Shuguang Hospital, Shanghai University of Traditional Chinese Medicine, Shanghai , China 2

Evidence-Based Complementary and Alternative Medicine Volume 22, Article ID 9628, pages doi:.55/22/9628 Research Article Salvianolic Acid B Inhibits ERK and p38 MAK Signaling in TGF-β-Stimulated Human Hepatic Stellate Cell Line (LX-2) viadistinctathways Zhigang Lv, 2, 3 and Lieming Xu, 2, 4, 5 Shuguang Hospital, Shanghai University of Traditional Chinese Medicine, Shanghai 223, China 2 Institute of Liver Diseases, Shanghai University of Traditional Chinese Medicine, Shanghai 223, China 3 Department of Neurology, Memorial Sloan-Kettering Cancer Center, New York, NY 2, USA 4 Key Laboratory of Liver and Kidney Diseases, Shanghai University of Traditional Chinese Medicine, Ministry of Education, Shanghai 2444, China 5 E-Institute of Traditional Chinese Medicine Internal Medicine in Shanghai University, Shanghai 223, China Correspondence should be addressed to Lieming Xu, xulieming@shutcm.edu.cn Received 5 December 2; Revised 3 April 2; Accepted 22 May 2 Academic Editor: Xiu-Min Li Copyright 22 Z. Lv and L. Xu. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Salvianolic acid B (SA-B) is water-soluble component of Radix Salvia miltiorrhiza. The previous work indicated that SA-B can inhibit MAK and Smad signaling in activated hepatic stellate cells (HSCs) to perform anti-fibrotic activity Lv et al. 2. However, some studies have shown that there is cross-talk between MAK and Smad in certain cell types. Thus, the anti-fibrotic action of SA-B may be through the cross-talk. In order to clarify the mechanism of SA-B further, we knocked down Smad in LX-2 cells () via RNAi, and then added TGF-β, and D9859 or SB2358 and SA-B. The levels of p-mek and p-p38 were inhibited by SA-B in independent of TGF-β. The expression of Col I and α-sma in could be reduced by SA-B independent TGF-β. SB2358 had not significant effect on p-mek in stimulated by TGF-β. The levels of p-mek in were not increased significantly after TGF-β stimulation.d9859 hadno effect onthelevels ofp-p38inirrespective oftgf-β. In conclusion, SA-B inhibits the synthesis of Col I in LX-2 cells independent of TGF-β stimulation, and the anti-fibrotic effect of SA-B is due to direct inhibition of p38 signaling and inhibition the cross-talk of Smad to ERK signaling.. Introduction Hepatic fibrosis is a wound-healing response to chronic liver injury. It is a scarring process associated with an increased deposition of fibrillar extracellular matrix in liver []. Much progress has been made in understanding the cellular mechanisms of hepatic fibrosis. Activation of HSCs is the central event in this condition [2]. Following liver injury of any etiology, HSCs undergo a transition from quiescent vitamin A-rich cells into proliferative, fibrogenic, and contractile myofibroblasts, in which synthesis of ECM and particularly Col. I predominates [3]. Transforming growth factor β (TGF-β) is one of the most powerful and widely distributed profibrogenic mediators. It is the dominant stimulator of ECM production by HSCs, regulating deposition of the ECM as part of the normal response to tissue injury and pathological fibrosis [4, 5]. Alterations in TGF-homeostasis are important factors in fibrotic diseases of multiple tissues. The pathogenic relevance of TGF-β to hepatic fibrosis has been established and the signaling pathway induced by TGF-β in HSCs is fully understood. It is clear that MAK and Smad signaling pathways in HSCs activated by TGF-β leadtoexcessecmdeposition. However, up to now, there are not effective measures to stop or reverse the disease progression. In recent years, increasing attention has been directed to the anti-fibrotic activity of natural herbs, in particular Salviae miltiorrhiza, a traditional Chinese herbal medicine widely used for anti-fibrosis in clinics. In order to explore the mechanism of action of Salvia miltiorrhiza, Salvianolic acids B (SA-B), an effective water-soluble component of Radix Salvia miltiorrhiza, was investigated. revious research

2 Evidence-Based Complementary and Alternative Medicine indicated that SA-B could effectively reverse liver fibrosis in patients suffering from chronic hepatitis B, and it was more effective than IFN-γ in reducing serum HA, C-III, Col. IV, and LM contents and decreasing ultrasound fibrosis imaging scores [6]. SA-B inhibits TGF-β secretion in activated HSCs and inhibits the expression of Col. I stimulated by TGFβ. SA-B inhibits the Smad and MAK pathway in HSCs stimulated with TGF-β[7, 8]. It has been reported that a synergy between TGF-β activated extracellular signal-regulated kinase (ERK) and Smad signaling in collagen production by human glomerular mesangial cells, and dominant negative ERK blockade reduced TGF-β induced phosphorylation of Smad2/3. This effect was not seen in the mouse