MOLECULAR AND CLINICAL ONCOLOGY 3: 435-441, 2015 Clinicl significnce of zinc finger E box binding homeobox 1 mrna levels in peritonel wshing for gstric cncer NORIMITSU YABUSAKI, SUGURU YAMADA, TOSHIFUMI MURAI, MITSURO KANDA, DAISUKE KOBAYASHI, CHIE TANAKA, TSUTOMU FUJII, GORO NAKAYAMA, HIROYUKI SUGIMOTO, MASAHIKO KOIKE, SHUJI NOMOTO, MICHITAKA FUJIWARA nd YASUHIRO KODERA Deprtment of Gstroenterologicl Surgery (Surgery II), Ngoy University Grdute School of Medicine, Ngoy, Aichi 466-8550, Jpn Received September 22, 2014; Accepted November 10, 2014 DOI: 10.3892/mco.2014.462 Abstrct. Zinc finger E box binding homeobox 1 (ZEB1) is n importnt regultor of epithelil to mesenchyml trnsition nd is ssocited with vrious types of metstsis. Gstric cncer ptients often develop peritonel crcinomtosis, of which the detection of free cncer cells in the peritonel wshes is n importnt predictor. We nlyzed the correltion of ZEB1 mrna levels in the peritonel wshing (pzeb1) with clinicopthologicl vribles nd survivl in 107 gstric cncer ptients who underwent surgery nd peritonel wshing cytology. Reverse trnscription polymerse chin rection ws performed to quntify pzeb1. The ptients were clssified into the pzeb1 High (n=27) nd the pzeb1 Low (n=80) groups bsed on their pzeb1 expression. pzeb1 ws sttisticlly correlted with pthologicl T stge (P=0.03) nd vsculr involvement (P=0.03). At 5 yers, the disese specific survivl ws 36.4% for the pzeb1 High group nd 64.7% for the pzeb1 Low group (P=0.02), wheres the disese free survivl rte ws 46.9% for the pzeb1 High group nd 83.0% for the pzeb1 Low group (P=0.03). When subclssified into 4 ctegories bsed on wshing cytology nd pzeb1, survivl ws significntly lower in the pzeb1 High compred to the pzeb1 Low group (cytology negtive group, P=0.01; cytology positive group, P=0.13). Therefore, pzeb1 my dd vluble informtion to conventionl peritonel wshing cytology s prognostic determinnt in gstric cncer. Correspondence to: Dr Suguru Ymd, Deprtment of Gstroenterologicl Surgery (Surgery II), Ngoy University Grdute School of Medicine, 65 Tsurumi cho, Show ku, Ngoy, Aichi 466 8550, Jpn E mil: suguru@med.ngoy u.c.jp Key words: zinc finger E box binding homeobox 1, peritonel wshing, epithelil to mesenchyml trnsition, gstric cncer Introduction Although the survivl of ptients with gstric cncer hs improved due to the recent dvnces in tretment, the prognosis of loclly dvnced or metsttic cncer remins poor (1 3). A proportion of the ptients develop recurrences even fter curtive resection, possibly reflecting the presence of residul cncer cells nd micrometstses tht hd not been detected by the currently vilble dignostic technology (4,5). Therefore, the ccurte evlution of microscopic residul disese my led to more pproprite therpeutic strtegies nd improvement in survivl. Epithelil to mesenchyml trnsition (EMT) is criticl process during which the dhesion nd migrtion properties of cncer cells chnge drmticlly (6,7). During EMT, the cells lose epithelil polrity nd cquire spindle shped, highly motile fibroblstoid phenotype. Vrious trnscription fctors re known to trigger EMT (8 10), including zinc finger E box binding homeobox 1 (ZEB1), centrl EMT meditor (11,12). ZEB1 reportedly ffects cncer progression by regulting EMT in gstric, brest, prostte, ovrin