Genes, Aging and Skin Helen Knaggs Vice President, Nu Skin Global R&D
Presentation Overview Skin aging Genes and genomics How do genes influence skin appearance?
Can the use of Genomic Technology enable Superior Product Development?
What Do We Know About Causes of Aging? Extrinsic and Intrinsic Smoking Sun Pollution Lifestyle Stress Hormones Genes Ethnicity Biological clock
Its not just about skin aging
Genes and Genomics
What Are Genes? Genes are units of heredity carrying genetic information such as the sequence of amino acids for a protein Inherited from parents Located on chromosomes
Cell Nucleus Genetic Material: DNA (stored on chromosomes)
DNA, GENES 1953: Structure 2003: Sequence 1953: James Watson and Francis Crick present the structure of DNA 2003: The Human Genome map is completed
In 2003, all the gene sequences were published = Human Genome 20,000 25,000 genes form the human genome
Genes in Common With Other Organisms Genes are shared with other species Gene may not have exact same code, but function is similar Traces of ancient genes
Percent in Common with Humans 98% 90% 21% Species
In 2003, all the gene sequences were published = Human Genome tgactgccaatttgccaataccaattattgggggaatatgcccaatatatgcc cgagaccagtattatgactgccaatttgccaataccaattttggcgactgga atatgcccaatatatgcccgagaccagtattatgactgccaatttgccaata ccaattttggacgaatatgcccaatatatgcccgagaccagtattatgactg ccaatttgccaataccaattttgggtgaatatgcccaatatatgcccgagac cagtattatgactgccaatttgccaataccaattattgggggaatatgcccaa tatatgcccgagaccagtattatgactgccaatttgccaataccaattttggc gactggaatatgcccaatatatgcccgagaccagtattatgactgccaattt gccaataccaattttggacgaattatatgcccgagaccagtattatgactgc caatttgccaataccaattttggacgaatatgcccaatatatgcccgagacc agtattatgactgccaatttgccaataccaattttgggtgaatatgcccaatat atgcccgagaccagtattatgactgccaatttgccaataccaattattgggg gaatatgcccaatatatgcccgagaccagtattatgactgccaatttgccaa taccaattttggcgactggaatatgcccaatatatgcccgagaccagtattat gactgccaatttgccaataccaattttggacgaatatgcccaatatatgccc gagaccagtattatgactgccaatttgccaataccaattttgggtgaatatgc ccaatatatgcccgagaccagtattatgactgccaatttgccaataccaatt attgggggaatatgcccaatatatgcccgagaccagtattatgactgccaat ttgccaataccaattttggcgactggaatatgcccaatatatgcccgagacc agtattatgactgccaatttgccaataccaattttggacgaatatgcccaatat atgcccgagaccagtattatgactgccaatttgccaataccaattttgggtga atatgcccaatatatgcccgagaccagtattatgactgccaatttgccaata ccaattattgggggaatatgcccaatatatgcccgagaccagtattatgact gccaatttgccaataccaattttggcgac.. 3 billion base pairs.
How do genes influence skin appearance?
How does this information influence cell structure, function, phenotype? Gene sequence varies Polymorphisms (SNPs) Mutations Either inherited or acquired Can lead to profound consequences
Eg. 1
Eg. 2: In skin, SNPS in filaggrin have been an area of great interest Genetic predisposition Dry skin Eczema or psoriasis Polymorphisms vary between different ethnic groups
Eg. 3: In skin, SNPS and aging (Verkotter et al, 2010, JID 130, s60) 400 females 70-80y Identified SNPs in genes significantly associated with an aged phenotype (wrinkles and age spots) Eg. Wrinkles: SNPs in MMP-1could be protective ie. less wrinkles Eg. Age spots: SNPs in melanin synthesis (MC1R, TYR, TYRP-1, TPCN-2) predisposed to more age spots Eg. SNP in DNA repair enzyme XPD was protective against UV-induced spot formation Genetic polymorphisms and genetic susceptibilities are relevant in predisposing to extrinsic aging Question remains how do we use this for product development?
How does this information influence cell structure, function, phenotype? Gene sequence Published in 2003 Variations result in phenotype difference Less tractable Gene expression
Gene Expression: The Central Dogma of Molecular Biology DNA information copied into mrna Proteins synthesized using the information in mrna
Genes are expressed differently
In skin, gene expression patterns have been investigated relative to aging Development of enabling technologies Elucidate differences in young and old skin Investigate effect of actives on gene expression
Development of Enabling Technologies Latest genetic tools: DNA microarray or gene chip, RT-PCR, bioinformatics etc Gene expression information for the entire human genome obtainable
Methodology Accessible: Changes in Gene Expression Can be Evaluated RNA 1. Elucidate differences in young and old skin 2. Investigate effect of actives on gene expression
Challenge for Product Development Distilling data to something usable for product development
Genes Expression Influenced by Topical Application of Product UV Protection Pigmentation 7% Hydration 6% 6% Antioxidant 9% DNA Repair 6% Cellular Turnover 15% Skin Structure 21% Inflammatory Response 23% Classified by function cdna microarray data 140 gene changes reported in skin Up and Down regulated 2 fold change compared to untreated Barrier Repair 7%
1. Elucidate Differences in Skin
Age-Related Changes in Gene Expression Old Arm / Young Buttock Old Arm / Old Buttock Young Arm / Young Buttock Old Arm / Young Arm Old Butt / Young Butt
Age-Related Changes in Gene Expression Intrinsic aging & photoaging associated with down-regulation of epidermal differentiation Intrinsic aging & photoaging associated with down-regulation of wound healing Photoaging associated with up-regulation of immune responses Bennett et al., JID 2008, 13, 15-19 Log 2-fold changes in gene expression
2. Investigate Effect of Actives on Gene Expression
Examples of Products
How does this information influence cell structure, function, phenotype? Gene sequence varies Gene expression patterns vary Epigenetics
Epigenetics is a new area Genes are not the whole story Above the genome Unique control mechanisms determine cell fate heart, muscle, hair Molecular switches sirna, methylation, acetylation
Methyl groups silence gene expression
Epigenetics These mice have the exact same genes
Rice and Soy reversed negative impact of dietary BPA Proc Natl Acad Sci U S A. 2007 Aug 7;104(32):13056-61. Epub 2007 Aug 1. Maternal nutrient supplementation counteracts bisphenol A-induced DNA hypomethylation in early development. Dolinoy DC, Huang D, Jirtle RL.
Yellow shows where the twins have similar gene regulation. Red and Green indicate differences (up and down regulation).
Genes influence skin appearance by Gene sequence varies Gene expression patterns vary Epigenetic phenomenon
Presentation Overview Skin aging Genes and genomics How do genes influence skin appearance?
END