mammary epithelial NMuMG cell line, indicating that ERK-dependent activation of Smad2/3 occurs only in certain cell types [9, ]. These results indicate that ERK-dependent R-Smad (receptor-regulated Smad) linker region phosphorylation enhances collagen I synthesis and imply positive cross-talk between the ERK and Smad pathways in human mesangial cells. However, it is not clear if there is a cross-talk between MAK and Smad signaling pathways in TGF-β-stimulated HSCs. Thus, in order to clarify the targets of SA-B on anti-fibrotic action, the cross-talk would have to be inhibited. This study investigated the anti-fibrotic role of SA-B in HSCs via inhibiting the Smad and MAK signaling pathways or by inhibiting the cross-talk between them. 2. Materials and Methods 2.. Reagents. Smad4 polyclonal antibody, p-p38 monoclonal antibody, p38, p-mek and MEK monoclonal antibody were purchased from Cell Signaling Technology (Beverly, MA, USA); mouse anti-human α-sma monoclonal antibody and Trizol reagent were purchased from Sigma (St Louis, MO, USA). BLOCK-iT ol II mir RNAi expression vector was purchased from Invitrogen (Carlsbad, CA, USA). Rabbit anti-human type I collagen antibody, SB2358 (p38 signaling inhibitor) and D9859 (ERK signaling inhibitor) were purchased from Chemicon (Temecula, CA, USA). Mouse anti-gadh monoclonal antibody was purchased from Sigma (St Louis, MO, USA) and TGF-β wassuppliedby R&D Systems (Minneapolis, MN, USA). The human Type I Collagen Detection Kit was purchased from Chondrex (Redmond, WA) and SA-B (purity > 98%; molecular formula: C 36 H 3 O 6 ; molecular weight: 78.62) was kindly provided by Dr. Zhu Dayuan(Shanghai Institute of Materia Medica, Shanghai, China). SA-B powder was stored at 4 C. SA-B was dissolved before use. 2.2. RNA Silencing and Cell Transfection. RNA silencing was performed using the BLOCK-iT ol II RNAi expression vector kit following the manufacturer s protocol. Artificial Smad4 microrna (mirna) was cloned in pcdna 6.2-GW/EmGF-miR leading to cocistronic expression of Emerald GF (EmGF) with mirna of Smad4. Different sequences of Smad4 mirna were designed using an algorithm developed by Invitrogen. Sense and antisense DNA sequences were SR-Forward: TGC TGT ATG ATG GTA AGT AGC TGG CTG TTT TGG CCA CTG ACT GAC AG CCA GCT TTA CCA TCA TA and SR-Reverse: CCT GTA TGA TGG TAA AGC TGG CTG TCA GTC AGT GGC CAA AAC AGCCAGCTACTTACCATCATAC; SR2-Forward: TGC TGT GGT GAG GCA AAT TAG GTG TGG TTT TGG CCA CTG ACT GAC CAC ACC TAT TGC CTC ACC A and SR2- Reverse: CCT GTG GTG AGG CAA TAG GTG TGG TCA GTC AGT GGC CAA AAC CAC ACC TAA TTT GCC TCA CCAC;SR3-Forward: TGCTGTTTCCGACCAGCCACC TGA AGG TTT TGG CCA CTG ACT GAC CTT CAG GTC TGG TCG GAA A; SR3-Reverse: CCT GTT TCC GAC CAG ACC TGA AGG TCA GTC AGT GGC CAA AAC CTT CAG GTG GCT GGT CGG AAA C; SR4-Forward: TGC TGA TTA CTT GGT GGA TGC TGG ATG TTT TGG CCA CTG ACT GAC ATC CAG CAC ACC AAG TAA T, and SR4-Reverse: CCT GAT TAC TTG GTG TGC TGG ATG TGT CAG TCA GTG GCC AAA ACA TCC AGC ATC CAC CAA GTA ATC. LX-2 cells [], human HSCs, supplied by Scott L. Friedman, were cultured in DMEM medium supplemented with % fetal bovine serum at 37 Cin5%CO 2 and were transfected with μg of the indicated vectors. Transfected cells were selected by 5 mg/ml blasticidin. 2.3. RT-CR and Quantitative CR Analysis of Gene Expression. Total RNA was extracted from selected LX-2 cells using Trizol reagent, quantified by spectrophotometry, and reverse-transcribed to cdna using the Invitrogen Reverse Transcription System. An icycleriq Multicolor Real time CR (RT-CR) Detection System (Bio-Rad) was used for RT-CR. The cdna of LX-2 was amplified using iq-sybr Green Supermix with specific oligonucleotide primers for Smad4 and β-actin (for normalization). Gene primers were Smad4 Forward: 5 -ATT GCC GAC AGG ATG CAG A-3 ; Reverse: 5 -GAG TAC TTG CGC TCA GGA GGA-3 ; β-actin Forward: 5 -TCT CTC AAT GGT TTC TGT CCT GTG- 3 ;Reverse:5 -TCC CAT TTC CAA TCA TCC TGC TC-3. Threshold cycles (Ct) were automatically calculated by the RT-CR System. Each Ct value was normalized to the β- actin Ct value. Relative quantification was expressed as foldinduction compared to control conditions. CR amplification was performed in a 5 μl reaction mixture containing CR amplification buffer,.5 2 mm MgCl 2 (optimized for each reaction), 25 pmol of each primer,.2 mm dnts and 2.5 units of AmpliTaq DNA polymerase (erkin Elmer Applied Biosystem). The CR program was as follows: 95 C for 5 min, 35 cycles of 2 min at 94 C,.5 min at 6 C, 2.5 min at 72 C, and a final extension for seconds at 72 C. The CR products were separated on a 2% agarose gel stained with ethidium bromide and compared to a standard DNA size marker. 2.4. Treatment of LX-2 Cells and reparation of Cell Lysates. LX-2 cells transfected with expressing high levels of Smad4 RNAi, and a negative control vector, were selected by blasticidin and cultured in DMEM medium supplemented with % FSC. SA-B ( 6 ML ) (The concentration is near to clinical application dose.) was added to LX-2 cells

