Supplementary Materials. Wild-type and mutant SOD1 share an aberrant conformation and

Similar documents
B. SDS-PAGE. Western blot MW (kda) Supplementary Information. Supplementary Figure 1. MW (kda) Glutelin. Prolamin. 3 E.coli. 3 E.

Structural Characterization of Prion-like Conformational Changes of the Neuronal Isoform of Aplysia CPEB

SUPPLEMENTARY INFORMATION

Supporting Information. Post translational Modifications of Serotonin Type 4 Receptor Heterologously Expressed in. Mouse Rod Cells

WDR62 is associated with the spindle pole and mutated in human microcephaly

Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Product Datasheet. Endothelin-1 Antibody (TR.ET.48.5) NB Unit Size: 100 ul. Store at -20C. Avoid freeze-thaw cycles.

Nature Methods: doi: /nmeth Supplementary Figure 1

Electronic Supplementary Information (ESI) for the article entitled:

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

Supplementary Information Titles Journal: Nature Medicine

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Anti-Lamin B1/LMNB1 Picoband Antibody

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease in which

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.

Product Datasheet. CD133 Antibody NB Unit Size: 0.1 mg

Tivadar Orban, Beata Jastrzebska, Sayan Gupta, Benlian Wang, Masaru Miyagi, Mark R. Chance, and Krzysztof Palczewski

Supplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) (b) (c) (d) (e) (f) (g) .

Atg5 flox/flox ; CAG-Cre, 19M brain heart lung. spleen stomach colon. Takamura_Fig. S1

Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion.

Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI

TECHNICAL BULLETIN. R 2 GlcNAcβ1 4GlcNAcβ1 Asn

Supporting Information

Supplementary Table 1. List of primers used in this study

Supplementary Figure 1. Comparative analysis of thermal denaturation of enzymatically

Supplementary Information

Solution oxygen-17 NMR application for observing a peroxidized cysteine residue in oxidized human SOD1

Human Apolipoprotein A1 EIA Kit

Relative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC

Supporting Information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Procaspase-3. Cleaved caspase-3. actin. Cytochrome C (10 M) Z-VAD-fmk. Procaspase-3. Cleaved caspase-3. actin. Z-VAD-fmk

Pearson r = P (one-tailed) = n = 9

An immunological epitope selective for pathological monomer/misfolded SOD1 in

Improve Protein Analysis with the New, Mass Spectrometry- Compatible ProteasMAX Surfactant

T H E J O U R N A L O F C E L L B I O L O G Y

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

Accurate determination of protein methionine oxidation by stable isotope labeling and LC-MS analysis

Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/-

Supporting Information. Lysine Propionylation to Boost Proteome Sequence. Coverage and Enable a Silent SILAC Strategy for

Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1

Effec<ve Use of PI3K and MEK Inhibitors to Treat Mutant K Ras G12D and PIK3CA H1047R Murine Lung Cancers

Human SH-SY5Y neuroblastoma cells (A.T.C.C., Manassas, VA) were cultured in DMEM, F-12

SUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.

Product Datasheet. IGF-I R Antibody (3G5C1) NB Unit Size: 0.1 ml

Influenza A H1N1 (Swine Flu 2009) Hemagglutinin / HA ELISA Pair Set

Rat Leptin ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or

InnoZyme Myeloperoxidase Activity Kit Cat. No. CBA024

Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal

Supplementary Materials for

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

Supplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

Product Datasheet. DARC Antibody NB Unit Size: 0.1 mg. Store at -20C. Avoid freeze-thaw cycles. Publications: 5

A. One to three months of age. Anterior Lens (Mean ± SEM) Posterior Lens (Mean ± SEM) Mid Lens (Mean ± SEM) Cornea (Mean ± SEM) Genotype

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Materials for

Product Datasheet. SERCA2 ATPase Antibody (IID8) NB Unit Size: 100uL. Store at -20C. Avoid freeze-thaw cycles.

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected

Supplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration

Product Datasheet. DC-LAMP Antibody (104G4) DDX0190P-100. Unit Size: 0.1 mg. Store at -20C. Avoid freeze-thaw cycles.

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

Product Datasheet. HLA ABC Antibody (W6/32) NB Unit Size: 0.25 mg. Store at -20C. Avoid freeze-thaw cycles. Reviews: 1 Publications: 22

The Mycobacterium tuberculosis MmpL11 cell wall lipid transporter is important for

The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells

SUPPLEMENTARY INFORMATION

Protein Identification and Phosphorylation Site Determination by de novo sequencing using PepFrag TM MALDI-Sequencing kit

RayBio KinaseSTAR TM Akt Activity Assay Kit

SUPPLEMENTARY INFORMATION

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

ab Human Citrate Synthase (CS) Activity Assay Kit

Reviewers' comments: Reviewer #1 Expert in EAE and IL-17a (Remarks to the Author):

Expanded View Figures

RayBio Human, Mouse and Rat Phospho-NF-kB P65 (Ser536) and Total NF-kB P65 ELISA Kit

Product Datasheet. Caspase-8 Antibody - (active/cleaved) NB Unit Size: 0.05 ml. Store at -20C. Avoid freeze-thaw cycles.

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG

SUPPLEMENTARY INFORMATION

Rat Leptin-HS ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN

Soluble ADAM33 initiates airway remodeling to promote susceptibility for. Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David I Wilson,

Supplementary Figure S1 Supplementary Figure S2

(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines

supplementary information

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

I. Introduction. II. Characteristics

Supplementary Figure-1. SDS PAGE analysis of purified designed carbonic anhydrase enzymes. M1-M4 shown in lanes 1-4, respectively, with molecular

Dissecting the role of H3K64me3 in mouse pericentromeric heterochromatin.

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)

Practical application of analytical tools for characterization of an impurity-related particle formation mechanism

Double charge of 33kD peak A1 A2 B1 B2 M2+ M/z. ABRF Proteomics Research Group - Qualitative Proteomics Study Identifier Number 14146

For the rapid, sensitive and accurate quantification of Ras in various samples

MagCapture Exosome Isolation Kit PS Q&A

Transcription:

Supplementary Materials Wild-type and mutant SOD1 share an aberrant conformation and a common pathogenic pathway in ALS Daryl A. Bosco, Gerardo Morfini, Murat Karabacak, Yuyu Song, Francois Gros-Louis, Piera Pasinelli, Holly Goolsby, Benjamin A. Fontaine, Nathan Lemay, Diane McKenna-Yasek, Matthew P. Frosch, Jeffery Agar, Jean-Pierre Julien, Scott Brady, and Robert H. Brown, Jr.

Supplementary Figure 1. The hydrogen peroxide-treated AS-SOD1 mutant is not recognized by the C4F6 antibody. The AS-SOD1 mutant, which contains both the C6A and C111S point-mutations, was exposed to hydrogen peroxide (H 2 O 2 ) as described for WT-SOD1 (Methods). (a) In contrast to WT- SOD1 (Fig. 1), there is no evidence of AS-SOD1 oxidation as a result of H 2 O 2 treatment in the mass spectra. The predominate species in the respective mass spectrum for untreated AS-SOD1 and AS-SOD1 exposed to H 2 O 2 (AS-SOD1ox) have similar masses (15,752.5 and 15,753.5 m/z). (b) The indicated recombinant human SOD1 proteins (10 µg/lane) were subjected to a native Western analysis as described in Figure 3. SOD1ox (formed by oxidation of WT- SOD1) and G93A are detected by the C4F6 monoclonal antibody (+C4F6), in agreement with Figure 3, whereas neither AS-SOD1 nor AS-SOD1ox are detected by C4F6 using Western-developing techniques with short (5 seconds) and relatively long (8.5 seconds) exposures. The low molecular weight band in the SOD1 G93A lane is likely a degradation product, which was also detected in the denaturing Western analysis in (d). In the absence of C4F6 antibody (- C4F6), there is no signal detected in the identical duplicate blots, thus demonstrating the lack of non-specific artifacts of the Western blotting techniques employed herein. (c) The native Western analysis described in (b) was performed with a rabbit anti-sod1 polyclonal antibody (Biodesign; 1:500), and demonstrates that the indicated proteins (3.75 µg/lane) are present in similar quantities. (d) The samples analyzed in b-c were diluted identically in SDSloading buffer and subjected to a denaturing Western analysis with a sheep anti- SOD1 polyclonal antibody (Calbiochem; 1:1,000), thus further demonstrating that the indicated proteins (10 ng/lane) are present in similar quantities.

