Supporting Information. Post translational Modifications of Serotonin Type 4 Receptor Heterologously Expressed in. Mouse Rod Cells

Size: px
Start display at page:

Download "Supporting Information. Post translational Modifications of Serotonin Type 4 Receptor Heterologously Expressed in. Mouse Rod Cells"

Transcription

1 Supporting Information Post translational Modifications of Serotonin Type 4 Receptor Heterologously Expressed in Mouse Rod Cells David Salom,, Benlian Wang,, Zhiqian Dong, Wenyu Sun, Pius Padayatti, Steven Jordan #, John A. Salon # and Krzysztof Palczewski, * Polgenix Inc., Cleveland, Ohio 44106, USA; Department of Pharmacology and Center for Proteomics and Bioinformatics, School of Medicine, Case Western Reserve University, Cleveland, Ohio 44106, USA; and # Department of Molecular Structure, Amgen Incorporated, Thousand Oaks, CA , USA. These authors contributed equally to this work. * To whom correspondence should be addressed: Krzysztof Palczewski, Ph.D. Phone: (216) Fax: (216) E mail: kxp65@case.edu 1

2 Supplementary Figures and Legends Figure S1. Size exclusion chromatographic profile (on a Superdex 200 column) of 5 HT 4 R immuno-affinity purified from mouse rod photoreceptor cells. 2

3 Figure S2. 5 HT 4 R expressed in different systems (TRex cells, insect Sf9 cells and HEK293 cells) separated by SDS PAGE and identified by 1D4 immunoblotting. Treatment with PNGase F (plus sign at bottom) removed glycosyl residues, yielding a deglycosylated 5 HT 4 R monomer (arrows). 3

4 Figure S3. Mass spectrometry coverage of 5 HT 4 R from transgenic mice treated with trypsin (red) or chymotrypsin (blue). Sequence coverage for glycosylated 5 HT 4 R (A) and deglycosylated 5 HT 4 R (B) is shown. A 1 MDKLDANVSS EEGFGSVEKV VLLTFLSTVI LMAILGNLLV MVAVCWDRQL 51 RKIKTNYFIV SLAFADLLVS VLVMPFGAIE LVQDIWIYGE VFCLVRTSLD 101 VLLTTASIFH LCCISLDRYY AICCQPLVYR NKMTPLRIAL MLGGCWVIPT 151 FISFLPIMQG WNNIGIIDLI EKRKFNQNSN STYCVFMVNK PYAITCSVVA 201 FYIPFLLMVL AYYRIYVTAK EHAHQIQMLQ RAGASSESRP QSADQHSTHR 251 MRTETKAAKT LCIIMGCFCL CWAPFFVTNI VDPFIDYTVP GQVWTAFLWL 301 GYINSGLNPF LYAFLNKSFR RAFLIILCCD DERYRRPSIL GQTVPCSTTT 351 INGSTHVLRD AVECGGQWES QCHPPATSPL VAAQPSDT B 1 MDKLDANVSS EEGFGSVEKV VLLTFLSTVI LMAILGNLLV MVAVCWDRQL 51 RKIKTNYFIV SLAFADLLVS VLVMPFGAIE LVQDIWIYGE VFCLVRTSLD 101 VLLTTASIFH LCCISLDRYY AICCQPLVYR NKMTPLRIAL MLGGCWVIPT 151 FISFLPIMQG WNNIGIIDLI EKRKFNQNSN STYCVFMVNK PYAITCSVVA 201 FYIPFLLMVL AYYRIYVTAK EHAHQIQMLQ RAGASSESRP QSADQHSTHR 251 MRTETKAAKT LCIIMGCFCL CWAPFFVTNI VDPFIDYTVP GQVWTAFLWL 301 GYINSGLNPF LYAFLNKSFR RAFLIILCCD DERYRRPSIL GQTVPCSTTT 351 INGSTHVLRD AVECGGQWES QCHPPATSPL VAAQPSDT 4

5 Figure S4. Tandem mass spectra of two glycopeptides from 5 HT 4 R expressed in mouse rod cells. (A) Tryptic glycopeptide 4 LDANVSSEEGFGSVEK 19 with m/z of (2+). (B) Chymotryptic glycopeptide 176 NQNSNSTYCVF 186 with m/z of (3+). Collision induced dissociation of attached oligosaccharides allowed manual interpretation of the polysaccharide composition. 5

6 6

7 Figure S5. GPCR expression in rod cells of transgenic mice yields homogenously glycosylated, well behaved receptor. The major band in each lane corresponds to cannabinoid receptor 2 (A), adenosine A1 receptor (B), and 5 HT 2C R, 5 HT 7 R (C). Purified receptors CB 2 R and A A1 R were separated by SDS PAGE and visualized after silver staining (A,B). DDM extracts of retinas from mice expressing 5 HT 2C R or 5 HT 7 R were subjected to SDS PAGE and analyzed by 1D4 immuno-blotting (C). 7

8 Figure S6. Rhodopsin expressed in two different mammalian expression systems (HEK293 cells and NIH 3T3 cells) was solubilized with DDM, separated by SDS PAGE and developed by 1D4 immunoblotting. An aliquot from each sample was treated with PNGase F (plus sign at bottom). Arrow indicates deglycosylated rhodopsin monomer. 8

9 Figure S7. Dephosphorylation of 5 HT 4 R expressed in mouse rod cells with protein phosphatase PP2A at 4 C. Three different dilutions of purified of 5 HT 4 R (lanes 1 3) and PP2A treated 5 HT 4 R (lanes 4-6) were resolved on a SDS PAGE gel, stained with the phosphoprotein stain ProQ Diamond and imaged with Typhoon Trio (GE Healthcare) with excitation at 532 nm and emission at 580 ± 30 nm (A). After fluorescent imaging, the same gel was silver stained (B). Monomer band intensities for each type of staining are plotted in panel C, with closed circles for non treated 5 HT 4 R and open circles for PP2A treated 5 HT 4 R. Numbers in the plot correspond to the lanes in panels A and B. Note that the band intensity ratio of phospho stained/silver stained is significantly lower after PP2A treatment. Residual phospho staining after PP2A treatment may be due to non-specific staining or incomplete dephosphorylation. Arrow designates the diglycosylated 5 HT 4 R monomer band. 9

10 10

11 Figure S8. Tandem mass spectra of mouse-expressed 5 HT 4 R peptide 232 AGASSESRPQSADQHSTHR 250 suggests phosphorylation of residues S 235 (A), S 235 and S 242 (B), S 235, S 236 and S 242 (C), and S 235, S 236, S 238 and S 242 (D). The parent ions for each phosphoform are (3+), (3+), (3+) and (3+), respectively. The modified residues are showed in red. 11

12 12

13 13

14 14

Post-Translational Modifications of the Serotonin Type 4 Receptor Heterologously Expressed in Mouse Rod Cells

Post-Translational Modifications of the Serotonin Type 4 Receptor Heterologously Expressed in Mouse Rod Cells pubs.acs.org/biochemistry Post-Translational Modifications of the Serotonin Type 4 Receptor Heterologously Expressed in Mouse Rod Cells David Salom, Benlian Wang, Zhiqian Dong, Wenyu Sun, Pius Padayatti,

More information

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis

More information

SUNY UPSTATE MEDICAL UNIVERSITY PROTEOMICS CORE

SUNY UPSTATE MEDICAL UNIVERSITY PROTEOMICS CORE SUNY UPSTATE MEDICAL UNIVERSITY PROTEOMICS CORE Location: SUNY Upstate Medical University Weiskotten Hall Addition, Room 4303 750 East Adams Street Syracuse, NY 13210 Contact Information: David Kakhniashvili,

More information

Tivadar Orban, Beata Jastrzebska, Sayan Gupta, Benlian Wang, Masaru Miyagi, Mark R. Chance, and Krzysztof Palczewski

Tivadar Orban, Beata Jastrzebska, Sayan Gupta, Benlian Wang, Masaru Miyagi, Mark R. Chance, and Krzysztof Palczewski Structure, Volume Supplemental Information Conformational Dynamics of Activation for the Pentameric Complex of Dimeric G Protein-Coupled Receptor and Heterotrimeric G Protein Tivadar Orban, Beata Jastrzebska,

More information

TECHNICAL BULLETIN. R 2 GlcNAcβ1 4GlcNAcβ1 Asn

TECHNICAL BULLETIN. R 2 GlcNAcβ1 4GlcNAcβ1 Asn GlycoProfile II Enzymatic In-Solution N-Deglycosylation Kit Product Code PP0201 Storage Temperature 2 8 C TECHNICAL BULLETIN Product Description Glycosylation is one of the most common posttranslational

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan

More information

Supporting Information

Supporting Information Supporting Information Palczewska et al. 10.1073/pnas.1410162111 SI Methods Bleaching of Rhodopsin Crystals. Trigonal crystals of ground-state bovine rhodopsin were grown as previously described (1, 2).