nd colorectl cncers (13 20). In gstric cncer, crcinoembryonic ntigen (CEA) mrna levels in peritonel wshing hve been reported to be potentil predictors of peritonel recurrence (21,22). Koder et l reported tht the combintion of CEA nd cytokertin 20 in peritonel wshes my more ccurtely predict prognosis (23). ZEB1 expression hs lso been recently reported s novel biomrker in cncer tissue tht my independently predict overll survivl (13,14,24). We recently reported on significnt correltion between ZEB1 expression nd diffuse phenotype in gstric cncer (24). Okugw et l reported tht ZEB1 ws n independent predictor of peritonel dissemintion in gstric cncer ptients nd ws expressed in disseminted cncer cells in the peritoneum in the sme pttern s tht seen in the primry lesions (13). Therefore, we hypothesized tht the ZEB1 mrna levels in peritonel wshing (pzeb1) in conjunction with peritonel wshing cytology my predict intrperitonel recurrence nd prognosis. This study investigted the ssocition of pzeb1 with clinicopthologicl prmeters nd prognosis nd the potentil of pzeb1 s predictive mrker. To the best of our knowledge,
436 YABUSAKI et l: ZEB1 IN PERITONEAL WASHING FOR GASTRIC CANCER this is the first report on the clinicl impliction of pzeb1 in gstric cncer. Mterils nd methods Ptients. We enrolled 107 consecutive gstric cncer ptients who underwent surgicl procedures tht included collection of peritonel wshing smples t the left subphrenic re t the beginning of surgery, between Jnury, 2005 nd August, 2010 t the Deprtment of Gstroenterologicl Surgery, Ngoy University Hospitl, Ngoy, Aichi, Jpn. All the ptients hd histologiclly confirmed gstric cncer. Of the 107 ptients, 4 hd received chemotherpy prior to surgery, 2 of whom chieved complete response. All the ptients hd been stged ccording to the Union for Interntionl Cncer Control stging criteri for gstric cncer (7th edition, 2009) s follows: 2 ptients hd stge 0; 12 hd stge IA; 11 hd stge IB; 7 hd stge IIA; 12 hd stge IIB; 8 hd stge IIIA; 10 hd stge IIIB; 10 hd stge IIIB; 10 hd stge IIIC; nd 35 hd stge IV disese. Overll, 72 ptients underwent curtive resection, 35 ptients underwent non curtive resection, of whom 2 ptients did not receive gstrectomy due to disseminted cncer. All the ptients underwent gstrectomy with D2 lymphdenectomy when potentilly curtive R0 resection ws plnned. The medin follow up period ws 41.9 months (rnge, 1 106 months). This study ws pproved by the Ethics Committee of our hospitl nd signed informed consent ws obtined from ll the prticipting ptients. Peritonel wshes. At the beginning of ech surgery, 100 200 ml sline ws introduced into the left subphrenic re nd spirted soon fter gentle stirring. Hlf of ech fluid smple ws sent for routine cytopthology with conventionl Ppnicolou nd Giems stining, wheres the other hlf ws used to mesure ZEB1 mrna levels. The smple ws centrifuged t 540 x g for 5 min to collect intct cells, rinsed with phosphte buffered sline, dissolved in ISOGEN LS RNA extrction buffer (Nippon Gene, Tokyo, Jpn) nd stored immeditely in liquid nitrogen t -80 C until nlysis. Reverse trnscription quntittive polymerse chin rection (RT qpcr). Totl RNA ws isolted from ech of the frozen smples with the RNesy mini kit (Qigen, Hilden, Germny) ccording to mnufcturer's instructions. cdna