Control. csarnt -/- Cre, f/f

Similar documents
c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W

E10.5 E18.5 P2 10w 83w NF1 HF1. Sham ISO. Bmi1. H3K9me3. Lung weight (g)

SUPPLEMENTARY INFORMATION

Serum cytokine levels in control and tumor-bearing male and female mice at day 15.

Effects of sitagliptin on cardiac metabolism in mice

Fetal gene upregulation by 1-wk TAC is significantly increased in mice lacking RGS2.

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in

Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI

Supplemental Table 1. Echocardiography Control (n=4)

Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

SUPPLEMENTARY INFORMATION

doi: /nature14508 Rappsilber et al.

BNP mrna expression in DR and DS rat left ventricles (n = 5). (C) Plasma norepinephrine

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

Supplementary Figure 1

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

SUPPLEMENTARY INFORMATION

Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition

Figure S1A. Blood glucose levels in mice after glucose injection

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Supplementary Table 1.

Primary Cilia Can Both Mediate and Suppress Hedgehog Pathway- Dependent Tumorigenesis (Supplementary Figures and Materials)

Supporting Information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplemental Figure 1

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation

Adipocyte-specific loss of PPARg attenuates cardiac hypertrophy

Supplementary Materials for

SUPPLEMENTARY LEGENDS...

Probe. Hind III Q,!&#12?R'!! /0!!!!D1"?R'! vector. Homologous recombination

Supplementary Figure 1

Fuel the Failing Heart: glucose or fatty acids? Rong Tian, MD, PhD Mitochondria and Metabolism Center University of Washington, Seattle

Supplementary Materials for

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

Supplementary Figure 1

Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections

Nature Genetics: doi: /ng Supplementary Figure 1. Parameters and consequences of mononuclear cardiomyocyte frequency.

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

SUPPLEMENTARY INFORMATION

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

SUPPLEMENTARY FIGURES

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

SUPPLEMENTARY INFORMATION

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

Supplementary Fig. S1. Schematic diagram of minigenome segments.

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

During exercise the heart rate is 190 bpm and the stroke volume is 115 ml/beat. What is the cardiac output?

Supplementary Figures and Figure Legends

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.

Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events

Supplemental Figures:

SUPPLEMENTARY INFORMATION

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected

SUPPLEMENTARY INFORMATION

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer

Supplementary Figure 1

Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

Supplemental Figure I

Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts

SUPPLEMENTARY FIGURES AND TABLES

Expanded View Figures

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

Angiotensin type 1a receptor-deficient mice develop diabetes-induced cardiac dysfunction, which is prevented by renin-angiotensin system inhibitors

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)

Moore-Morris et al. Supplemental Table 1.

Erythropoietin preserves the endothelial differentiation potential of cardiac progenitor cells and attenuates heart failure during anti-cancer therapy

Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses

Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation

SUPPLEMENTARY FIGURES

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

SUPPLEMENTARY FIGURES

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Supplementary Information

HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment.

Supplemental Figure S1. RANK expression on human lung cancer cells.

Phosphoinositides Regulate Ciliary Protein Trafficking to Modulate Hedgehog Signaling

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus

Transcription:

ody weight (g) A re,f/f re x f/f f/+ re, f/+ re,f/+ f/f x f/f f/+ cs -/- re, f/f re f/f re, f/f Normal chow Tamoxifen Tamoxifen Tamoxifen W 4W re f/f re, re/ff f/f re f/f re, re/ff f/f Normal chow Tamoxifen chow Supplemental Figure. Generation of knockout mice. (A) reeding of f/f (denoted as f/f) mice with αmh-mm (denoted as re) mice to generate MM/ f/f (denoted as re, f/f) mice. () Protocol for oral administration of tamoxifen in different experimental groups. ardiac function was assessed at and 4 weeks after the completion of tamoxifen treatment. Arrows refer to the time when echocardiography was performed. () Mean body weight and food intake in controls, αmh- MM (represented as re) and f/f (represented as f/f) and αmh-mm/ f/f (represented as cre, f/f) mice treated with normal and tamoxifen chow (n=7- independent experiments). Data are presented as mean ± SEM. P <. versus normal chow.

mrna levels.4 -/- cs -/-..8.6.4. mrna levels (relative expression) 4 -/- cs -/- Tamoxifen chow Normal chow Adipose rain Kidney Liver Lung Spleen GAPDH Supplemental Figure. expression in the heart and other organs of control and cs -/- mice. (A) mrna levels (as determined by RT-PR) of cardiac samples from control and cs -/- mice after tamoxifen administration at different time points (n=6 independent experiments). () mrna levels in different organs of control and cs -/- mice (n=6 independent experiments). () Western blot analysis of in different organs of control and cs -/- mice 4 weeks after tamoxifen treatment. Data are presented as mean ± SEM. P <..