More information

Improve Protein Analysis with the New, Mass Spectrometry- Compatible ProteasMAX Surfactant

Improve Protein Analysis with the New, Mass Spectrometry- Compatible ProteasMAX Surfactant Improve Protein Analysis with the New, Mass Spectrometry- Compatible Surfactant ABSTRACT Incomplete solubilization and digestion and poor peptide recovery are frequent limitations in protein sample preparation

More information

ALLOSTERIC REGULATION OF GPCR ACTIVITY BY PHOSPHOLIPIDS

ALLOSTERIC REGULATION OF GPCR ACTIVITY BY PHOSPHOLIPIDS Supplementary Information ALLOSTERIC REGULATION OF GPCR ACTIVITY BY PHOSPHOLIPIDS Rosie Dawaliby 1, Cataldo Trubbia 1, Cédric Delporte 3,4, Matthieu Masureel 2, Pierre Van Antwerpen 3,4, Brian K. Kobilka

More information

B. SDS-PAGE. Western blot MW (kda) Supplementary Information. Supplementary Figure 1. MW (kda) Glutelin. Prolamin. 3 E.coli. 3 E.

B. SDS-PAGE. Western blot MW (kda) Supplementary Information. Supplementary Figure 1. MW (kda) Glutelin. Prolamin. 3 E.coli. 3 E. Supplementary Information Supplementary Figure 1. A. MW (kda) B. SDS-PAGE Western blot MW (kda) 50 40 100 75 50 37 30 Glutelin 25 20 15 20 Prolamin 10 ARP1 1 2 3 E.coli MucoRice ARP1 (RNAi +) 4 5 ARP1

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1

More information

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin

More information

Supplementary Information

Supplementary Information Supplementary Information Figure S1. Int6 gene silencing efficiency. (A) Western Blot analysis of Int6 expression at different times after sirna transfection. Int6 expression is strongly silenced in Int6

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed

More information

PTM Discovery Method for Automated Identification and Sequencing of Phosphopeptides Using the Q TRAP LC/MS/MS System

PTM Discovery Method for Automated Identification and Sequencing of Phosphopeptides Using the Q TRAP LC/MS/MS System Application Note LC/MS PTM Discovery Method for Automated Identification and Sequencing of Phosphopeptides Using the Q TRAP LC/MS/MS System Purpose This application note describes an automated workflow

More information

Supplementary Materials. Wild-type and mutant SOD1 share an aberrant conformation and

Supplementary Materials. Wild-type and mutant SOD1 share an aberrant conformation and Supplementary Materials Wild-type and mutant SOD1 share an aberrant conformation and a common pathogenic pathway in ALS Daryl A. Bosco, Gerardo Morfini, Murat Karabacak, Yuyu Song, Francois Gros-Louis,

More information

Nature Methods: doi: /nmeth.3177

Nature Methods: doi: /nmeth.3177 Supplementary Figure 1 Characterization of LysargiNase, trypsin and LysN missed cleavages. (a) Proportion of peptides identified in LysargiNase and trypsin digests of MDA-MB-231 cell lysates carrying 0,

More information

Dramatic increase in SHP2 binding activity of Helicobacter. pylori Western CagA by EPIYA-C duplication: its

Dramatic increase in SHP2 binding activity of Helicobacter. pylori Western CagA by EPIYA-C duplication: its Supplementary Information Dramatic increase in SHP2 binding activity of Helicobacter pylori Western CagA by EPIYA-C duplication: its implications in gastric carcinogenesis Lisa Nagase, Takeru Hayashi,

More information

Protein Identification and Phosphorylation Site Determination by de novo sequencing using PepFrag TM MALDI-Sequencing kit

Protein Identification and Phosphorylation Site Determination by de novo sequencing using PepFrag TM MALDI-Sequencing kit Application Note Tel: +82-54-223-2463 Fax : +82-54-223-2460 http://www.genomine.com venture ldg 306 Pohang techno park Pohang, kyungbuk, Korea(ROK) Protein Identification and Phosphorylation Site Determination

More information

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion

More information

on Non-Consensus Protein Motifs Analytical & Formulation Sciences, Amgen. Seattle, WA

on Non-Consensus Protein Motifs Analytical & Formulation Sciences, Amgen. Seattle, WA N-Linked Glycosylation on Non-Consensus Protein Motifs Alain Balland Analytical & Formulation Sciences, Amgen. Seattle, WA CASSS - Mass Spec 2010 Marina Del Rey, CA. September 8 th, 2010 Outline 2 Consensus