ws synthesized using the QuntiTect Reverse Trnscription kit (Qigen, Hilden, Germny) nd mplified by PCR primers s follows: ZEB1: 5' TGCACTGAGTGTGGAAAAGC 3' (forwrd) nd 5' TGGTGATGCTGAAAGAGACG 3' (reverse), which mplify 237 bp product. RNA expression ws determined using the rel time quntittive PCR method. To quntify nd demonstrte the integrity of the isolted RNA, glycerldehyde 3 phophte dehydrogense ws lso nlyzed with RT qpcr using the primer set 5' AACGGCTCCGGCATGTGCAA 3' (forwrd) nd 5' GGCTCCTGTGCAGAGAAAGC 3' (reverse). All the PCR rections were performed s follows: 1 cycle t 50 C for 2 min, 1 cycle t 95 C for 10 min, followed by 40 cycles t 95 C for 15 sec nd t 60 C for 60 sec. Rel time detection of the emission intensity of SYBR Green ws performed with n ABI prism 7000 Sequence Detector (Perkin Elmer Tble I. Ptient chrcteristics. Chrcteristics Applied Biosystems, Foster City, Cliforni, USA). qpcr ws performed t lest 3 times, including negtive no templte control. Sttisticl nlysis. Correltions between pzeb1 expression nd clinicopthologicl vribles were nlyzed by the χ 2 nd Fisher's exct tests. Disese specific survivl (DSS) nd disese free survivl (DFS) were clculted using the Kpln Meier method nd differences in survivl curves were nlyzed using the log rnk test. The Cox proportionl hzrds model ws used for multivrite nlysis, fter relevnt prognostic vribles hd been defined by univrite nlysis. Dt were nlyzed using JMP v10 softwre (JMP, SAS Institute, Cry, North Crolin, USA). P<0.05 ws considered to indicte sttisticlly significnt differences. Results Ptient no. Age, yers (men ± SD) 63±13.5 Gender Mle 83 Femle 24 Opertive method TGX 45 DGX 57 PGX 3 Gstrojejunostomy 1 Explortory lprotomy 1 UICC stge 0 2 IA 12 IB 11 IIA 7 IIB 12 IIIA 8 IIIB 10 IIIC 10 IV 35 SD, stndrd devition; DGX, distl gstrectomy; PGX, proximl gstrectomy; TGX, totl gstrectomy; UICC, Union for Interntionl Cncer Control. Ptient demogrphics. The 107 subjects in this study included 83 men nd 24 women, with medin ge of 63 yers (rnge, 20 84 yers) (Tble I). Of the 107 ptients, 45 underwent totl gstrectomy, 57 distl gstrectomy, 3 proximl gstrectomy, 1 gstrojejunostomy nd 1 explortory lprotomy. Correltion between pzeb1 nd clinicopthologicl fctors. pzeb1 ws techniclly detectble in ll 107 ptients by qpcr.
MOLECULAR AND CLINICAL ONCOLOGY 3: 435-441, 2015 437 Tble II. Correltion between clinicopthologicl vribles nd pzeb1 expression in ptients with gstric cncer. pzeb1 Low pzeb1 High P-vlue Vribles (n=80) (n=27) Gender 0.30 Mle 64 19 Femle 16 8 Age, yers 0.61 65 46 14 <65 34 13 Tumor size, cm 0.78 5 39 13 <5 41 12 Histologicl type 0.38 Diffuse 52 20 Intestinl 28 7 Pthologicl T stge pt1/2 30 4 pt3/4 50 23 Vsculr involvement Present 37 18 Absent 42 7 Lymphtic vessel involvement 0.20 Present 64 23 Absent 15 2 Lymph node metstsis 0.45 Present 52 19 Absent 28 7 Liver metstsis 0.16 Present 7 5 Absent 73 22 Peritonel dissemintion 0.22 Present 10 6 Absent 70 21 Peritonel wshing cytology 0.46 Present 18 8 Absent 62 19 TNM stge 0.16 I/II 36 8 III/IV 44 19 Sttisticlly significnt. pzeb1, zinc finger E box binding homeobox 1 mrna levels in peritonel wshing. 