Supplementary Figure 2. Extraction of insoluble SOD1 from mouse and human spinal cord tissue lysates. SOD1 G93A transgenic mice, which reportedly form SOD1 G93A aggregates, naïve mice, and human spinal cord (SpC) tissue samples were homogenized in detergent-free lysis buffer. The resulting insoluble-pellet was extensively washed and then extracted with SDS (see Methods). (a) An SDS-Western analysis for the final wash ( W ) of the insoluble pellet before extraction, and the extracted pellet ( Pel ) for SOD1 G93A transgenic (n=3; age=98 days) and naïve (n=3; age=110 days) mice. SOD1 is not detected in the wash samples, demonstrating that the SOD1 detected in the

extracted samples is due to the extraction process and not from insufficient washing. SOD1 G93A is extracted from the SpC tissue of the corresponding mouse model, whereas insoluble SOD is not detected from the extracted pellets derived from the naïve mice, indicating that this extraction procedure is capable of extracting insoluble SOD1 from animal tissues. (b) The same extraction protocol described in (a) was applied to insoluble pellets derived from frozen, end-stage human tissues from the indicated control and ALS cases. All cases contain some insoluble SOD1. Because the end-stage human tissues were frozen prior to the homogenation, and the resulting lysate pellets were frozen prior to the extraction, we cannot exclude that some level of insoluble protein may have resulted from the multiple freeze-thaw cycles. In contrast, the mouse tissue was isolated and immediately homogenized (Methods). (c) An independent experiment that is the same as (b) for the indicated cases. Note that the SALS1 and SALS4 cases are represented in both (a) and (b). (d) Densitometry of the insoluble SOD1 band is shown for the extractions performed in panels (b; solid bars) and (c; hatched bars). The results for SALS1 and SALS4 illustrate that the extraction protocol is reproducible between independent experiments. Although SALS1 and FALS2 cases contain the highest levels of insoluble SOD1, there is not a significant difference in the levels of insoluble SOD1 for the ALS versus control cases (n=4 cases for controls (C3,4,5,6) and SALS(SALS1,2,3,4); P=0.5 by the T-test, two-tailed).

Supplementary Figure 3. Immunohistochemistry of human spinal cord tissues with a commercial, polyclonal anti-sod1 antibody. Human paraffin spinal cord tissues (see Supplementary tables 2 and 3 for clinical and demographic information) from Figure 6 were stained with a commercial polyclonal antibody (Calbiochem; Methods). Dark arrows denote SOD1-positive cells.

Supplementary Table 1: Mass spectrometry analysis of SOD1 fragments resulting from electron capture dissociation (EDC) SOD1 amino acid sequence Modification status SOD1 residue at EDC cleaveage site Theoretical +1 mass of the peptide (z+1 ion) (monoisotopic) 1 Theoretical +1 mass +48Da (z+1 ion) (monoisotopic) 2 Observed mass (monoisotopic) Deviation of observedtheoretical 86-153 +3 ox N 6846.403 6894.388 6894.306-0.082 88-153 +3 ox T 6633.292 6681.277 6681.160-0.117 89-153 +3 ox A 6532.244 6580.229 6581.160 0.931 90-153 +3 ox D 6461.207 6509.192 6510.127 0.935 92-153 +3 ox D 6218.085 6266.070 6266.998 0.928 93-153 +3 ox G 6103.058 6151.043 6151.977 0.934 95-153 +3 ox A 5946.969 5994.953 5996.903 1.950 96-153 +3 ox D 5875.931 5923.916 5924.853 0.937 98-153 +3 ox S 5661.836 5709.821 5710.762 0.941 102-153 +3 ox S 5217.650 5265.635 5265.579-0.056 111-153* +3 ox C 4322.210 4370.195 4370.140-0.055 117-153* none L 3678.863 3726.848 3678.821-0.042 118-153 none V 3565.779 3613.764 3565.746-0.033 119-153 none V 3466.710 3514.695 3466.674-0.036 121-153 none E 3230.583 3278.568 3230.560-0.023 122-153 none K 3101.541 3149.525 3101.516-0.024 1 The theoretical mass of the indicated SOD1 peptide fragment, assuming there is no oxidation of the SOD1 amino acid side chains. 2 The theoretical mass of the indicated SOD1 peptide fragment, taking into account a potential 48Da increase in mass, which is observed in the FT-MS spectrum of SOD1ox (Fig. 1b). 1,2 Those masses in bold italics correspond to the actual observed mass detected in the experiment, within 1-2 Da. *The overlapping sequence in these peptides is 111-CIIGRTL-117, in which only C111 can undergo oxidation of +48 Da, thus forming sulfonic acid.

Supplementary Table 2: Clinical information pertaining to ALS patient tissues used in this study. Case number Sex Diagnosis Age at onset (years) Age at death (years) Duration of disease (months) Site of onset 1 Tissue source (analysis) 3 SALS1 M SALS 56.6 58 21 LE Paraffin (IHC); frozen (pellet extraction, motility assay) SALS2 M SALS 49 51 26 LE Paraffin (IHC); frozen (pellet extraction, motility assay) SALS3 M SALS 41.6 45 42 LE Paraffin (IHC); frozen (pellet extraction) SALS4 F SALS NA 2 65 NA NA Paraffin (IHC); frozen (pellet extraction, motility assay) SALS5 F SALS 64 69 21 UE Paraffin (IHC) SALS6 M SALS 57 62 63 UE Paraffin (IHC) SALS7 M SALS 28.2 37 59 UE Paraffin (IHC) SALS8 F SALS 58.5 65 78 LE Paraffin (IHC) SALS9 M SALS 56.7 59 29 UE Paraffin (IHC) FALS1 F FALS/ (SOD1 negative) FALS2 M FALS/ (SOD A4V) NA 54 NA NA Paraffin (IHC) 56.7 57 10 B & LE frozen (pellet extraction) 1 LE=lower extremity; UE=upper extremity; B=bulbar. 2 NA=information not available. 3 The indicated cases were used for immunohistochemistry analysis (IHC; Figure 6), extraction of insoluble SOD1 from tissue pellets (Supplementary Figure 2), and/or the squid motility assay (Figure 7).

Supplementary Table 3: Clinical information for control tissues used in this study. Case number Sex Age at death (years) Cause of death Control 1 F 60 End-stage renal disease; systemic lupus erythematosus (SLE) Tissue source (analysis) 3 Paraffin (IHC) Control 2 M 52 Hepatocellular carcinoma Paraffin (IHC) Control 3 M 93 NA 1 frozen (pellet extraction) Control 4 M 34 NA frozen (pellet extraction) Control 5 F 76 NA frozen (pellet extraction) Control 6 M 65 NA frozen (pellet extraction, motility assay) Control 7 M 24 NA Paraffin (IHC) Control 8 NA 42 Spinal cord tumor, Paraffin (IHC) pulmonary illness Control 9 NA 63 Heart illness Paraffin (IHC) Control 10 M 75 Gastrointestinal tumor Paraffin (IHC) Control 11 M 56 Heart illness Paraffin (IHC) Control 12 M 66 Heart illness Paraffin (IHC) Control 13 F 86 Pulmonary infection Paraffin (IHC) Control 14 M 68 Pulmonary infection, Paraffin (IHC) cancer, heart illness Control 15 F 64 Post-transplant Paraffin (IHC) lymphoproliferative disorder Control 16 F 44 Chronic obstructive Paraffin (IHC) pulmonary isease Control 17 M 9 months Krabbe s disease Paraffin (IHC) Control 18 F 50 Pneumonia Paraffin (IHC) Control 19 NA 49 Pneumonia Paraffin (IHC) Control 20 NA 56 Sarcoma of unknown Paraffin (IHC) origin Control 21 NA NA NA Paraffin (IHC) 1 NA=information not available. 2 The indicated cases were used for immunohistochemistry analysis (IHC; Figure 6), extraction of insoluble SOD1 from tissue pellets (Supplementary Figure 2), and/or the squid motility assay (Figure 7).