More information

Trypsin Mass Spectrometry Grade

Trypsin Mass Spectrometry Grade 058PR-03 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Trypsin Mass Spectrometry Grade A Chemically Modified, TPCK treated, Affinity Purified

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1

Nature Biotechnology: doi: /nbt Supplementary Figure 1 Supplementary Figure 1 The timeline of the NGAG method for extraction of N-linked glycans and glycosite-containing peptides. The timeline can be changed based on the number of samples. Supplementary Figure

More information

Structural Characterization of Prion-like Conformational Changes of the Neuronal Isoform of Aplysia CPEB

Structural Characterization of Prion-like Conformational Changes of the Neuronal Isoform of Aplysia CPEB Structural Characterization of Prion-like Conformational Changes of the Neuronal Isoform of Aplysia CPEB Bindu L. Raveendra, 1,5 Ansgar B. Siemer, 2,6 Sathyanarayanan V. Puthanveettil, 1,3,7 Wayne A. Hendrickson,

More information

Doubly Phosphorylated Peptide Vaccines to Protect Transgenic P301S Mice against Alzheimer s Disease Like Tau Aggregation

Doubly Phosphorylated Peptide Vaccines to Protect Transgenic P301S Mice against Alzheimer s Disease Like Tau Aggregation , 1-11 manuscripts; doi:10.3390/vaccines20x000x Article OPEN ACCESS vaccines ISSN 2076-393X www.mdpi.com/journal/vaccines Doubly Phosphorylated Peptide Vaccines to Protect Transgenic P301S Mice against

More information

SUPPLEMENTAL INFORMATION

SUPPLEMENTAL INFORMATION SUPPLEMENTAL INFORMATION EXPERIMENTAL PROCEDURES Tryptic digestion protection experiments - PCSK9 with Ab-3D5 (1:1 molar ratio) in 50 mm Tris, ph 8.0, 150 mm NaCl was incubated overnight at 4 o C. The

More information

RayBio KinaseSTAR TM Akt Activity Assay Kit

RayBio KinaseSTAR TM Akt Activity Assay Kit Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll

More information

Development of a Human Cell-Free Expression System to Generate Stable-Isotope-Labeled Protein Standards for Quantitative Mass Spectrometry

Development of a Human Cell-Free Expression System to Generate Stable-Isotope-Labeled Protein Standards for Quantitative Mass Spectrometry Development of a Human Cell-Free Expression System to Generate Stable-Isotope-Labeled Protein Standards for Quantitative Mass Spectrometry Ryan D. omgarden 1, Derek aerenwald 2, Eric Hommema 1, Scott Peterman

More information

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated

More information

Double charge of 33kD peak A1 A2 B1 B2 M2+ M/z. ABRF Proteomics Research Group - Qualitative Proteomics Study Identifier Number 14146

Double charge of 33kD peak A1 A2 B1 B2 M2+ M/z. ABRF Proteomics Research Group - Qualitative Proteomics Study Identifier Number 14146 Abstract The 2008 ABRF Proteomics Research Group Study offers participants the chance to participate in an anonymous study to identify qualitative differences between two protein preparations. We used

More information

Supporting Information. Lysine Propionylation to Boost Proteome Sequence. Coverage and Enable a Silent SILAC Strategy for

Supporting Information. Lysine Propionylation to Boost Proteome Sequence. Coverage and Enable a Silent SILAC Strategy for Supporting Information Lysine Propionylation to Boost Proteome Sequence Coverage and Enable a Silent SILAC Strategy for Relative Protein Quantification Christoph U. Schräder 1, Shaun Moore 1,2, Aaron A.

More information

Nature Methods: doi: /nmeth Supplementary Figure 1

Nature Methods: doi: /nmeth Supplementary Figure 1 Supplementary Figure 1 Subtiligase-catalyzed ligations with ubiquitin thioesters and 10-mer biotinylated peptides. (a) General scheme for ligations between ubiquitin thioesters and 10-mer, biotinylated

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/3/114/ra23/dc1 Supplementary Materials for Regulation of Zap70 Expression During Thymocyte Development Enables Temporal Separation of CD4 and CD8 Repertoire Selection

More information

Glycosylation analysis of blood plasma proteins

Glycosylation analysis of blood plasma proteins Glycosylation analysis of blood plasma proteins Thesis booklet Eszter Tóth Doctoral School of Pharmaceutical Sciences Semmelweis University Supervisor: Károly Vékey DSc Official reviewers: Borbála Dalmadiné

More information

Supplementary Information

Supplementary Information Supplementary Information High-yield cell-free synthesis of human EGFR by IRES-mediated protein translation in a continuous exchange cell-free reaction format Authors Robert B. Quast, Andrei Sonnabend,

More information

Phosphorylation of proteins Steve Barnes Feb 19th, 2002 in some cases, proteins are found in a stable, hyperphosphorylated state, e.g.

Phosphorylation of proteins Steve Barnes Feb 19th, 2002 in some cases, proteins are found in a stable, hyperphosphorylated state, e.g. Phosphorylation of proteins Steve Barnes Feb 19th, 2002 in some cases, proteins are found in a stable, hyperphosphorylated state, e.g., casein more interestingly, in most other cases, it is a transient

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Design of isolated protein and RNC constructs, and homogeneity of purified RNCs. (a) Schematic depicting the design and nomenclature used for all the isolated proteins and RNCs used

More information

Glycosylation analyses of recombinant proteins by LC-ESI mass spectrometry

Glycosylation analyses of recombinant proteins by LC-ESI mass spectrometry Glycosylation analyses of recombinant proteins by LC-ESI mass spectrometry Dr Malin Bäckström Mammalian Protein Expression Core Facility P4EU meeting Porto Nov 11-12, 2013 MPE - A tissue culture facility

More information

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% FIGURE LEGENDS Supplementary Fig 1 (A) sumoylation pattern detected under denaturing condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% SDS in the presence and absence

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/278/rs11/dc1 Supplementary Materials for In Vivo Phosphoproteomics Analysis Reveals the Cardiac Targets of β-adrenergic Receptor Signaling Alicia Lundby,* Martin

More information

Lane: 1. Spectra BR protein ladder 2. PFD 3. TERM 4. 3-way connector 5. 2-way connector

Lane: 1. Spectra BR protein ladder 2. PFD 3. TERM 4. 3-way connector 5. 2-way connector kda 1 2 3 4 5 26 14 1 7 Lane: 1. Spectra BR protein ladder 2. PFD 3. TERM 4. 3-way connector 5. 2-way connector 5 4 35 25 15 1 Supplementary Figure 1. SDS-PAGE of acterially expressed and purified proteins.

More information

Protein sequence mapping is commonly used to

Protein sequence mapping is commonly used to Reproducible Microwave-Assisted Acid Hydrolysis of Proteins Using a Household Microwave Oven and Its Combination with LC-ESI MS/MS for Mapping Protein Sequences and Modifications Nan Wang and Liang Li

More information

Alpha-Tubulin Housekeeping 10,000 tests

Alpha-Tubulin Housekeeping 10,000 tests Headquarters & Europe Office Cisbio Bioassays Phone: +33 (0)4 66 79 67 05 Fax: +33 (0)4 66 79 19 20 bioassays@cisbio.com cisbio_dd_pi_64atubpeh USA Office Cisbio US, Inc. Phone: +1 888 963 4567 Fax: +1

More information

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Experimental design and workflow utilized to generate the WMG Protein Atlas.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Experimental design and workflow utilized to generate the WMG Protein Atlas. Supplementary Figure 1 Experimental design and workflow utilized to generate the WMG Protein Atlas. (a) Illustration of the plant organs and nodule infection time points analyzed. (b) Proteomic workflow

More information

Combination of 2-D Gel and Liquid-Phase Electrophoretic Separations as Proteomic Tools in Neuroscience. Analytical 2-D. Electrophoresis.

Combination of 2-D Gel and Liquid-Phase Electrophoretic Separations as Proteomic Tools in Neuroscience. Analytical 2-D. Electrophoresis. electrophoresis tech note 2859 Combination of 2-D Gel and Liquid-Phase Electrophoretic Separations as Proteomic Tools in Neuroscience Pia Davidsson, Department of Clinical Neuroscience, Experimental Neuroscience

More information

Chemical Biology, Option II Mechanism Based Proteomic Tagging Case History CH1

Chemical Biology, Option II Mechanism Based Proteomic Tagging Case History CH1 Proteome Wide Screening of Serine Protease Activity Proc Natl Acad Sci 1999, 97, 14694; Proteomics 2001, 1, 1067; Proc Natl Acad Sci 2002, 99, 10335; Biochemistry 2001, 40, 4005; J. Am. Chem. Soc., 2005,

More information

Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis

Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis Supplementary information Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis Yasuyuki Yamada, Fumihiko Sato

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

Supplementary Figures

Supplementary Figures Supplementary Figures a b c d PDI activity in % ERp72 activity in % 4 3 2 1 1 1 ERp activity in % e ΔRFU min -1 1 1 ERp7 activity in % 1 1 Supplementary Figure 1. Selectivity of the bepristat-mediated

More information

2D protein gel analysis tool for studying the protein phosphorylation changes associated with contraction and relaxation of vascular smooth muscle

2D protein gel analysis tool for studying the protein phosphorylation changes associated with contraction and relaxation of vascular smooth muscle 2D protein gel analysis tool for studying the protein phosphorylation changes associated with contraction and relaxation of vascular smooth muscle Internship details Where: Department of Bioengineering

More information

Molecular Cell, Volume 46. Supplemental Information

Molecular Cell, Volume 46. Supplemental Information Molecular Cell, Volume 46 Supplemental Information Mapping N-Glycosylation Sites across Seven Evolutionary Distant Species Reveals a Divergent Substrate Proteome Despite a Common Core Machinery Dorota

More information

Mass Spectrometry and Proteomics - Lecture 4 - Matthias Trost Newcastle University

Mass Spectrometry and Proteomics - Lecture 4 - Matthias Trost Newcastle University Mass Spectrometry and Proteomics - Lecture 4 - Matthias Trost Newcastle University matthias.trost@ncl.ac.uk previously Peptide fragmentation Hybrid instruments 117 The Building Blocks of Life DNA RNA Proteins

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Isolation of mt-trnas and RNA-MS analysis of mt-trna Asn from M. nudus (a)m. nudus mt-trnas were isolated by RCC and resolved by 10% denaturing PAGE. The gel was stained with SYBR

More information

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)

More information

Nature Biotechnology: doi: /nbt.3828

Nature Biotechnology: doi: /nbt.3828 Supplementary Figure 1 Development of a FRET-based MCS. (a) Linker and MA2 modification are indicated by single letter amino acid code. indicates deletion of amino acids and N or C indicate the terminus

More information

Application Note # ET-17 / MT-99 Characterization of the N-glycosylation Pattern of Antibodies by ESI - and MALDI mass spectrometry

Application Note # ET-17 / MT-99 Characterization of the N-glycosylation Pattern of Antibodies by ESI - and MALDI mass spectrometry Bruker Daltonics Application Note # ET-17 / MT-99 Characterization of the N-glycosylation Pattern of Antibodies by ESI - and MALDI mass spectrometry Abstract Analysis of the N-glycosylation pattern on

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1. Neither the activation nor suppression of the MAPK pathway affects the ASK1/Vif interaction. (a, b) HEK293 cells were cotransfected with plasmids encoding

More information

Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random

Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random S1 Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random Conical Tilt (RCT) reconstruction (left: -50,right:

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure 1: immunoprecipitation with anti-casr antibody The Casr protein was expressed in transiently transfected HEK cells. Cell lysates from HEK cells were subjected

More information

Supplementary Figures and Notes for Digestion and depletion of abundant

Supplementary Figures and Notes for Digestion and depletion of abundant Supplementary Figures and Notes for Digestion and depletion of abundant proteins improves proteomic coverage Bryan R. Fonslow, Benjamin D. Stein, Kristofor J. Webb, Tao Xu, Jeong Choi, Sung Kyu Park, and

More information

Mammalian-type Glycosylation l in LEXSY

Mammalian-type Glycosylation l in LEXSY Mammalian-type Glycosylation l in LEXSY Case Study: Recombinant hu Erythropoietin Jena Bioscience GmbH Loebstedter Str. 80 07749 Jena, Germany Tel.: +49-3641-628-5000 Fax: +49-3641-628-5100 628 e-mail:

More information

Supplementary Information

Supplementary Information Supplementary Information Site-specific incorporation of phosphotyrosine using an expanded genetic code Christian Hoppmann, 1 Allison Wong, 2 Bing Yang, 1 Shuwei Li, 3 Tony Hunter, 4 Kevan M. Shokat 2

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10962 Supplementary Figure 1. Expression of AvrAC-FLAG in protoplasts. Total protein extracted from protoplasts described in Fig. 1a was subjected to anti-flag immunoblot to detect AvrAC-FLAG

More information

Enzymatic Removal of N- and O-glycans using PNGase F or the Protein Deglycosylation Mix