0.03 0.03 The vlues rnged from 3.0x10-6 to 7.0x10-3 µg/µl (medin, 1.2x10 - µg/µl). The pzeb1 cut off point ws set t the top qurtile, which ws 3.5x10-4 µg/µl. Accordingly, ptients with low pzeb1 expression (<3.5x10-4 µg/µl) were ssigned to the pzeb1 Low group (n=80), wheres those with high expression ( 3.5x10-4 µg/µl) were ssigned to the pzeb1 High group (n=27). The nlysis of pzeb1 expression nd vrious clinicopthologicl fctors (Tble II) reveled tht pzeb1 ws correlted with pthologicl T stge (P=0.03) nd vsculr involvement (P=0.03), but not with gender, ge, tumor size, histologicl type, lymphtic vessel involvement, lymph node metstsis, liver metstsis, peritonel dissemintion, peritonel wshing cytology, or TNM stge. Ptient survivl by pzeb1 expression. The survivl curves of ptients with gstric cncer by pzeb1 expression re presented in Fig. 1. DSS ws significntly lower in ptients with pzeb1 High expression compred to those with pzeb1 Low expression. The
438 YABUSAKI et l: ZEB1 IN PERITONEAL WASHING FOR GASTRIC CANCER Figure 1. Survivl curves for gstric cncer ptients by pzeb1 expression sttus. (A) Disese specific survivl; (B) disese free survivl. The ptients with pzeb1 High expression exhibited significntly poorer prognosis compred to those with pzeb1 Low expression (A) P=0.02, (B) P=0.03, log rnk test. pzeb1, zinc finger E box binding homeobox 1 mrna levels in peritonel wshing. Figure 2. Survivl curves for gstric cncer ptients bsed on wshing cytology nd pzeb1 expression. The ptients were subclssified into 4 types bsed on wshing cytology nd pzeb1 expression. Disese specific survivl ws significntly lower in ptients with pzeb1 High expression compred to those with pzeb1 Low expression. (CY0 group, P=0.01; CY1 group, P=0.13). pzeb1, zinc finger E box binding homeobox 1 mrna levels in peritonel wshing; CY0, negtive cytology; CY1, positive cytology; NA, not pplicble. 5 yer DSS ws 36.4% in the pzeb1 High group nd 64.7% in the pzeb1 Low group (P=0.02), wheres the 5 yer DFS ws 46.9%, in the pzeb1 High group nd 83.0% in the pzeb1 Low group (P=0.03). The ptients were next subclssified into 4 groups ccording to negtive or positive peritonel wshing cytology (CY0 nd CY1, respectively) s follows: CY0 pzeb1 Low, CY0 pzeb1 High, CY1/pZEB1 Low nd CY1 pzeb1 High. In the CY0 group, DSS ws significntly lower in the pzeb1 High group compred to tht in the pzeb1 Low group. The 5 yer survivl rte ws 48.7% in the CY0 pzeb1 High group nd 82.0% in the CY0 pzeb1 Low group (P=0.01). In the CY1 group, DSS ws lso lower mong ptients with pzeb1 High expression compred to those with pzeb1 Low expression. The 5 yer survivl rte ws 0% in the CY1 pzeb1 High group nd 9.3% in the CY1 pzeb1 Low group (P=0.13) (Fig. 2). pzeb1 s predictor of recurrence fter surgery. Among the 18 ptients who developed recurrences fter surgery, 10 ptients hd pzeb1 Low expression nd 8 hd pzeb1 High expression. The recurrence rte in the pzeb1 High group (8/27) ws significntly higher compred to tht in the pzeb1 Low group (10/80; P=0.03,
MOLECULAR AND CLINICAL ONCOLOGY 3: 435-441, 2015 439 Tble III. Correltion of pzeb1 expression sttus with recurrence of gstric cncer nd recurrence site. A, Correltion of pzeb1 expression with recurrence pzeb1 Low pzeb1 High Recurrence (n=54) (n=18) P-vlue Yes 10 8 0.03 No 44 10 B, Correltion of pzeb1 expression with recurrence site Recurrence site No. pzeb1 Low/High Lymph nodes 6 4/2 Peritoneum 6 2/4 Liver 5 3/2 Lung 1 1/0 Sttisticlly significnt. pzeb1, zinc finger E box binding homeobox 1 mrna levels in peritonel wshing. Tble IV. Chrcteristics of ptients with pzeb1 High expression excluding those with stge IV disese. Ptients Age (yrs) Gender DFS Recurrence site T stge Metstsis Histology 1 62 F 48 Peritoneum T4 N3 Diffuse 2 60 F 28 Peritoneum T4 N1 Diffuse 3 55 M 3.2 Peritoneum T4 N0 Diffuse 4 55 M 19 Peritoneum T2 N0 Diffuse 5 63 M 15 Liver T3 N3b Intestinl 6 61 M 6 Liver T3 N2 Intestinl 7 71 M 16 Lymph node T3 N2 Diffuse 8 75 F 19 Lymph node T4 N3 Diffuse 9 56 M 70 None T3 N1 Diffuse 10 70 M 9.5 None T3 N0 Intestinl 11 71 F 69 None T2 N0 Diffuse 12 67 M 27 None T1 N0 Intestinl 13 52 M 31 None T3 N0 Diffuse 14 72 M 45 None T4 N1 Diffuse 15 74 M 35 None T1b N0 Intestinl 16 65 M 58 None T4 N1 Intestinl 17 35 F 50 None T4 N2 Diffuse 18 59 M 43 None T2 N0 Diffuse Metsttic lymph nodes. pzeb1, zinc finger E box binding homeobox 1 mrna levels in peritonel wshing; DFS, disese free survivl (in months). Tble IIIA). Of these 18 ptients 6 developed lymph node metstses, 6 peritonel metstses, 5 liver metstses nd 1 lung metstsis. Of the 6 ptients with recurrent peritonel metstses, 4 were in the pzeb1 High group (Tble IIIB). The chrcteristics of the 18 ptients with pzeb1 High nd CY0, excluding those with stge IV disese, re summrized in Tble IV. Among these, 8 ptients ultimtely developed recurrent metstses (4 in the peritoneum, 2 in the liver nd 2 in the lymph nodes). Prognostic fctors of gstric cncer ptients by univrite nd multivrite nlysis. The univrite nlysis using the Cox proportionl hzrds model identified 9 prognostic fctors, nmely tumor size, T stge, histologicl type, lymph node metstsis, lymphtic vessel involvement, vsculr involvement, peritonel metstsis, liver metstsis nd pzeb1 expression (Tble V). However, in the multivrite nlysis of these prmeters, pzeb1 ws not identified s n independent predictor of DSS.
440 YABUSAKI et l: ZEB1 IN PERITONEAL WASHING FOR GASTRIC CANCER Tble V. Univrite nd multivrite nlysis of clinicopthologicl fctors for disese specific survivl. Univrite nlysis Multivrite nlysis ---------------------------------------------------------------------------- --------------------------------------------------------------------------- Vribles HR 95% CI P-vlue HR 95% CI P-vlue Gender (femle) 1.3 0.6 2.5 0.52 Age ( 65 yers) 1.0 0.6 2.0 0.89 Tumor size ( 5 cm) 2.3 1.2 4.6 0.01 1.1 0.5 2.5 0.76 Pthologicl T stge (pt3/4) 8.4 3.0 34.9 <0.001 4.4 1.1 24.8 0.04 Histologicl type (diffuse) 2.3 1.1 5.4 0.02 1.3 0.5 3.5 0.57 Lymph node metstsis 4.2 1.8 12.4 <0.001 2.2 0.7 10.1 0.22 Lymphtic vessel involvement 4.7 1.4 28.9 0.008 0.4 0.05 3.8 0.40 Vsculr involvement 3.9 1.9 8.7 <0.001 2.0 0.8 5.3 0.13 Peritonel metstsis 10.6 5.2 21.2 <0.001 4.1 1.8 9.4 0.001 Liver metstsis 5.2 2.2 11.1 <0.001 2.9 0.9 7.9 0.06 pzeb1 High 2.1 1.1 4.0 0.03 1.0 0.4 2.1 0.98 Sttisticlly significnt. HR, hzrd rtio; CI, confidence intervl; pzeb1, zinc finger E box binding homeobox 1 mrna levels in peritonel wshing. Discussion EMT is process through which epithelil cells ttin fibroblstic chrcteristics, which enble them to invde neighboring tissues (25,26). ETM is regulted by severl trnscription fctors, including Snil, Slug, Twist, CrB box binding fctor, mesenchyme forkhed 