Evidence-Based Complementary and Alternative Medicine 3 in serum-free medium for 2 days. TGF-β(ngmL )was added to the medium during the last 2 hours of culture, or for the last 24 h when carrying out gene transfection examinations. Specific protein kinase blocker (5 μm), D9859 (blocking ERK signaling) or SB2358 (blocking p38 MAK signaling), was added to the media 3 min before the addition of TGF-β. After TGF-β stimulation, LX-2 cells were washed with BS and lysed in 5 M Tris-HCl, ph 7.5, 5 mm NaCl, % Triton X-,. mm Na 3 VO 4, mm MSF, and. mm aprotinin. Cell debris was removed by centrifugation at 5 gfor3minat4 C. rotein concentrations were determined using BioRad protein assay. 2.5. Western Blotting. Samples were subjected to % sodium dodecyl sulphate-polyacrylamide gel electrophoresis and transferred to nitrocellulose membranes. Membranes were blocked and washed in TBS-Tween buffer. They were incubated overnight with specific antibodies (Smad4, β- Actin, MEK, p38, p-p38, GADH, α-sma or Col. I). After incubation with peroxidase-conjugated secondary antibodies for h, membranes were developed with an enhanced chemiluminescence western blotting detection system. The experiment was repeated for three times. 2.6. Detection of Collagen I in Media Using ELISA. Cell culture media were centrifuged and supernatants collected for measuring total protein concentrations: 9 μl sample and μl coating buffer (.59% Na 2 CO 3, 2.93% NaHCO 3, ph 9.6) were added to wells of a 96-well plate in triplicate; Col. I standard controls were added to standard wells [ coating buffer (.59% Na 2 CO 3,.293% NaHCO 3, ph 9.6)]. The 96-well plate was incubated at 4 Candcoatedfor24h. The coating buffer was discarded and the plate washed with washing buffer three times for 2 minutes. Rabbit anti-mouse Col. I ( : 2) diluted with. M BS was added to each well in a volume of μl and incubated at 37 Cfor2h. Goat anti-rabbit IgG-HR diluted ( : ) with enzymelabeled antibody dilution (9%. M BS, % inactivated bovine serum) was added to each well in a μlvolumeand plates were incubated at 37 C for 2 h. The preparations were developed under darkroom conditions at room temperature. After the chromatism of the standard well was observable, 2NH 2 SO 4 ( μl/well) was added to stop the reaction. The absorbance was read at 492 nm on a microplate reader, and a standard curve was generated. The Col. I contents detected (ng ml ) per total protein in the supernatant (mg ml ) were recorded. 2.7. Data Analysis. Data are expressed as mean ± standard deviation. Data were analyzed using a one-way analysis of variance as well as the least significant difference test, and <.5 was considered statistically significant. 3. Results 3.. Construction of LX-2 Cell-Line Containing Smad4 RNAi. The ol II mir RNAi expression vector was constructed and confirmed by sequencing. The level of Smad4 mrna in LX-2 cells transfected with SRV3 and was decreased compared to control cells. After selection of cells with blasticidin, the protein levels of Smad4 in LX-2 cells transfected with were reduced to approximately 3% (Figures (a) and (b)). The levels of Smad4 mrna were reduced to approximately 7.3% compared to control (Figure (b)). 3.2. The Effect of SA-B on p38 MAK Signaling in LX-2 Cells Is via Inhibiting the Smad and ERK athways. Without TGF-β stimulation and SA-B drug intervention, p-p38 protein can be detected in LX-2 cells. When LX-2 cells were transfected with a negative control plasmid or a vector, there was no significant effect on p-p38 protein expression, however, following to stimulation with TGF-β the levels of p-p38 protein were significantly increased ( <.). The LX- 2 cells containing Smad4 RNAi or Smad4 RNAi combined with D9859 expressed higher levels of p-p38 protein when they were stimulated with TGF-β (<.). In the case of LX-2 cells containing Smad4 RNAi, the p-p38 protein expression levels in LX-2 cells stimulated with TGF-β were significantly inhibited by SA-B ( <. in all cases) (Figure 2(a)). Similar effect was observed when LX-2 cells containing Smad4 RNAi combined with D9859 addition ( <. in all cases) (Figure 2(a)). We determined the changes of α-sma and Col. I, which are markers of activated HSCs, following inhibition of the Smad and ERK pathways. The protein expression of α-sma and Col. I was high in control cells and the cells transfected with a negative control vector, but the levels of protein were much lower in the group. TGF-β stimulation of LX- 2 cells increased the protein expression of α-sma and Col. I markedly ( <.), but the levels were significantly lower in the + TGF group ( <.) (Figures 2(b) and 2(c)). The Col. I protein content in the supernatants from these groups showed similar trends (Table ). In LX-2 cells containing Smad4 RNAi combined with D9859 addition and TGF stimulation, the protein expression of α-sma was virtually undetectable. In LX-2 cells containing Smad4 RNAi, combined with TGF-β stimulation, the expression of α- SMA and Col. I was significantly inhibited by SA-B or D9859 (Figure2(c)). 