Normal chow Tamoxifen chow αmh-mm, f/f αmh-mm f/f M-mode %EF 7 6 4 f/f %FS re re, f/f re re, f/f f/f D LVID-d (mm) 4 Tamoxifen Normal chow E IVS-d.8.6.4. Tamoxifen Normal chow f/f Tamoxifen re re, f/f re re, f/f f/f Normal chow Tamoxifen Normal chow Supplemental Figure. ardiac function in three sets of control animals by echocardiographic assessment. (A) representative M-mode images from indicated mice at weeks. EF (), FS (), LVID-d (D), and interventricular septal thickness at enddiastole (IVS-d) (E) (n=- independent experiments). Data are presented as mean ± SEM.

Heart weight/tibia length (mg/mm) 8 7 6 4 Lung weight/tibia length (mg/mm) 8 6 4 cs -/- cs -/- cs -/- Tibia length (mm) Supplemental Figure 4. Morphologic changes of control ( f/f littermates) and cs -/- mice 4 weeks after tamoxifen treatment. (A) Ratio of heart weight to tibia length (n= independent experiments). () Ratio of lung weight to tibia length (n= independent experiments). () Tibia length (n= independent experiments). Data are presented as mean ± SEM. P <..

NP mrna NP mrna A 8 7 9 8 6 7 4 6 4 cs -/- -/- -/- cs -/- Supplemental Figure. mrna levels of (A) atrial natriuretic peptide (ANP) and () brain natriuretic peptide (NP) in the hearts of control and cs -/- mice at 4 weeks after tamoxifen administration (n=6 independent experiments). Data are presented as mean ± SEM. P <..

4 TAG (mg/dl) control cs-/- expression..8.6.4. Tubulin TAG content (nmol/µg protein).6.4..8.6.4. Supplemental Figure 6. Serum triacylglycerol (TAG) level with knockdown. (A) Serum TAG levels in cs -/- hearts (n=7 independent experiments). () Western blot analysis of expression in NRM treated with and control for 48 hours ( n= independent experiments). () TAG levels in NRM treated with control or for 48 hours (n=6 independent experiments). Data are presented as mean ± SEM. P <..

A Glucose oxidation (nmol/g dry wt/min) Glucose uptake (cpm/µg protein) 6 4 7 6 4 8 6 4 cs -/- mrna levels D..8.6.4. EAR mph/min/mg protein.4 HKII cs-/- Glut Glut4 Supplemental Figure 7. Assessment of myocardial glucose metabolism in vivo and in vitro. (A) Glucose oxidation measured in working hearts (n=6 independent experiments). () mrna levels of HKII, Glut and Glut4 determined by qrt-pr on cardiac muscle samples of control and cs -/- mice (n=-6 mice per genotype). () Glucose uptake as measured by 4 - labeled glucose in NRM after treatment with control and (n=6 independent experiments). (D) Extracellular acidification rate (EAR) measured with the XF4 Extracellular Flux Analyzer in NRM transfected with control or (n= 6 independent experiments). Data are shown as mean ± SEM. P <. vs control.

A PPARα PPAR-α mrna levels... Relative intensity... Tubulin Supplemental Figure 8. Expression of PPARα in NRM treated with control and for 48 hours. (A) PPARα mrna levels were determined by qrt-pr and 8S ribosomal was used as a internal control (n=6 independent experiments). () PPARα protein levels analyzed by Western blot (n=6 independent experiments). Data are presented as mean ± SEM. P <..

GAPDH.4 IgG Fold enrichment..8.6.4. Fold enrichment. IgG.. 8S β-actin WD ELMO UGP Supplemental Figure 9. Effective knockdown of in HEK9 cells and Positive and negative controls for hip studies. (A) Western blot of HEK9 cells treated with control or and blotted with antibody. () Negative controls for the hip studies. The amplified regions do not contain any predicted HRE sites, and therefore is not regulated by (n=). () Positive controls for the hip studies (n=). These genes have been shown to be regulated by as described in the Methods section. WD, obalamin Synthetase W Domain-ontaining Protein ; ELMO, Engulfment And ell Motility ; UGP, UDP-Glucose Pyrophosphorylase. Data are represented as fold enrichment over IgG samples and are shown as mean ± SEM. P <. vs control. N= independent experiments for and.

mrna..8.6.4. HIFα mrna..8.6.4. : : HIFα HIFα mrna..8.6.4. D AHR mrna..8.6.4. : HIFα : AHR Supplemental Figure. Effective reduction in the mrna levels of (A) and its partners, HIFα (), HIFα (), and AHR (D) using approach in NRM (n=6 independent experiments). Data are shown as mean ± SEM. P <. vs control.

PPARα mrna levels (Fold hnge).8.6.4..8.6.4. N.S. N.S. DMSO TSA Relative Expression.... ITPR DMSO TSA JAG Relative Expression... DMSO TSA ITPR JAG Supplemental Figure. Regulation of PPARα promoter by is not mediated by HDAS. (A) PPARα mrna levels in NRM treated with HDA inhibitor, trichostatin A (TSA) and in the presence and absence of. Positive control for TSA treatment in NRMs treated with control- () or - (). The expression of these genes is shown to be increased with HDA inhibition (irc Res. ;97:-8). ITPR=inositol,4,-trisphosphate receptor, type ; JAG=jagged. P <. vs control. N=6 independent experiments for all of the panels.