1, Krüppel like fctor nd ZEB1 (26 29). ZEB1 is reportedly key plyer in cncer progression (17,30 32). In prticulr, high expression of ZEB1 in endometril nd colorectl cncers nd heptocellulr crcinom hs been ssocited with poor prognosis (15,33,34). In gstric cncer, ZEB1 expression in cncer tissues hs been identified s n independent prognostic fctor (13,14). We hve lso reported correltion between high ZEB1 expression nd diffuse pthologicl cncer type (24). However, the diffuse type is known risk fctor for peritonel recurrence in gstric cncer, which supports the findings of Okugw et l (13), who reported tht high ZEB1 expression is n independent fctor for peritonel crcinomtosis. Comprisons of the expression of EMT mrkers in the primry tumor nd corresponding lymph node metstses hve been performed for severl cncer types (35,36,37). These studies demonstrted tht the expression of EMT mrkers in mture metsttic lymph nodes ws lower compred to tht in the primry lesions; therefore it ws hypothesized tht mesenchyml to epithelil trnsition (MET), the reverse phenomenon of EMT, my occur t secondry metsttic sites before the metstsized cells develop into cliniclly significnt metsttic lesions. However, Okugw et l (13) observed through immunostining tht ZEB1 expression in the peritonel metsttic sites exhibited the sme pttern s tht observed in the primry lesions. The role of EMT nd MET in the development of peritonel metstsis my be different from tht of nodl metstsis nd it my be of vlue to investigte the EMT sttus of intrperitonel cncer cells tht likely develop into visible peritonel deposits. To the best of our knowledge, there re no vilble studies investigting pzeb1 in gstric cncer ptients. The mjor finding in this study ws tht pzeb1 expression ws significntly ssocited with DSS nd DFS in ptients with gstric cncer. Furthermore, pzeb1 my be more sensitive dignostic tool for poor prognosis compred to conventionl peritonel wshing cytology, s the RT qpcr more sensitively detects intrperitonel free cncer cells nd lso becuse positive pzeb1 reflects the cpbility of the primry tumor to disseminte ZEB1 positive mesenchymlly trnsformed cells into the peritonel cvity s well s through the hemtogeneous nd lymphtic metsttic pthwys. Although ZEB1 expression in the primry lesion is lredy known s n independent prognostic fctor (13,14,24), pzeb1 expression my lso represent novel mrker of poorer prognosis. However, our results filed to demonstrte sttisticl correltions between pzeb1 nd peritonel dissemintion nd peritonel recurrence. As stted bove, lthough locl ZEB1 production by cncer cells in the peritonel cvity is the most importnt fctor in pzeb1 expression, the primry pzeb1 high tumor my disseminte metsttic nd ZEB1 producing crcinom cells to ny other sites in the body, leding to vrious other types of metstsis nd consequent cncer relted deth. Thus, pzeb1 my be correlted with poor prognosis, but not necessrily with peritonel dissemintion. There is lso possibility tht proportion of the ptients did ctully hrbor peritonel recurrence, but its mnifesttion ws preceded by other types of metstsis tht were cliniclly more relevnt. Further investigtion is required to elucidte the mechnisms underlying pzeb1 expression in lrge popultion with long term follow up. In conclusion, pzeb1 my be predictive mrker for poor prognosis or tumor ggressiveness in gstric cncer, similr to ZEB1 expression in primry lesions. pzeb1 my dd vluble informtion to conventionl peritonel wshing cytology nd, thus, help with the selection of cndidtes for more ggressive chemotherpies.
MOLECULAR AND CLINICAL ONCOLOGY 3: 435-441, 2015 441 References 1. Mcdonld JS, Smlley SR, Benedetti J, et l: Chemordiotherpy fter surgery compred with surgery lone for denocrcinom of the stomch or gstroesophgel junction. N Engl Med 345: 725 730, 2001. 2. Cunninghm D, Allum WH, Stenning SP, et l: Periopertive chemotherpy versus surgery lone for resectble gstroesophgel cncer. N Engl Med 355: 11 20, 2006. 3. Skurmoto S, Ssko M, Ymguchi T, et l: Adjuvnt chemotherpy for gstric cncer with S 1, n orl fluoropyrimidine. N Engl Med 357: 1810 1820, 2007. 4. Allum W, Groflo A, Degiuli M nd Schuhmcher C: The first Europen Union Network of Excellence for Gstric Cncer conference, Rome, Itly, April 2008. Gstric Cncer 12: 56 65, 2009. 5. Yonemur Y, Elnemr A, Endou Y, et l: Multidisciplinry therpy for tretment of ptients with peritonel crcinomtosis from gstric cncer. World J Gstrointest Oncol 2: 85 97, 2010. 6. Thiery JP: Epithelil mesenchyml trnsitions in tumour progression. Nt Rev Cncer 2: 442 454, 2002. 7. Gotzmnn J, Mikul M, Eger A, et l: Moleculr spects of epithelil cell plsticity: implictions for locl tumor invsion nd metstsis. Mutt Res 566: 9 20, 2004. 8. Cvllro U nd Christofori G: Cell dhesion nd signlling by cdherins nd Ig CAMs in cncer. Nture Rev Cncer 4: 118 132, 2004. 9. Tomit K, vn Bokhoven A, vn Leenders GJ, et l: Cdherin switching in humn prostte cncer progression. Cncer Res 60: 3650 3654, 2000. 10. Rieger Christ KM, Cin JW, Brsch JW, et l: Expression of clssic cdherins type I in urothelil neoplstic progression. Hum Pthol 32: 18 23, 2001. 11. Christinsen JJ nd Rjsekrn AK: Ressessing epithelil to mesenchyml trnsition s prerequisite for crcinom invsion nd metstsis. Cncer Res 66: 8319 8326, 2006. 12. Klymkowsky MW nd Svgner P: Epithelil mesenchyml trnsition: cncer resercher's conceptul friend nd foe. Am J Pthol 174: 1588 1593, 2009. 13. Okugw Y, Toiym Y, Tnk K, et l: Clinicl significnce of zinc finger E box binding homeobox 1 (ZEB1) in humn gstric cncer. J Surg Oncol 106: 280 285, 2012. 14. Ji B, Liu H, Kong Q, et l: Overexpression of ZEB1 ssocited with metstsis nd invsion in ptients with gstric crcinom. Mol Cell Biochem 366: 223 229, 2012. 15. Zhng GJ, Zhou T, Tin HP, et l: High expression of ZEB1 correltes with liver metstsis nd poor prognosis in colorectl cncer. Oncol Lett 5: 564 568, 2013. 16. Spdern S, Schmlhofer O, Hlubek F, et l: A trnsient, EMT linked loss of bsement membrnes indictes metstsis nd poor survivl in colorectl cncer. Gstroenterology 131: 830 840, 2006. 17. Eger A, Aigner K, Sonderegger S, et l: DeltEF1 is trnscriptionl repressor of E cdherin nd regultes epithelil plsticity in brest cncer cells. Oncogene 24: 2375 2385, 2005. 18. Ohir T, Gemmill RM, Ferguson K, et l: WNT7 induces E cdherin in lung cncer cells. Proc Ntl Acd Sci USA 100: 10429 10434, 2003. 19. Chu HL, Bht Nkshtri P, Clre SE, et l: NF kppb represses E cdherin expression nd enhnces epithelil to mesenchyml trnsition of mmmry epithelil cells: potentil involvement of ZEB 1 nd ZEB 2. Oncogene 26: 711 724, 2007. 20. Grhm TR, Zhu HE, Odero Mrh VA, et l: Insulin like growth fctor I dependent up regultion of ZEB1 drives epithelil to mesenchyml trnsition in humn prostte cncer cells. Cncer Res 68: 2479 2488, 2008. 21. Abe N, Wtnbe T, Tod H, et l: Prognostic significnce of crcinoembryonic ntigen levels in peritonel wshes in ptients with gstric cncer. Am J Surg 181: 356 361, 2001. 22. Ito S, Nknishi H, Koder Y, et l: Prospective vlidtion of quntittive CEA mrna detection in peritonel wshes in gstric crcinom ptients. Br J Cncer 93: 986 992, 2005. 23. Koder Y, Nknishi H, Ito S, et l: Prognostic significnce of intrperitonel cncer cells in gstric crcinom: detection of cytokertin 20 mrna in peritonel wshes, in ddition to detection of crcinoembryonic ntigen. Gstric Cncer 8: 142 148, 2005. 24. Muri T, Ymd S, Fuchs BC, et l: Epithelil to mesenchyml trnsition predicts prognosis in clinicl gstric cncer. J Surg Oncol 109: 684 689, 2014. 25. Schmlhofer O, Brbletz S nd Brbletz T: E cdherin, bet ctenin nd ZEB1 in mlignnt progression of cncer. Cncer Metstsis Rev 28: 151 166, 2009. 26. De Wever O, Puwels P, De Crene B, et l: Moleculr nd pthologicl signtures of epithelil mesenchyml trnsitions t the cncer invsion front. Histochem Cell Biol 130: 481 494, 2008. 27. Wldmnn J, Feldmnn G, Slter EP, et l: Expression of the zinc finger trnscription fctor Snil in drenocorticl crcinom is ssocited with decresed survivl. Br J Cncer 99: 1900 1907, 2008. 28. Iwtsuki M, Mimori K, Yokobori T, et l: Epithelil mesenchyml trnsition in cncer development nd its clinicl significnce. Cncer Sci 101: 293 299, 2010. 29. Rosivtz E, Becker I, Specht K, et l: Differentil expression of the epithelil mesenchyml trnsition regultors Snil, SIP1 nd Twist in gstric cncer. Am J Pthol 161: 1881 1891, 2002. 30. Spdern S, Schmlhofer O, Whlbuhl M, et l: The trnscriptionl repressor ZEB1 promotes metstsis nd loss of cell polrity in cncer. Cncer Res 68: 537 544, 2008. 31. Drke JM, Strohbehn G, Bir TB, et l: ZEB1 enhnces trnsendothelil migrtion nd represses the epithelil phenotype of prostte cncer cells. Mol Biol Cell 20: 2207 2217, 2009. 32. Tkeym Y, Sto M, Horio M, et l: Knockdown of ZEB1, mster epithelil to mesenchyml trnsition (EMT) gene, suppresses nchorge independent cell growth of lung cncer cells. Cncer Lett 296: 216 224, 2010. 33. Singh M, Spoelstr NS, Jen A, et l: ZEB1 expression in type I vs type II endometril cncers: mrker of ggressive disese. Mod Pthol 21: 912 923, 2008. 34. Zhou YM, Co L, Li B, et l: Clinicopthologicl significnce of ZEB1 protein in ptients with heptocellulr crcinom. Ann Surg Oncol 19: 1700 1706, 2012. 35. Kurhr H, Tko S, Memur K, et l: Epithelil mesenchyml trnsition nd mesenchyml epithelil trnsition vi regultion of ZEB 1 nd ZEB 2 expression in pncretic cncer. J Surg Oncol 105: 655 661, 2012. 36. Toll A, Msferrer E, Hernández Ruiz ME, et l: Epithelil to mesenchyml trnsition mrkers re ssocited with n incresed metsttic risk in primry cutneous squmous cell crcinoms but re ttenuted in lymph node metstses. J Dermtol Sci 72: 93 102, 2013. 37. Aokge K, Ishii G, Ohtki Y, et l: Dynmic moleculr chnges ssocited with epithelil mesenchyml trnsition nd subsequent mesenchyml epithelil trnsition in the erly phse of metsttic tumor formtion. Int J Cncer 128: 1585 1595, 2011.