3.3. The EffectofSA-BonERKSignalinginLX-2CellsIs via Inhibiting the Smad and p38 Signaling. Our previous research results indicate that SA-B can inhibit the expression of p-mek, but have no significant effect on other kinases of ERK pathway [2]. p-mek was detected in LX-2 cells in the absence of TGF-β stimulation and SA-B intervention. p- MEK level was significantly increased by TGF-β stimulation ( <.). When Smad signaling was knocked down, p- MEK expression was significantly decreased irrespective of TGF-β stimulation ( <.), and there was no statistically significant difference in p-mek protein expression in the +TGF+SBgrouporthe+TGFgroup.Furthermore, p-mek protein was virtually undetectable in the + TGF + SA-B and + TGF + SA-B + SB groups ( <.) (Figure 3(a)). Similar to 3.2, protein expression of α-sma and Col. I was detectable in control cells and those transfected with

4 Evidence-Based Complementary and Alternative Medicine mrna Relative folds of Smad4.8.6.4.2.8.6.4.2 Negative control SRV SRV2 SRV3 NC SRV SRV2 SRV3 Smad4 Actin (a) Negative control Smad4 Actin Smad4 protein expression (of actin).2.8.6.4.2 (b) Figure : Inhibition of Smad4 in LX-2 transfected with ol II mir RNAi expression vectors (SRV, SRV2, SRV3, and ). (a) Smad4 mrna expression levels detected by real time CR 72 h after selection with blasticidin. Results were normalized to Smad4 expression in using the 2 ΔΔCt method (where Ct is threshold cycle). Significant difference versus negative control (n = 3, <.). On the right side of the figure is shown the electrophoresis of CR product. (b) Smad4 protein expression levels detected after selection with blasticidin, using the Western blot. Blotting with anti-β-actin antibody was conducted as a protein loading control. Quantification of the intensity of bands calibrated to the intensity of total protein bands (means ± SD). Significant difference versus negative control (n = 3, <.). Table : The changes of Col. I in LX-2 cell culture supernatants following inhibition of ERK and Smad4 signaling pathways. Group n mean ± S 3.567 ±.93 3.469 ±.4 3.35 ±. TGF 3.7 ±.7 SM4 + TGF 3.648 ±.2 SM4 + TGF + SA-B 3.289 ±.22 SM4 + TGF + D 3.294 ±.23 TGF + SA-B + D 3.439 ±.3 SM4 + TGF + SA-B + D 3.252 ±.4 The levels of Col. I protein were determined by ELISA kit as indicated. Results were expressed as mean ± SE of three independent experiments performed in triplicate. Significant difference versus, Negative control, and (n = 3, <.); Significant difference versus and TGF (n = 3, <.); Significant difference versus SM4 + TGF (n = 3, <.); Significant difference versus SM4 + TGF + SA-B, SM4 +TGF+D,andTGF+SA-B+D(n = 3, <.). a negative control vector, but it was significantly lower in the group ( <.). LX-2 cells stimulated by TGFβ had significantly increased α-sma and Col. I expression ( <.); and significantly reduced α-sma and Col. I in the + TGF group ( <.). LX-2 cells in the + TGF + SB group expressed a low amount of α-sma ( <.). In the + TGF + SA-B group and + TGF + SA-B + SB group, the α-sma level was minimal. The protein expression of α-sma in LX-2 cells of the TGF + SA- B + SB group was significantly lower than that of the TGF + SA-B group and TGF + SB group (both <.) (Figure 3(b)).ThelevelofCol.Iinthe+TGF+SBgroupand + TGF + SA-B group was lower than in the + TGF group (both <.5).Inthe+TGF+SA-B+ SB group, the protein expression of Col. I was lower than in the+tgf+sa-bandtgf+sa-b+sbgroups(both <.) (Figure 3(c)). Similar changes of Col. I can be also observed in culture media of LX-2 (Table 2). 4. Discussion General TGF-β signaling pathways have been described in detail. In addition to the Smad signaling pathway, TGF-β can persistently activate MAK signaling pathways [3, 4]. A variety of extracellular stimuli transmit signals from cell membrane to nucleus and converge on MAK cascades [5]. Three distinct MAK pathways have been described in mammalian cells, the extracellular signal-regulated kinases (ERK) pathway, the c-jun amino terminal kinase (JNK)

Evidence-Based Complementary and Alternative Medicine 5 TGF-β ( ng ml ) D9859 (5 μm) 6 SA-B ( M L ) + + + + + + + + + + + + + + + + + + p-p38 p38 -p38 rotein expression (of total p38) 4 3.5 3 2.5 2.5.5 TGF SM4 + TGF SM4 + TGF + D SM4 + TGF + SA-B TGF + SA-B + D SM4 + TGF + SA-B + D TGF-β ( ng ml ) D9859 (5 μm) 6 SA-B ( M L ) (a) + + + + + + + + + + + + + + + + + + α-sma GADH α-sma protein expression (of GADH) 2.5 2.5.5 TGF SM4 + TGF SM4 + TGF + D SM4 + TGF + SA-B TGF + SA-B + D S M4 + TGF + SA-B + D (b) Figure 2: Continued.

6 Evidence-Based Complementary and Alternative Medicine TGF-β(ng ml ) D9859 (5 μm) 6 SA-B ( M L ) + + + + + + + + + + + + + + + + + + Col I GADH ColIproteinexpression (of GADH) 2.8.6.4.2.8.6.4.2 TGF SM4 + TGF SM4 + TGF + D SM4 + TGF + SA-B TGF + SA-B + D SM4 + TGF + SA-B + D (c) Figure 2: The effects of SA-B on p38 MAK pathway via Inhibition of ERK and Smad signaling. (a) 38 phosphorylation in LX-2 cells. The levels of phosphorylated p38 protein were determined by Western blot using anti-phospho-p38 antibodies. The levels of total p38 protein were determined by Western blot using anti-p38 antibodies. Quantification of the intensity of bands calibrated to the intensity of total protein bands (means ± SD). Significant difference versus,, and (n = 3, <.); Significant difference versus SM4 + TGF (n = 3, <.); Significant difference versus TGF (n = 3, <.); Significant difference versus SM4 + TGF + D (n = 3, <.). (b) α-sma level in LX-2. The levels of α-sma protein were determined by Western blot using anti-α-sma antibodies. Blotting with anti-gadh antibodies was conducted as a protein loading control. Quantification of the intensity of bands calibrated to the intensity of total protein bands (means ± SD). Significant difference versus,, and (n = 3, <.); Significant difference versus TGF (n = 3, <.); Significant difference versus SM4 + TGF (n = 3, <.), Significant difference SM4 + TGF + D and SM4 + TGF + SA-B (n = 3, <.); Significant difference versus SM4 + TGF + SA-B, TGF + SA-B + D (n = 3, <.). (c) Col. I level in LX-2. The levels of Col. I protein were determined by Western blot using anti- Col. I antibodies. Blotting with anti-gadh antibodies was conducted as a protein loading control. Significant difference versus,, and (n = 3, <.); Significant difference versus TGF (n = 3, <.); Significant difference versus SM4 +TGF(n = 3, <.); Significant difference versus SM4 + TGF + D, SM4 + TGF + SA-B, and TGF + SA-B + D (n = 3, <.5). pathway, and the p38 MAK pathway [6]. TGF-βactivates ERK and p38mak signaling in HSCs [7, 8]. SA-B inhibits Smads and MAK activity in HSCs stimulated with TGF-β [8, 9]. However, the mechanism(s) by which SA-B regulates the MAK signaling pathway in HSCs stimulated with TGF-β have not been elucidated completely. In the present study, we used RNAi to knock down Smad4 protein expression, thus inhibiting potential crosstalk of the Smads to the MAK signaling. The BLOCKiT ol II mir RNAi expression vector system was used to knock down Smad4 mrna levels. Smad4 mrna levels were decreased by 7.3% in LX-2 cells selected with blasticidin. This allowed us to investigate the anti-fibrotic action of SA-B in depth. 4.. Cross-Talk between the Smad and MAK Signaling athways. TGF-β stimulates further activation of LX-2 cells. Furthermore, phosphorylation of p38 and ERK was significantly increased. In LX-2 cells affectedby Smad4 RNAi, the phosphorylation of p38 was not significantly different compared to control. However, the protein expression of p-p38 and p-erk in LX-2 cells stimulated with TGF-β was significantly higher than in controls. Smad4 RNAi did not inhibit the phosphorylation of p38 in LX-2 cells stimulated with TGF-β. This suggests there may be lack of

Evidence-Based Complementary and Alternative Medicine 7 TGF-β(ng ml ) SB2358 (5 μm) 6 SA-B ( M L ) + + + + + + + + + + + + + + + + + + p-mek MEK protein expression (of total MEK) 2.5 2.5 # MEK p-.5 # TGF SM4 + TGF SM4 + TGF + SB SM4 + TGF + SA-B TGF + SA-B + SB SM4 + TGF + SA-B + SB TGF-β(ng ml ) SB2358 (5 μm) 6 SA-B ( M L ) (a) + + + + + + + + + + + + + + + + + + α-sma GADH α-sma protein expression (of GADH).6.4.2.8.6.4.2 TGF SM4 + TGF SM4 + TGF + SB SM4 + TGF + SA-B TGF + SA-B + SB SM4 + TGF + SA-B + SB (b) Figure 3: Continued.

8 Evidence-Based Complementary and Alternative Medicine TGF-β ( ng ml ) SB2358 (5 μm) 6 SA-B ( M L ) + + + + + + + + + + + + + + + + + + Col I GADH ColIproteinexpression (of GADH).4.2.8.6.4.2 TGF SM4 + TGF SM4 + TGF + SB SM4 + TGF + SA-B TGF + SA-B + SB SM4 + TGF + SA-B + SB (c) Figure 3: The effects of SA-B on ERK signaling via inhibition of p38 MAK and Smad signaling. (a) MEK phosphorylation in LX-2 cells. The levels of phosphorylated MEK protein were determined by Western blot using anti-phospho-mek antibodies. The levels of total MEK protein were determined by Western blot using anti-mek antibodies. Quantification of the intensity of bands calibrated to the intensity of total protein bands (means ± SD). # Significant difference versus,, and (n = 3, <.); Significant difference versus TGF (n = 3, <.); Significant difference versus SM4 + TGF, SM4 + TGF + SB, and TGF + SA-B + SB (n = 3, <.). (b) α-sma levels in LX-2. The levels of α-sma protein were determined using anti-α-sma antibodies. Blotting with anti-gadh antibodies was conducted as a protein loading control. Significant difference versus, and (n = 3, <.); Significant difference versus TGF (n = 3, <.); Significant difference versus SM4 + TGF (n = 3, <.); Significant difference versus SM4 + TGF (n = 3, <.); Significant difference versus SM4 + TGF + SB, SM4 + TGF + SA-B, and TGF + SA-B + SB (n = 3, <.). (c) Col. I level in LX-2. The levels of Col. I protein were determined by Western blot using anti-col. I antibodies. Blotting with anti-gadh antibodies was conducted as a protein loading control. Significant difference versus,, and (n = 3, <.); Significant difference versus TGF (n = 3, <.); Significant difference versus SM4 + TGF (n = 3, <.5); Significant difference versus SM4 + TGF (n = 3, <.); Significant difference versus SM4 + TGF + SB, SM4 + TGF + SA-B, and TGF + SA-B + SB (n = 3, <.). cross-talk of Smad signaling pathway to the p38 MAK signaling pathway in LX-2 cells stimulated with TGF-β. In the Smad4 RNAi LX-2 cells with ERK pathway inhibitor, TGF-β induced increased expression of p-p38. This indicates that there seems to be no cross-talk between the ERK signaling pathway and p38 signaling pathway in HSCs. In Smad4 RNAi LX-2cellsstimulated withtgf-β, the protein expression of p-mek was significantly lower compared to that in the cells without Smad4 RNAi. These results indicate there may be cross-talk between the Smad pathway and the ERK pathway (Figure 4). Such cross-talk has been reported in other types of cells [2 22]. In Smad4 RNAi LX-2 cells stimulated with TGF-β, SB2358 did not have a significant effect on the expression of p-mek. This suggests there may be no significant cross-talk between the p38 pathway and the ERK pathway (Figure 4). However, cross-talk between ERK and p38 MAK has been reported in other cell types [23]. This indicates the complexity of cross-talk and signaling pathways in the different cell types. 4.2. The Inhibitory Effect of SA-B on ERK Signaling in HSCs Stimulated with TGF-β. SA-B inhibits the phosphorylation of MEK in HSCs, but has no significant effect on phosphorylation of other kinases in ERK signaling. SA-B also has no significant effect on total MEK protein expression [2]. In view of the potential cross-talk between the Smad and

Evidence-Based Complementary and Alternative Medicine 9 TGF-β TGFβ-R MAK Cell membrane Smad2 Smad3 SA-B Raf MEK Smad4 p38mak ERK GTF MEF2A MEF2C Gene transcription Nucleus Elk- Figure 4: roposed mechanisms of the anti-fibrotic effects of SA-B on activated HSCs stimulated by TGF-β. Table 2: The changes of Col. I in LX-2 cell culture supernatant after inhibition of p38 MAK and Smad4 signaling. Group n Mean ± S 3.567 ±.93 3.469 ±.4 3.35 ±. TGF 3.7 ±.7 SM4 + TGF 3.648 ±.2 SM4 + TGF + SA-B 3.289 ±.22 SM4 + TGF + SB 3.28 ±.36 TGF + SA-B + SB 3.386 ±.24 SM4 + TGF + SA-B + SB 3.222 ±.26 Δ The levels of Col. I protein were determined by ELISA kit as indicated. Results were expressed as mean ± SE of three independent experiments performed in triplicate. Significant difference versus, Negative control, and (n = 3, <.); Significant difference versus and TGF-β(n = 3, <.); Significant difference versus (n = 3, <.); Δ Significant difference versus SM4 + TGF + SA-B, SM4 + TGF + SB, and TGF + SA-B + SB (n = 3, <.5). the ERK signaling pathway, further clarification of the effect of SA-B on the ERK signaling pathway was required. To investigate this, the Smad signaling pathway was inhibited and the effect of SA-B on the phosphorylation of MEK was analyzed. As shown in Figure 3(a), SA-B suppresses the phosphorylation of MEK significantly. In Smad4 RNAi HSC cells, SA-B inhibits MEK phosphorylation with or without the addition of SB2358. This indicates that there is no cross-talk between the p38 and ERK pathways. The phosphorylation level of MEK in the + TGF group was 5% of that in the TGF group, and after Smad4 knockdown combined with SA-B intervention, the phosphorylation level of MEK was barely detectable by Western blotting. The decline in phosphorylation levels of MEK in HSCs may not only be due to the residual levels of Smad4 but also to the action of SA- B. Therefore, it may be concluded that SA-B directly inhibits the phosphorylation of MEK in HSCs (Figure 4). 4.3. The Inhibitory Effect of SA-B on the p38 Signaling athway in HSCs Stimulated by TGF-β. MAK signaling has been implicated in TGF-β-mediated signaling and collagen gene expression [5]. In MAK family, ERK and p38 MAK activation can increase the collagen in hepatic stellate cells. The data shown in Figures 2(a) and 3(a) illustrate the lack of cross-talk between p38 MAK and the Smad or ERK signaling pathways. The reduction of phosphorylated p38 may be due to SA-B. In previous research we found SA-B has no significant effect on total MEK protein expression [2]. Following Smad4 RNAi and/or blocking ERK signaling, SA-B inhibits the expression of p-p38 in HSCs stimulated with TGF-β. This confirms that SA-B inhibits the phosphorylation of p38 in HSCs independent of the Smad and ERK pathways (Figure 4). To clarify the action of SA-B on p38mak signaling pathway, it will be required to detect the kinase upstream of p38. 4.4. SA-B Suppresses the Expression of Col. I and α-sma in HSCs Stimulated with TGF-β via Inhibition of MEK hosphorylation in ERK Signaling and p38mak Signaling. The protein expression of α-smacanbedetected in controlcells. Smad4 RNAi caused a significant reduction in the expression of α-sma irrespective of TGF-β stimulation. Smad4 RNAi resulted in further reduction in α-sma expression with ERK or p38 MAK signaling being inhibited. In the + TGF +SA-B,+TGF+SA-B+SB,and+TGF+SA-B + D groups, the protein expression of α-sma could not be detected.

Evidence-Based Complementary and Alternative Medicine Inthe+TGF+SA-B,and+TGF+D groups, the expression of Col. I was inhibited by SA-B, an effect similar to D9859. In these groups, the SA-B inhibitory action is weaker than that of Smad4 RNAi, compared to thetgf+sa-b+dand+tgf+sa-b+dgroups. As shown in Figure 3(c), SA-B suppresses the expression of Col. I more effectively than SB2358 in the + TGF + SA-B and + TGF + SB groups. However, in the TGF + SA-B + SB, + TGF + SA-B + SB, + TGF + SA-B and + TGF + SB groups, we could not determine which was most effective on reducing the production of Col. I in HSCs in Smad4 RNAi, SB2358, or SA-B. SA-B has a significant inhibitory effect on Smad and MAK signaling. The anti-fibrotic effect of SA-B occurs via inhibiting p38mak signaling pathway directly and inhibiting the cross-talk of Smad signaling pathway to ERK MAK signaling pathway. As demonstrated in Figures 2(c) and 3(c), when the ERK and p38 MAK signaling pathways were blocked, respectively, Col. I expression was significantly inhibited. Smad4 RNAi enhanced the inhibitory effect on the intracellular expression of Col. I. This suggests that the Smad, ERK, and p38 pathways are involved in Col. I synthesis in activated HSCs. However, Smad4 RNAi (7.3% effective) and antagonists of ERK and p38 MAK did not completely inhibit signal transduction in LX-2 cells stimulated with TGF-β, and LX-2 cells express residual levels of Col. I protein. After weakening the Smad and MAK signal pathways, the inhibitory action of SA-B on Col. I production is still evident. The expression of Col. I is the lowest in the + TGF + D + SB + SA-B group, but it can still be detected. A possible explanation for this result is that SA-B supplements the inhibitory action of Smad4 RNAi, D9859, and SB2358 on the signal transduction pathway, but does not completely inhibit Col. I synthesis in HSCs stimulated withtgf-β, suggesting the involvement of other signal transduction pathways. Normally cultured LX- 2 cells express Col. I, suggesting that they are activated by mechanisms other than TGF-β stimulation, which requires further investigation. Appendix ECM: Extracellular matrix CCl 4 : Carbon tetrachloride Col. I: Collagen type I HSCs: Hepatic stellate cells MFB: Myofibroblast-like cells TGF-β: Transforming growth factor-β α-sma: α-smooth muscle actin MAK: Mitogen-activated protein kinase SA-B: Salvianolic-acids B SB: SB2358 D: D9859 : Smad4 RNAi ERK: Extra cellular signal-regulated kinase p38 MAK: p38 mitogen-activated RNAi: RNA interference mirna: MicroRNA pri-mirna: rimary transcript of mirna p-mek: hosphorylation of MEK p-p38: hosphorylation of p38 p-mkk3/6: hosphorylation of MKK3/6. Acknowledgments This work was supported by Grants from the National Natural Science Foundation of Shanghai no. 6ZR482, National Basic Research rogram of China 973 and Shanghai Leading Academic Discipline roject Y32, and Leading Academic Discipline roject of Shanghai Municipal Education Commission (J537). References []M.D.A.Gaça,J.A.ickering,M.J..Arthur,andR.C. Benyon, Human and rat hepatic stellate cells produce stem cell factor: a possible mechanism for mast cell recruitment in liver fibrosis, Journal of Hepatology, vol. 3, no. 5, pp. 85 858, 999. [2] H. L. Reeves and S. L. Friedman, Activation of hepatic stellate cells a key issue in liver fibrosis, Frontiers in Bioscience, vol. 7, pp. d88 826, 22. [3] S. L. Friedman, Liver fibrosis: from mechanisms to treatment, Gastroenterologie Clinique et Biologique, vol. 3, no., pp. 82 84, 27. [4] S. Kanzler, A. W. Lohse, A. Keil et al., TGF-β in liver fibrosis: an inducible transgenic mouse model to study liver fibrogenesis, American Journal of hysiology, vol. 276, no. 4, pp. G59 G68, 999. [5] M. H. Chen, J. C. Chen, C. C. Tsai et al., The role of TGF-β and cytokines in the modulation of liver fibrosis by Sho-saiko-to in rat s bile duct ligated model, Journal of Ethnopharmacology, vol. 97, no., pp. 7 3, 25. [6] Y. Y. Hu,. Liu, C. Liu et al., Actions of salvianolic acid A on CCl4-poisoned liver injury and fibrosis in rats, Zhongguo Yao Li Xue Bao, vol. 8, no. 5, pp. 478 48, 997. [7]. Liu, Y. Y. Hu, C. Liu et al., Clinical observation of salvianolic acid B in treatment of liver fibrosis in chronic hepatitis B, World Journal of Gastroenterology, vol. 8, no. 4, pp. 679 685, 22. [8] C.Liu,.Liu,Y.Hu,and D.Zhu, Effects of salvianolic acid-b on TGF-beta stimulated hepatic stellate cell activation and its intracellular signaling, Zhonghua Yi Xue Za Zhi, vol. 82, no. 8, pp. 267 272, 22. [9] T. Hayashida, M. Decaestecker, and H. W. Schnaper, Crosstalk between ERK MA kinase and Smad signaling pathways enhances TGF-beta-dependent responses in human mesangial cells, Journal of the Federation of American Societies for Experimental Biology, vol. 7, no., pp. 576 578, 23. [] R. Samarakoon, C. E. Higgins, S.. Higgins, and. J. Higgins, Differential requirement for MEK/ERK and SMAD signaling in AI- and CTGF expression in response to microtubule disruption, Cellular Signalling, vol. 2, no. 6, pp. 986 995, 29. [] L. Xu, A. Y. Hui, E. Albanis et al., Human hepatic stellate cell lines, LX- and LX-2: new tools for analysis of hepatic fibrosis, Gut, vol. 54, no., pp. 42 5, 25. [2] Z. Lv, Y. Song, D. Xue, W. Zhang, Y. Cheng, and L. Xu, Effect of Salvianolic-acid B on inhibiting MAK signaling induced by transforming growth factor-β in activated rat hepatic

Evidence-Based Complementary and Alternative Medicine stellate cells, Journal of Ethnopharmacology, vol. 32, no. 2, pp. 384 392, 2. [3] F. Caraci, E. Gili, M. Calafiore et al., TGF-β targets the GSK- 3β/β-catenin pathway via ERK activation in the transition of human lung fibroblasts into myofibroblasts, harmacological Research, vol. 57, no. 4, pp. 274 282, 28. [4] A. Sebe, S. K. Leivonen, A. Fintha et al., Transforming growth factor-β-induced alpha-smooth muscle cell actin expression in renal proximal tubular cells is regulated by p38β mitogenactivated protein kinase, extracellular signal-regulated protein kinase,2 and the Smad signalling during epithelialmyofibroblast transdifferentiation, Nephrology Dialysis Transplantation, vol. 23, no. 5, pp. 537 545, 28. [5] M. Raman and M. H. Cobb, MA inase modules: many roads home, Current Biology, vol. 3, no. 22, pp. R886 R888, 23. [6] S. Kumar, J. Boehm, and J. C. Lee, 38 MA kinases: key signalling molecules as therapeutic targets for inflammatory diseases, Nature Reviews Drug Discovery, vol. 2, no. 9, pp. 77 726, 23. [7] S. Saika, O. Yamanaka, K. Ikeda et al., Inhibition of p38ma kinase suppresses fibrotic reaction of retinal pigment epithelial cells, Laboratory Investigation, vol. 85, no. 7, pp. 838 85, 25. [8] O. Yamanaka, S. Saika, Y. Ohnishi, S. Kim-Mitsuyama, A. K. Kamaraju, and K. Ikeda, Inhibition of p38ma kinase suppresses fibrogenic reaction in conjunctiva in mice, Molecular Vision, vol. 3, pp. 73 739, 27. [9]J.F.Zhao,C.H.Liu,Y.Y.Hu,L.M.Xu,.Liu,andC. Liu, Effect of salvianolic acid B on Smad3 expression in hepatic stellate cells, Hepatobiliary and ancreatic Diseases International, vol. 3, no., pp. 2 5, 24. [2] H. Watanabe, M.. de Caestecker, and Y. Yamada, Transcriptional cross-talk between smad, ERK/2, and p38 Mitogenactivated protein kinase pathways regulates transforming growth factor-β-induced aggrecan gene expression in chondrogenic ATDC5 cells, Journal of Biological Chemistry, vol. 276, no. 7, pp. 4466 4473, 2. [2] K. M. Mulder, Role of ras and mapks in TGFβ signaling, Cytokine and Growth Factor Reviews, vol., no. -2, pp. 23 35, 2. [22]H.K.Hong,C.Y.Song,B.C.Kim,andH.S.Lee, ERK contributes to the effects of Smad signaling on oxidized LDL-induced AI- expression in human mesangial cells, Translational Research, vol. 48, no. 4, pp. 7 79, 26. [23] Y. Q. Xiao, K. Malcolm, G. S. Worthen et al., Cross-talk between ERK and p38 MAK mediates selective suppression of pro-inflammatory cytokines by transforming growth factor-β, Journal of Biological Chemistry, vol. 277, no. 7, pp. 4884 4893, 22.

MEDIATORS of INFLAMMATION The Scientific World Journal Gastroenterology Research and ractice Journal of Diabetes Research International Journal of Journal of Endocrinology Immunology Research Disease Markers Submit your manuscripts at BioMed Research International AR Research Journal of Obesity Journal of Ophthalmology Evidence-Based Complementary and Alternative Medicine Stem Cells International Journal of Oncology arkinson s Disease Computational and Mathematical Methods in Medicine AIDS Behavioural Neurology Research and Treatment Oxidative Medicine and Cellular Longevity