBT/SSO vs NGS Resolving a phase ambiguity and identifying a novel allele BS-72, Reference genotype: A*03:78/A*03:01:01:01, A*23:01 NGS genotype: A*03:01:01:01, A*23:01:01_Exon4 variant, C > T, Ala >Val, codon 211 A*23:01:01 x1 M/M in exon 4
26 SBT/SSO vs NGS Identifying a novel allele S-101, Reference Type Result: B*13@, B*38@, one allele is an exon 4 variant? NGS Result: B*13:02:01, B*38:02:01 _Exon 4 variant A to G, Lys to Arg, codon 186.
27 DRB4*01:03:01:02Ne1 S-214 Genomic reference sequence
28 S-16 Evidence of a second allele Unmapped reads that do not align to DRB1*01:03:01:01 Second allele: DRB1*01:01:01:01
29 Evidence of a second allele S-36 Unmapped reads that do not align to DPA1*01:03:01:04 Second allele: DPA1*02:01:01_x2 intron 1 variants
30 Summary MIA FORA workflows (manual and automated) are very easy to follow Pooling amplicons early on the process reduces hands on time, decrease costs, minimizes deck space used on automated workstations High concordance (99.9%) with reference genotypes Wide gene coverage using 2 x 150 bp paired end reads minimized phased ambiguities for all loci except for some DPB1 allele combinations MIA FORA NGS able to distinguish all genotypes at 3-fields and for the majority of genotypes at 4-field level resolution Software continually improved during Alpha and Beta trials to improve accuracy of automatic calls
31 Acknowledgments Stanford Blood Center Prof Dolly Tyan Prof Marcelo Fernandez-Vina Sridevi Gangavarapu Sirona Genomics Michael Mindrinos Sujatha Krishnakumar Chunlin Wang Ming Li Tommy Liu Jennifer Simonovich Raquel Kuehn Marilyn Fukushima Farbod Babrzadeh
2/10/2016. Evaluation of MIA FORA NGS HLA test and software. Disclosure. NGS-HLA typing requirements for the Stanford Blood Center
Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,
More informationHandouts. Handouts 2/11/ Thank you for joining us today
2/11/2016 Thank you for joining us today Agenda: Applications of NGS in Transplantation Marcelo A. Fernández-Viña, Ph.D. Director Histocompatibility, Immunogenetics, and Disease Profiling Laboratory Stanford
More informationValidation of the MIA FORA NGS FLEX Assay Using Buccal Swabs as the Sample Source
S. Krishnakumar, M. Li, C. Wang, M, Osada, R. Kuehn, M. Fukushima and Y. Thorstenson Immucor, Inc. S. Krishnakumar, M. Li, C. Wang, M, Osada, R. Kuehn, M. Fukushima and Y. Thorstenson Immucor, Inc. Introduction
More informationHLA and new technologies. Vicky Van Sandt
HLA and new technologies. Vicky Van Sandt Life-threatning malignant and non malignant blood disorders can be cured by hematopoetic stem cell transplantation (HSCT). GVHD is the 2nd most prevalent cause
More informationDEFINITIONS OF HISTOCOMPATIBILITY TYPING TERMS
DEFINITIONS OF HISTOCOMPATIBILITY TYPING TERMS The definitions below are intended as general concepts. There will be exceptions to these general definitions. These definitions do not imply any specific
More informationHistocompatibility Evaluations for HSCT at JHMI. M. Sue Leffell, PhD. Professor of Medicine Laboratory Director
Histocompatibility Evaluations for HSCT at JHMI M. Sue Leffell, PhD Professor of Medicine Laboratory Director JHMI Patient Population Adults Peds NMDP data >20,000 HSCT JHMI HSCT Protocols Bone marrow
More informationThe Human Major Histocompatibility Complex
The Human Major Histocompatibility Complex 1 Location and Organization of the HLA Complex on Chromosome 6 NEJM 343(10):702-9 2 Inheritance of the HLA Complex Haplotype Inheritance (Family Study) 3 Structure
More informationAVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB
Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation
More informationMarcelo Fernandez Vina Conflict of Interest: Co-Founder Sirona Genomics
Marcelo Fernandez Vina Conflict of Interest: Co-Founder Sirona Genomics Next Generation Sequencing (NGS) and its Role in Transplantation Marcelo A. Fernández Viña, Ph.D. Professor Department of Pathology
More informationAdvance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More informationCalculation Tables. Olerup SSP Kits without Taq Polymeras
Calculation Tables lerup SSP Kits without Taq Polymeras Table 1: Volumes of the components needed per test for different numbers of when using Master Mix without. The recommended volumes listed below include
More informationFONS Nové sekvenační technologie vklinickédiagnostice?
FONS 2010 Nové sekvenační technologie vklinickédiagnostice? Sekvenování amplikonů Sequence capture Celogenomové sekvenování FONS 2010 Sekvenování amplikonů Amplicon sequencing - amplicon sequencing enables
More informationASHI Proficiency Testing Program Summary Report. Survey 2013-HT1 / HLA Typing
ASHI Proficiency Testing Program Summary Report Survey 2013-HT1 / HLA Typing Shipping Date: February 26,2013 / Results Due Date:April 5,2013 / Report Date: May 17,2013 The ASHI HT proficiency testing survey
More informationPerformance Characteristics BRCA MASTR Plus Dx
Performance Characteristics BRCA MASTR Plus Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Table of Contents 1. Workflow... 4 2. Performance Characteristics
More informationCalculation Tables. Olerup SSP Kits without Taq Polymeras
Calculation Tables lerup SSP Kits without Polymeras Table 1: Volumes of the components needed per test for different numbers of when using Master Mix without. The recommended volumes listed below include
More informationAbstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
More informationHigh Throughput TruSeq Stranded mrna Library Construction on the Biomek FX P
High Throughput TruSeq Stranded mrna Library Construction on the Biomek FX P Zach Smith and Scott D. Michaels The Center for Genomics and Bioinformatics Indiana University Bloomington, IN USA Mary Blair
More informationNGS in tissue and liquid biopsy
NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences
More informationDocumentation of Changes to EFI Standards: v 5.6.1
Modified Standard B - PERSONNEL QUALIFICATIONS B1.000 The laboratory must employ one or more individuals who meet the qualifications and fulfil the responsibilities of the Director/Co-Director, Technical
More informationMutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationPG-Seq NGS Kit for Preimplantation Genetic Screening
Application Note: PG-Seq Validation Study PG-Seq NGS Kit for Preimplantation Genetic Screening Validation using Multi (5-10) Cells and Single Cells from euploid and aneuploid cell lines Introduction Advances
More informationStructural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
More informationLynch Syndrome and COLARIS Testing
Lynch Syndrome and COLARIS Testing Webinar Objectives Review of Lynch syndrome as a multi-gene disorder COLARIS Enhancements Technical Overview COLARIS test offerings Test development and validation process
More informationMultiplex target enrichment using DNA indexing for ultra-high throughput variant detection
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin
More informationCirculating Cell-Free DNA Pre-analytics: Importance of ccfdna Stabilization and Extraction for Liquid Biopsy Applications
Circulating Cell-Free DNA Pre-analytics: Importance of ccfdna Stabilization and Extraction for Liquid Biopsy Applications Martin Schlumpberger, Ass.Director R&D, QIAGEN GmbH IQNpath 2017 - Circulating
More informationNGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation
NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department
More informationCOMPARISON OF HIV DRUG-RESISTANT MUTANT DETECTION BY NGS WITH AND WITHOUT UNIQUE MOLECULAR IDENTIFIERS (UMI)
COMPARISON OF HIV DRUG-RESISTANT MUTANT DETECTION BY NGS WITH AND WITHOUT UNIQUE MOLECULAR IDENTIFIERS (UMI) Kevin D McCormick; Kerri J Penrose; Rahil Sethi; Jacob Waldman; William Schwarzmann; Uma Chandran;
More informationDiversity and Frequencies of HLA Class I and Class II Genes of an East African Population
Open Journal of Genetics, 2014, 4, 99-124 Published Online April 2014 in SciRes. http://www.scirp.org/journal/ojgen http://dx.doi.org/10.4236/ojgen.2014.42013 Diversity and Frequencies of HLA Class I and
More informationAccel-Amplicon Panels
Accel-Amplicon Panels Amplicon sequencing has emerged as a reliable, cost-effective method for ultra-deep targeted sequencing. This highly adaptable approach is especially applicable for in-depth interrogation
More informationA complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis
APPLICATION NOTE Cell-Free DNA Isolation Kit A complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis Abstract Circulating cell-free DNA (cfdna) has been shown
More informationNew technologies reaching the clinic
New technologies reaching the clinic Martin Däumer May 31, 2018 Deep-sequencing Standard Sanger-sequencing...PQIYMDDHTRE... Ultra-deep-sequencing...PQIYMDDHTRE......PQIYMDDHTRE......PQIYVDDHTRE......PQIYMDDHTRE......PQIYMDDHTRE......PQIYMDDHTRE...
More informationFluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS
APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor
More informationNature Biotechnology: doi: /nbt.1904
Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is
More informationIntroduction of an NGS gene panel into the Haemato-Oncology MPN service
Introduction of an NGS gene panel into the Haemato-Oncology MPN service Dr. Anna Skowronska, Dr Jane Bryon, Dr Samuel Clokie, Dr Yvonne Wallis and Professor Mike Griffiths West Midlands Regional Genetics
More informationHigh resolution HLA typing from second generation sequencing data
High resolution HLA typing from second generation sequencing data This thesis is presented for the degree of Doctor of Philosophy Murdoch University Don Cooper Institute for Immunology and Infectious Diseases
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationAnalysis with SureCall 2.1
Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis
More informationCPT Codes for Pharmacogenomic Tests
CPT s for Pharmacogenomic Tests The table below lists CPT codes and lab fee information for pharmacogenomic tests as established by the Centers for Medicare and Medicaid Services. It was compiled by the
More informationNext Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters
Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters XXXth International Symposium on Technical Innovations in Laboratory Hematology Honolulu, Hawaii
More informationBreast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and
More informationUsing the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep
Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold
More informationMinimal Requirements for Histocompatibility & Immunogenetics Laboratory
Minimal Requirements for Histocompatibility & Immunogenetics Laboratory The 4 th WBMT Congress and Workshop Riyadh, KSA - January 15-17, 2017 HLA Discovery, 1958 The Nobel Prize in Physiology or Medicine
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More informationTargeted qpcr. Debate on PGS Technology: Targeted vs. Whole genome approach. Discolsure Stake shareholder of GENETYX S.R.L
Antonio Capalbo, PhD Laboratory Director GENETYX, reproductive genetics laboratory, Italy PGT responsible GENERA centers for reproductive medicine, Italy Debate on PGS Technology: Targeted vs. Whole genome
More informationRun glycans up to 5x faster than HILIC
FAST GLYCAN LABELING AND ANALYSIS TECHNOLOGY Run glycans up to 5x faster than HILIC HI-RES ANALYSIS AND ID IN MINUTES Run Your Glycans in Record Time High-Resolution Glycan Identification and Quantitation
More informationLiquid biopsy in lung cancer: The EGFR paradigm
Liquid biopsy in lung cancer: The EGFR paradigm Lynette M. Sholl, M.D. Brigham and Women s Hospital Dana Farber Cancer Institute Department of Pathology Boston, MA Disclosure of Relevant Financial Relationships
More informationHLA Mismatches. Professor Steven GE Marsh. Anthony Nolan Research Institute EBMT Anthony Nolan Research Institute
HLA Mismatches Professor Steven GE Marsh HLA Mismatches HLA Genes, Structure, Polymorphism HLA Nomenclature HLA Mismatches in HSCT Defining a mismatch HLA Mismatches HLA Genes, Structure, Polymorphism
More informationSupplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.
Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized
More informationOVERVIEW OF CURRENT IDENTIFICATION SYSTEMS AND DATABASES
OVERVIEW OF CURRENT IDENTIFICATION SYSTEMS AND DATABASES EVERY STEP OF THE WAY 1 EVERY STEP OF THE WAY MICROBIAL IDENTIFICATION METHODS DNA RNA Genotypic Sequencing of ribosomal RNA regions of bacteria
More informationgenomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Clinical Transplantation Laboratory (CTL) 3rd Floor Tower Wing Guy's Hospital SE9 1RT Contact: Jeremy Skinner Tel: +44 (0)2071881713 E-Mail:
More informationWHO Prequalification of In Vitro Diagnostics PUBLIC REPORT. Product: Alere q HIV-1/2 Detect WHO reference number: PQDx
WHO Prequalification of In Vitro Diagnostics PUBLIC REPORT Product: Alere q HIV-1/2 Detect WHO reference number: PQDx 0226-032-00 Alere q HIV-1/2 Detect with product codes 270110050, 270110010 and 270300001,
More informationImmunogenetics in SARS: a casecontrol
RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES MHL Ng 吳香玲 SH Cheng 鄭淑恆 KM Lau 劉建盟 GM Leung 梁卓偉 US Khoo 邱瑋璇 BCW Zee 徐仲鍈 JJY Sung 沈祖堯 Key Messages 1. Human leukocyte antigen (HLA) genotypes from 102
More informationSTEP-programme S-candiaT-ransplant kidney E-xchange P-rogramme (STEP) Version 1.8
STEP-programme S-candiaT-ransplant kidney E-xchange P-rogramme (STEP) Version 1.8 June 12, 2017 General guidelines Purpose To increase the likelihood of offering a suitable kidney graft to immunized (HI)
More informationCompleting the CIBMTR Confirmation of HLA Typing Form (Form 2005)
Completing the CIBMTR Confirmation of HLA Typing Form (Form 2005) Stephen Spellman Research Manager NMDP Scientific Services Maria Brown Scientific Services Specialist Data Management Conference 2007 1
More informationPersonalized Healthcare Update
Dr. Kai - Oliver Wesche Market Development Manager, Personalized Healthcare QIAGEN Personalized Healthcare Update Pioneering Personalized Medicine through Partnering TOMTOVOK BKM120 Zelboraf QIAGEN partners:
More informationIso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing
Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing PacBio Americas User Group Meeting Sample Prep Workshop June.27.2017 Tyson Clark, Ph.D. For Research Use Only. Not
More informationiplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers).
Supplementary Materials Supplementary Methods iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). IDH1 R132H and R132L Forward:
More informationQIAGEN Complete Solutions for Liquid Biopsy Molecular Testing
QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing Christopher Swagell, PhD Market Development Manager, Advanced Molecular Pathology QIAGEN 1 Agenda QIAGEN Solid Tumor Testing and Liquid Biopsy
More informationHandling Immunogenetic Data Managing and Validating HLA Data
Handling Immunogenetic Data Managing and Validating HLA Data Steven J. Mack PhD Children s Hospital Oakland Research Institute 16 th IHIW & Joint Conference Sunday 3 June, 2012 Overview 1. Master Analytical
More informationMRC-Holland MLPA. Description version 08; 30 March 2015
SALSA MLPA probemix P351-C1 / P352-D1 PKD1-PKD2 P351-C1 lot C1-0914: as compared to the previous version B2 lot B2-0511 one target probe has been removed and three reference probes have been replaced.
More informationSelective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples
DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Selective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples LIBRARY
More informationMEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)
Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)
More informationCRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery
CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences
More informationCharacterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser
Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why
More informationDetection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit
APPLICATION NOTE Ion PGM System Detection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit Key findings The Ion PGM System, in concert with the Ion ReproSeq PGS View Kit and Ion Reporter
More informationP. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University.
Databases and Tools for High Throughput Sequencing Analysis P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. HTseq Platforms Applications on Biomedical Sciences
More informationSignificance of the MHC
CHAPTER 7 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ
More informationFRAGILE X MOLECULAR DIAGNOSTICS ORDERING INFORMATION. FragilEaseTM FRAGILEASETM ASSAY CHARACTERISTICS WORKFLOW. PCR Purification.
ORDERING INFORMATION FRAGILEASE ASSAY CHARACTERISTICS High and low throughput options for cost- and timeefficient analyses 96 or 1152 reactions per kit Turnaround time from DNA to report approximately
More informationThe clearest path to the most meaningful results. The cobas HPV Test delivers clinical value with workflow efficiencies every step of the way
The clearest path to the most meaningful results The cobas HPV Test delivers clinical value with workflow efficiencies every step of the way The cobas HPV Test KNOW THE RISK Help guide clinical decision
More informationSALSA MLPA probemix P241-D2 MODY mix 1 Lot D As compared to version D1 (lot D1-0911), one reference probe has been replaced.
mix P241-D2 MODY mix 1 Lot D2-0413. As compared to version D1 (lot D1-0911), one reference has been replaced. Maturity-Onset Diabetes of the Young (MODY) is a distinct form of non insulin-dependent diabetes
More informationSupporting Information
Supporting Information Honegger et al. /pnas.0 HCV proteins Core E E P NS NS NSA NSB NSA NSB HCV peptide pools 9 Fig. S. HCV proteins represented in the nine peptide pool arrays used for the IFN-γ ELISpot
More informationDiagnostic Methods of HBV infection. Zohreh Sharifi,ph.D of Virology Research center, Iranian Blood Transfusion Organization (IBTO)
Diagnostic Methods of HBV infection Zohreh Sharifi,ph.D of Virology Research center, Iranian Blood Transfusion Organization (IBTO) Hepatitis B-laboratory diagnosis Detection of HBV infection involves
More informationSingle-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials
More informationRNA based high-resolution HLA sequencing based typing
Chapter 2 RNA based high-resolution HLA sequencing based typing Judith Reinders, Anna Houben, Alain van Mill, Erik Rozemuller, Jan van den Tweel and Marcel Tilanus Department of Pathology, University Medical
More informationAmbient temperature regulated flowering time
Ambient temperature regulated flowering time Applications of RNAseq RNA- seq course: The power of RNA-seq June 7 th, 2013; Richard Immink Overview Introduction: Biological research question/hypothesis
More informationPlease Silence Your Cell Phones. Thank You
Please Silence Your Cell Phones Thank You Utility of NGS and Comprehensive Genomic Profiling in Hematopathology Practice Maria E. Arcila M.D. Memorial Sloan Kettering Cancer Center New York, NY Disclosure
More informationCyBio Felix Your Automated Application Starts Here
Title Label Lab Automation CyBio Felix Your Automated Application Starts Here 2 CyBio FeliX Future-Proof Liquid Handling Automation Transform your manual workflows to automated processes on your benchtop!
More informationCytogenetics 101: Clinical Research and Molecular Genetic Technologies
Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these
More informationProduct # Kit Components
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Pneumocystis jirovecii PCR Kit Product # 42820 Product Insert Background Information
More informationHome Brewed Personalized Genomics
Home Brewed Personalized Genomics The Quest for Meaningful Analysis Results of a 23andMe Exome Pilot Trio of Myself, Wife, and Son February 22, 2013 Gabe Rudy, Vice President of Product Development Exome
More informationIllumina Trusight Myeloid Panel validation A R FHAN R A FIQ
Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ G E NETIC T E CHNOLOGIST MEDICAL G E NETICS, CARDIFF To Cover Background to the project Choice of panel Validation process Genes on panel, Protocol
More informationAnalysis of the genetic diversity of influenza A viruses using next-generation DNA sequencing
See discussions, stats, and author profiles for this publication at: http://www.researchgate.net/publication/273470093 Analysis of the genetic diversity of influenza A viruses using next-generation DNA
More informationSomatic cancer applications of NGS in in vitro Diagnostics.
Somatic cancer applications of NGS in in vitro Diagnostics. Nitin Udar PhD In Vitro Diagnsotics Division Illumina, Inc. 2013 Illumina, Inc. All rights reserved. Illumina, IlluminaDx, BaseSpace, BeadArray,
More informationncounter Data Analysis Guidelines for Copy Number Variation (CNV) Molecules That Count NanoString Technologies, Inc.
ncounter Data Analysis Guidelines for Copy Number Variation (CNV) NanoString Technologies, Inc. 530 Fairview Ave N Suite 2000 Seattle, Washington 98109 www.nanostring.com Tel: 206.378.6266 888.358.6266
More informationHow to Standardise and Assemble Raw Data into Sequences: What Does it Mean for a Laboratory to Use Such Technologies?"
How to Standardise and Assemble Raw Data into Sequences: What Does it Mean for a Laboratory to Use Such Technologies?" Dr Joseph Hughes 11th OIE Seminar Saskatoon - 17th June 2015 Cost per raw Megabase
More informationSupplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR
Supplemental Materials and Methods Plasmids and viruses To generate pseudotyped viruses, the previously described recombinant plasmids pnl4-3-δnef-gfp or pnl4-3-δ6-drgfp and a vector expressing HIV-1 X4
More informationASSESSMENT OF THE RISK FOR TYPE 1 DIABETES MELLITUS CONFERRED BY HLA CLASS II GENES. Irina Durbală
ASSESSMENT OF THE RISK FOR TYPE 1 DIABETES MELLITUS CONFERRED BY HLA CLASS II GENES Summary Irina Durbală CELL AND MOLECULAR BIOLOGY DEPARTMENT FACULTY OF MEDICINE, OVIDIUS UNIVERSITY CONSTANŢA Class II
More informationExosome DNA Extraction Kits
Exosome DNA Extraction Kits Summary Section 5 Introduction 40 EXO-DNAc 41 EXO-DNA 43 Introduction Genomic DNA Extractiom Kits Ordering informations Products can be purchased directly in our on-line shop:
More informationDetection of low-frequent mitochondrial DNA variants using SMRT sequencing
Detection of low-frequent mitochondrial DNA variants using SMRT sequencing Marjolein J.A. Weerts SMRT Leiden 2018 June 13 Content Mitochondrial DNA & liquid biopsy in oncology Pitfalls when studying human
More informationEvaluation of Dried Blood Spots (DBS) for Human Immunodeficiency Virus (HIV-1) Drug Resistance Testing
Evaluation of Dried Blood Spots (DBS) for Human Immunodeficiency Virus (HIV-1) Drug Resistance Testing Dawit Assefa 2, Woldaregay E.Abegaz 3, Teferi Gedif 2, Belete Tegbaru 1, Dereje Teshome 1, Tesfaye
More informationNGS ONCOPANELS: FDA S PERSPECTIVE
NGS ONCOPANELS: FDA S PERSPECTIVE CBA Workshop: Biomarker and Application in Drug Development August 11, 2018 Rockville, MD You Li, Ph.D. Division of Molecular Genetics and Pathology Food and Drug Administration
More informationNorgen s HIV Proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad T1000 Cycler
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product# 33840 Product Insert Intended
More informationAZOOSPERMIA Chromosome Y
AZOOSPERMIA Chromosome Y M i c r o d e l e t i o n Ref.: PI EDP003024-40 testspi EDP002024 1. INTRODUCTION In 1976, Tiepolo and Zuffardi reported de novo, microscopically detectable deletions of the distal
More informationSequencing of 58 STRs using the Illumina ForenSeq TM workflow and analysis of the data with the STRinNGS v.1.0 software
Sequencing of 58 STRs using the Illumina ForenSeq TM workflow and analysis of the data with the STRinNGS v.1.0 software C. Hussing, C. Huber, R. Bytyci, H.S. Mogensen, C. Børsting, and N. Morling Section
More informationEXAMPLE. - Potentially responsive to PI3K/mTOR and MEK combination therapy or mtor/mek and PKC combination therapy. ratio (%)
Dr Kate Goodhealth Goodhealth Medical Clinic 123 Address Road SUBURBTOWN NSW 2000 Melanie Citizen Referring Doctor Your ref Address Dr John Medico 123 Main Street, SUBURBTOWN NSW 2000 Phone 02 9999 9999
More informationMRC-Holland MLPA. Description version 14; 28 September 2016
SALSA MLPA probemix P279-B3 CACNA1A Lot B3-0816. As compared to version B2 (lot B2-1012), one reference probe has been replaced and the length of several probes has been adjusted. Voltage-dependent calcium
More informationProducts for cfdna and mirna isolation. Subhead Circulating Cover nucleic acids from plasma
MACHEREY-NAGEL Products for cfdna and mirna isolation Bioanalysis Subhead Circulating Cover nucleic acids from plasma n Flexible solutions for small and large blood plasma volumes n Highly efficient recovery
More information