Enzymatic Removal of N- and O-glycans using PNGase F or the Protein Deglycosylation Mix be INSPIRED drive DISCOVERY stay GENUINE APPLICATION NOTE Enzymatic Removal of N- and O-glycans using PNGase F or the Protein Deglycosylation Mix Alicia Bielik and Paula Magnelli, New England Biolabs,

More information

ProteaseMAX Surfactant, Trypsin Enhancer

ProteaseMAX Surfactant, Trypsin Enhancer Technical Bulletin ProteaseMAX Surfactant, Trypsin Enhancer INSTRUCTIONS FOR USE OF PRODUCTS V2071 AND V2072. PRINTED IN USA. Revised 1/10 ProteaseMAX Surfactant, Trypsin Enhancer All technical literature

More information

Supplemental Data. Supplemental Text

Supplemental Data. Supplemental Text Supplemental Data The magnitude of the light-induced conformational change in different rhodopsins correlates with their ability to activate G proteins. Hisao Tsukamoto, David L. Farrens, Mitsumasa Koyanagi

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

Expression constructs

Expression constructs Gene expressed in bebe3 ZmBEa Expression constructs 35S ZmBEa Pnos:Hygromycin r 35S Pnos:Hygromycin r 35S ctp YFP Pnos:Hygromycin r B -1 Chl YFP- Merge Supplemental Figure S1: Constructs Used for the Expression

More information

Supplemental information

Supplemental information Supplemental information Activity of the purified plant ABC transporter NtPDR1 is stimulated by diterpenes and sesquiterpenes involved in constitutive and induced defenses Baptiste Pierman ǂ1, Frédéric

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/2/4/e1500980/dc1 Supplementary Materials for The crystal structure of human dopamine -hydroxylase at 2.9 Å resolution Trine V. Vendelboe, Pernille Harris, Yuguang

More information

TECHNICAL BULLETIN. PhosDecor Fluorescent Phosphoprotein In-Gel Detection Kit. Catalog Number PDECOR Storage Temperature 2 8 C

TECHNICAL BULLETIN. PhosDecor Fluorescent Phosphoprotein In-Gel Detection Kit. Catalog Number PDECOR Storage Temperature 2 8 C PhosDecor Fluorescent Phosphoprotein In-Gel Detection Kit Catalog Number PDECOR Storage Temperature 2 8 C TECHNICAL BULLETIN Product Description Phosphorylation is an important covalent posttranslational

More information

Figure S6. A-J) Annotated UVPD mass spectra for top ten peptides found among the peptides identified by Byonic but not SEQUEST + Percolator.

Figure S6. A-J) Annotated UVPD mass spectra for top ten peptides found among the peptides identified by Byonic but not SEQUEST + Percolator. Extending Proteome Coverage by Combining MS/MS Methods and a Modified Bioinformatics Platform adapted for Database Searching of Positive and Negative Polarity 193 nm Ultraviolet Photodissociation Mass

More information

New Instruments and Services

New Instruments and Services New Instruments and Services Liwen Zhang Mass Spectrometry and Proteomics Facility The Ohio State University Summer Workshop 2016 Thermo Orbitrap Fusion http://planetorbitrap.com/orbitrap fusion Thermo

More information

O-Glycosylation of Transcription Factor BCL11b: Truth or Myth?

O-Glycosylation of Transcription Factor BCL11b: Truth or Myth? O-Glycosylation of Transcription Factor BCL11b: Truth or Myth? Elizabeth Pendergrass Dr. Theresa Filtz Dept Of Pharmaceutical Sciences College Of Pharmacy Oregon State University T-cell Leukemia T-cell

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,

More information

Human SH-SY5Y neuroblastoma cells (A.T.C.C., Manassas, VA) were cultured in DMEM, F-12

Human SH-SY5Y neuroblastoma cells (A.T.C.C., Manassas, VA) were cultured in DMEM, F-12 SUPPLEMENTARY METHODS Cell cultures Human SH-SY5Y neuroblastoma cells (A.T.C.C., Manassas, VA) were cultured in DMEM, F-12 Ham with 25 mm HEPES and NaHCO 3 (1:1) and supplemented with 10% (v/v) FBS, 1.0

More information

Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with

Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with Coomassie brilliant blue. One µg/ml recombinant human (rh) apo-e

More information

PNGase F Instruction Manual

PNGase F Instruction Manual PNGase F Instruction Manual Catalog Number 170-6883 Bio-Rad Laboratories, 2000 Alfred Nobel Dr., Hercules, CA 94547 4006094 Rev A Table of Contents Section 1 Introduction...1 Section 2 Kit Components and

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information)

BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information) BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information) David Dankort, David P. Curley, Robert A. Cartlidge, Betsy Nelson, Anthony N. Karnezis,

More information

Section 1 Proteins and Proteomics

Section 1 Proteins and Proteomics Section 1 Proteins and Proteomics Learning Objectives At the end of this assignment, you should be able to: 1. Draw the chemical structure of an amino acid and small peptide. 2. Describe the difference

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Mass Spectrometry at the Laboratory of Food Chemistry. Edwin Bakx Laboratory of Food Chemistry Wageningen University

Mass Spectrometry at the Laboratory of Food Chemistry. Edwin Bakx Laboratory of Food Chemistry Wageningen University Mass Spectrometry at the Wageningen University Mass Spectrometry at the 3 UPLC/CE - ESI - Ion trap MS systems UPLC Thermo Acella with a Velos or VelosPro CE Beckman PA800 with a Thermo VelosPro 1 UPLC-

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains

More information

Mass Spectrometry. Mass spectrometer MALDI-TOF ESI/MS/MS. Basic components. Ionization source Mass analyzer Detector

Mass Spectrometry. Mass spectrometer MALDI-TOF ESI/MS/MS. Basic components. Ionization source Mass analyzer Detector Mass Spectrometry MALDI-TOF ESI/MS/MS Mass spectrometer Basic components Ionization source Mass analyzer Detector 1 Principles of Mass Spectrometry Proteins are separated by mass to charge ratio (limit

More information

Profiling of Histone Post-translational Modifications in Mouse Brain with High Resolution Top Down Mass Spectrometry

Profiling of Histone Post-translational Modifications in Mouse Brain with High Resolution Top Down Mass Spectrometry Profiling of Histone Post-translational Modifications in Mouse Brain with High Resolution Top Down Mass Spectrometry Mowei Zhou, Ljiljana Paša-Tolić, and David L. Stenoien Supporting Information: Figure

More information

SUPPLEMENTAL FIGURE LEGENDS

SUPPLEMENTAL FIGURE LEGENDS SUPPLEMENTAL FIGURE LEGENDS Fig. S1. SDSPAGE of crosslinked Aβ42 oligomers after SEC. After crosslinking of Aβ42 with or without Myr or RA, APS and Ru(bpy) were removed by SEC. The resulting products were

More information

Agilent Protein In-Gel Tryptic Digestion Kit

Agilent Protein In-Gel Tryptic Digestion Kit Agilent 5188-2749 Protein In-Gel Tryptic Digestion Kit Agilent Protein In-Gel Tryptic Digestion Kit Instructions Kit Contents The Protein In-Gel Tryptic Digestion Kit includes sufficient reagents for approximately

More information

Myelin suppresses axon regeneration by PIR-B/SHPmediated inhibition of Trk activity

Myelin suppresses axon regeneration by PIR-B/SHPmediated inhibition of Trk activity Manuscript EMBO-2010-76298 Myelin suppresses axon regeneration by PIR-B/SHPmediated inhibition of Trk activity Yuki Fujita, Shota Endo, Toshiyuki Takai and Toshihide Yamashita Corresponding author: Toshihide

More information

Supplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration

Supplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration Supplementary Materials for c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration Saurav Brahmachari, Preston Ge, Su Hyun Lee, Donghoon Kim, Senthilkumar S. Karuppagounder, Manoj

More information

DetergentOUT Tween. DetergentOUT GBS10. OrgoSol DetergentOUT

DetergentOUT Tween. DetergentOUT GBS10. OrgoSol DetergentOUT 252PR 01 G-Biosciences, St Louis, MO. USA 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name DetergentOUT Detergent Removal Systems For the Removal of Detergents

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding

More information

SUPPORTING INFORMATION. Multimodal Mass Spectrometry Imaging of N-glycans and Proteins from the Same

SUPPORTING INFORMATION. Multimodal Mass Spectrometry Imaging of N-glycans and Proteins from the Same SUPPORTING INFORMATION Multimodal Mass Spectrometry Imaging of N-glycans and Proteins from the Same Tissue Section. Bram Heijs 1, Stephanie Holst 1, Inge H. Briaire-de Bruijn 2, Gabi W. van Pelt 3, Arnoud

More information

Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.

Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William

More information

NF-κB p65 (Phospho-Thr254)

NF-κB p65 (Phospho-Thr254) Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 NF-κB p65 (Phospho-Thr254) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02015 Please read the provided manual

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in

More information