HDA HDA Tubulin Fold Enrichment over IgG 4. 4.... control- - HDA HDA4 Tubulin acetylated-h acetylated H4 D Fold Enrichment over IgG 9 8 7 6 4 acetylated-h control- - acetylated H4 Protein Expression (Fold hange) E.4. Fold Enrichment over IgG.8.6.4. 8 7 6 4 control- control- - acetylated-h - HDA HDA HDA HDA 4 acetylated H4 Supplemental Figure. HDA levels and histone acetylation are not altered by. (A) HDA, HDA, HDA, and HDA4 protein levels in NRM treated with control or. A Summary bar graph is shown in Panel. hip studies assessing the Levels of acetylated histone H and H4 on the PPARα promoter (), and on the promoter of two known target genes, OW domain containing protein (WD, D), and UDP-glucose pyrophosphorylase- (UGP, E) in HepG cells treated with control or. Data are presented as fold enrichment over IgG. P <. vs control. N= independent experiments for panel -E.

. Relative expression.. control db/db Supplemental Figure. PPARα mrna levels in the hearts of control and db/db mice. Data are presented as mean ± SEM. P <.. n=6 independent experiments per group.

cs -/- UP UP Tubulin Protein expression 4.... control cs+/- -/- UP UP Supplemental Figure 4. UP and UP protein levels in the heart of cs -/- mice. A summary bar graph of the results is provided below the Western blot gels. Data are presented as mean ± SEM. P <. versus normal chow.

x re, f/f PPARα -/- re, f/+, PPARα +/- x re, f/f re, f/f, PPARα +/- x re, f/f, PPARα +/- re, f/f, PPARα -/- cs -/- PPARα -/- PPARα -/- cs -/- 44 bp: re 4 bp: WT PPARα bp: f/f bp: WT DAPI 6 bp: PPARα -/- 4 bp: WT Overlay Supplemental Figure. reeding scheme for generation of cs -/- /PPARα -/- double knockout mice. (A) Interbreeding plan of PPARα -/- and re, f/f Knockout mice. () Double knockout mice were selected by genotyping as indicated. () Tissue sections were stained for PPARα (green), (red), and DAPI (nuclei in blue) in hearts from control, c -/- and cs -/- /PPARα -/- double knockout mice. The experiment was repeated three times.

ANP mrna 8 7 6 4 cs -/- cs -/- NP mrna.8.6.4..8.6.4. PPARα -/- cs -/- cs -/- PPARα -/- Supplemental Figure 6. mrna levels of (A) atrial natriuretic peptide (ANP) and () brain natriuretic peptide (NP) in the hearts of control, cs -/- and cs -/- /PPARα -/- double knockout mice 4 weeks after tamoxifen (n=-7 independent experiments). Data are presented as means ± SEM. P <. vs control.

Supplemental Table parameter week (Tomaxifen) Week (Tomxifen) Week ( N how) group cs -/- cs -/- PPARα -/- cs -/- cs -/- PPARα -/- cs -/- cs -/- PPARα -/- n 7 7 7 IVS-d, mm.7 ±..69 ±.6.7 ±..79 ±.7.6 ±..67 ±.4.77 ±.6.84 ±..87 ±. LVPW-d,.6 ±..9 ±..64 ±..8 ±.. ±.4.6 ±..6 ±..67 ±..64 ±.4 mm LVID-d, mm.86 ±..78 ±.44.77 ±.44.6 7 ±. 4.8 ±.8 4. ±.8.8 ±. 4.6 ±.4.99 ±.6 %FS 6.9 ±..9 9 ± 7.644 ±. ±.88 7.6 ±.94. ±.7. ±.4. ±.97 7.64 ±.7.. %EF.6 ± 4.49 4. ±.87.9 ±.8 6.4 ±.76 8. ±.8 47.4 ±.6 6. ±. 4. ±.6.4 ±.6 O, ml/min.7 ±.8 9. ± 4.44 4.44 ±.84 4.64 ± 9. 9.4 ±.4.76 ±.48. ±.. ±. 6.7 ± 6. HR, min 44 ± 8.6 447 ± 4. 487 ± 6. 48 ±.9 488 ± 4. 47 ±. 489 ±. 4 ±. 47 ±. Echocardiographic assessment of control, cs -/- and cs -/- PPARα -/- double knockout mice performed, and weeks after tamoxifen treatment and followed with one week normal chow. End-diastolic interventricular septum thickness (IVS-d); End-diastolic posterior wall thickness (LVPW-d); left ventricular diastolic internal diameter (LVID-d); fractional shorting (%FS); Ejection fraction (%EF); cardiac output (O) and heart rate (HR) were assessed. Animal number used in each group was indicated. Data are presented as mean ± SEM. P <. vs control.

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback