Liu et l. Cell Communiction nd Signling (2018) 16:10 https://doi.org/10.1186/s12964-018-0223-4 RESEARCH Open Access Rs enhnces TGF-β signling y decresing cellulr protein levels of its type II receptor negtive regultor SPSB1 Sheng Liu 1, Josephine Iri 1, Richrd J. Simpson 2 nd Hong-Jin Zhu 1* Astrct Bckground: Trnsformtion y oncogene Rs overcomes TGF-β medited growth inhiition in epithelil cells. However, it coopertes with ech other to medite epithelil to mesenchyml trnsition (EMT). The mechnism of how these two pthwys interct with ech other is controversil. Methods: Moleculr techniques were used to engineer expression plsmids for Rs, SPRY, TGF-β receptors, type I nd II nd uiquitin. Immunoprecipittion nd western lots were employed to determine protein-protein interctions, preotein levels, protein phosphoryltion while immunofluorecesent stining for moleculr co-locliztion. TGF-β signlling ctivities is lso determined y its luciferse reporter ssy. Trns-well ssys were used to mesure cell migrtion nd invsion. Results: Rs intercts with the SPSB1 s SPRY domin to enhnce TGF-β signling. Rs intercts nd coloclizes with the TGF-β type II receptor s (TβRII) negtive regultor SPSB1 on the cell memrne, consequently promoting SPSB1 protein degrdtion vi enhnced mono- nd di-uiquitintion. Reduced SPSB1 levels result in the stliztion of TβRII, in turn the increse of receptor levels significntly enhnce Smd2/3 phosphoryltion nd signling. Importntly, forced expression of SPSB1 in Rs trnsformed cells suppresses TGF-β signling nd its medited migrtion nd invsion. Conclusion: Rs positively coopertes with TGF-β signling y reducing the cellulr protein levels of TβRII negtive regultor SPSB1. Keywords: Rs, SPSB1, TGF-β signling Bckground TGF-β regultes plethor of cellulr processes including cell prolifertion, differentition, migrtion, orgniztion nd deth [1]. As one of the most potent inhiitors of norml cell growth, the loss of growth inhiitory responses to TGF-β is often oserved in cncer cells [2, 3]. It is widely ccepted tht TGF-β is tumor suppressor, given the frequent occurrence of mny types of tumors in mice with disruptions of TGF-β signling components y gene trgeting nd mny types of humn cncers contining lossof-function muttion of TGF-β signling components [4]. In spite of the tumor suppressor ctivity of TGF-β, the mjority of humn tumors hve not suffered loss-of * Correspondence: hongjin@unimel.edu.u 1 Deprtment of Surgery (RMH), The University of Melourne, The Royl Melourne Hospitl, Prkville, VIC 3010, Austrli Full list of uthor informtion is ville t the end of the rticle function of TGF-β signling components [5]. Tumor cells, prticulrly dvnced tumor cells, often show incresed production of TGF-β while they re insensitive to TGF-β induced growth inhiition [6]. TGF-β cting s n importnt tumor promoter, prticulrly t lte stges of tumor development, is evidenced y using murine niml models nd humn cellulr systems [7 10], in which TGF-β signling components re required for tumor invsion in vitro nd metstsis in vivo. Cliniclly, there is sustntil ody of evidence tht excess TGF-β production is ssocited with poor prognosis in mny types of humn tumors [5]. Thus, TGF-β cts s tumor suppressor in erly tumor development, ut promotes tumor invsion nd metstsis during lte stges of tumor progression [11]. Rs proteins re smll GTPses tht ct s moleculr switches y cycling etween inctive GDP-ound nd The Author(s). 2018 Open Access This rticle is distriuted under the terms of the Cretive Commons Attriution 4.0 Interntionl License (http://cretivecommons.org/licenses/y/4.0/), which permits unrestricted use, distriution, nd reproduction in ny medium, provided you give pproprite credit to the originl uthor(s) nd the source, provide link to the Cretive Commons license, nd indicte if chnges were mde. The Cretive Commons Pulic Domin Dediction wiver (http://cretivecommons.org/pulicdomin/zero/1.0/) pplies to the dt mde ville in this rticle, unless otherwise stted.
Liu et l. Cell Communiction nd Signling (2018) 16:10 Pge 2 of 15 ctive GTP-ound sttes. It functions s trnsducer of the cell signls from the memrne receptor to the intrcellulr pthwy tht controls cell prolifertion, differentition, nd survivl [12]. Constitutive ctive muttions of Rs re frequently expressed in humn cncers ~ 20 to 30% of ll humn tumors contin one of the mutted Rs genes, especilly in pncres, thyroid nd colon crcinoms (90, 60 nd 45% respectively) [13, 14]. Rs plys n importnt role in tumor initition s well s in tumor mintennce [15]. Mny crcinoms crrying the ctivted Rs proteins hve undergone EMT [16, 17]. It is known tht Rs downstrem effecter pthwy Rs-Rf-MAPK is essentil mediting EMT [10, 18]. On the other hnd, ctivtion of nother Rs downstrem effecter pthwy PI3K/Akt enhnces tumor cell growth nd medites protection from TGF-β induced poptosis [19, 20]. TGF-β nd Rs signling re two of the most importnt moleculr pthwys mediting the fundmentl cellulr process, nmely EMT, involved in tumor metstsis [21, 22]. Depending on the cellulr contexts, Rs signling ntgonizes TGF-β-induced growth rrest nd poptosis [23] y suppressing the TGF-β-Smd signling [24]. It ws reported tht Rs, cting through Mek1 nd Erk kinses, induced the phosphoryltion of Smd2/3 t cluster of Ser/Thr-Pro sites in the linker region [24]. The Rs-induced phosphoryltion in the linker region prevents the ccumultion of Smd2/3 in the nucleus. Prolonged ctivtion of Rf/MAPK pthwy in MDCK cells significntly reduces Smd3 levels independently of TGF-β stimultion [25]. Recently, Rs hs een shown to induce the down-regultion of TβRII [26]. Induced expression of mutnt Rs ctivtes MAPK pthwy which leds to the recruitment of histone decetylse (HDAC). HDAC suppresses the TβRII promoter region ( 127/ 75) nd consequently results in the downregultion of TβRII in lung cncer cells [26]. In contrst, Rs signling ws shown to up-regulte TGF-β production [27], enhncing endogenous TGF-β signling [10]. During dvnced stge of tumour development, Rs signling often positively coopertes with TGF-β signling. Activtion of the Rs-MAPK signling often results in utocrine TGF-β signling which is criticl in EMT mintennce [9, 19, 27 29]. It hs een shown tht metstsis is driven y sequentil elevtion of H-Rs nd Smd2 levels [10]. During tumour progression from kertinocyte towrds squmous crcinom then to invsive spindle cell crcinom, TGF-β signling ctivity ws drmticlly incresed nd the constitutively ctivted Smd2 ws oserved in invsive spindle tumour cells only. Activted H-Rs over-expression in squmous crcinom cells demonstrted tht oncogenic Rs stimulted TGF-β-induced trnscription nd enhnced TGFβ-induced phosphorylted Smd2 levels [10]. However, how Rs positively regultes the TGF-β signling is uncler. The mechnisms of cross-tlk etween the Rs nd TGF-β signling re eing investigted in numer of cell lines, with controversil results [30]. Recently, we hve identified SPSB1 (SPRY domincontining SOCS ox protein 1) s novel negtive regultor of the TGF-β signling pthwy [31]. The SPSB1 gene expression is induced y TGF-β nd it feeds ck to negtively regulte the TGF-β signling pthwy. Interestingly, SPSB1 hs lso een reported to positively regulte the c-met-rs-mapk signling [32]. We investigte whether SPSB1 ridges the Rs nd TGF-β signling. This study descries new mechnism of how Rs up-regultes the TGF-β signling: Rs intercts with the newly identified TβRII negtive regultor SPSB1 nd cuses its degrdtion vi uiquitintion. This leds to the enhnced TβRII levels nd consequently incresed TGF-β signling ctivity. This is the first to report tht Rs is directly trgeting TGF-β signling regultory components to enhnce its signling ctivity. Experimentl procedures Antiodies nd regents The mouse nti-flag (M2) nd nti-actin monoclonl ntiodies were otined from Sigm-Aldrich (St Louis, MO). Mouse monoclonl nti-myc nd nti-rs (detects endogenous Rs) ntiodies were generted in house. Rit polyclonl nti-tβri, nti-tβrii nd mouse monoclonl nti-h-rs ntiodies were otined from Snt Cruz Biotechnology (Snt Cruz, CA). Rit polyclonl nti-flag ntiody ws otined from ABR (Affinity BioRegents, Golden, CO). Rit polyclonl nti-phospho- Smd2 ntiody ws kindly provided y Prof Peter ten Dijke (Leiden University Medicl Center, Netherlnds). Mouse monoclonl nti-smd2 ntiody ws otined from BD Trnsduction Lortories (Rockville, MD). Got nti-mouse IgG HRP conjugted secondry ntiody, Got nti-rit IgG HRP conjugted secondry ntiody were otined from Bio-Rd (Bio-Rd Lortories, Gldesville, N.S.W., Austrli). The nti-mouse Alex 488 nd Alex 546 - conjugted secondry ntiodies were from Invitrogen (Invitrogen Corp., Mulgrve, Austrli). Humn recominnt TGF-β1 ws otined from R&D Systems (Minnepolis, MN). Doxycycline nd Cycloheximide were purchsed from Sigm-Aldrich, while MG132 ws otined from Merck (Merck, Drmstdt, Germny). DNA constructs nd primers FLAG-TβRI, HA-TβRII nd v-h-rs were cloned into pcdna3 mmmlin cell expression vector s descried previously [33, 34]. v-h-rs(n85a), v-h-rs(n86a) nd v-h-rs(d120a, R124A) were generted sed on v-h- Rs using Quick Chnge II XL Site-Directed Mutgenesis Kit (Agilent Technologies, Snt Clr, CA) ccording to
Liu et l. Cell Communiction nd Signling (2018) 16:10 Pge 3 of 15 the mnufcturer s recommendtions. The following pimers were used in the PCR rection: v-h-rs N85A forwrd: TGTGTATTTGCCATCGCCAACACCAAGT CCTT. v-h-rs N85A reverse: AAGGACTTGGTG TTGGCGATGGCAAATACACA. v-h-rs N86A forwrd: GTATTTGCCATCAACGCCACCAAGTCCTT TGA. v-h-rs N86A reverse: TCAAAGGACTTGGT GGCGTTGATGGCAAATAC. v-h-rs D120A, R124A forwrds: TGGGCAACAAGTGTGCACTGGCCGCTGC- CACTGTTGAGTCTC. v-h-rs D120A, R124A reverse: GAGACTCAACAGTGGCAGCGGCCAGTGCACACTT GTTGCCCA. The sequence of ll newly generted v-h- Rs mutnts were confirmed y direct DNA sequencing. FLAG/MYC-SPSB1, FLAG/MYC-SPSB1Δ, MYC-SP SB1(Y129A) nd MYC-SPSB1(T160A, Y161A) were ll cloned into the pef-bos mmmlin cell expression vector [35]. Cell lines, cell culture nd tretments The humn emryonic kidney cell line HEK-293 T (293 T), the Mdin Dry Cnine Kidney (MDCK) cell line, the v-h-rs stle trnsformed MDCK (21D1) cell line hve ll een previously descried [32, 34]. To generte the doxycycline inducile SPSB1 cell line in 21D1 cells, tetrcycline-inducile vector, ptre ws utilized [36]. Briefly, ptre-flag-spsb1 nd pefpurop-tet-on [36] were co-trnsfected into 21D1 cells y using FuGENE HD trnsfection regent (Roche, Bsel, Switzerlnd) following the mnufcturer s instructions nd selected for using puromycin (Roche, Bsel, Switzerlnd). To generte the doxycycline inducile v-h-rs cell line in MDCK cells, ptre-v-h-rs nd pefpurop-tet-on were co-trnsfected into MDCK cells y using FuGENE 6 trnsfection regent (Roche, Bsel, Switzerlnd) following the mnufcturer s instructions nd selected for using puromycin (Roche, Bsel, Switzerlnd). All positive clones were selected y Western lot nlysis using FLAG ntiody (Sigm-Aldrich) or Rs ntiody (In house mde). All cells were mintined in Dulecco s Modified Egle s Medium contined 10% foetl ovine serum (FBS) (DKSH, Hllm, Victori, Austrli), 2 mm glutmine, 100 U/ml penicillin nd 100 μg/ml streptomycin (Invitrogen). Luciferse ssys Cells were trnsiently trnsfected with firefly luciferse (luc) construct pcaga 12 -luc [37], long with other DNA constructs s indicted using FuGENE HD trnsfection kit for 293 T cells nd METAFECTENE PRO (Biontex Lortories, Sn Diego, CA) for ll other cells. Twentyfour hours fter trnsfection, cells were stimulted with ± TGF-β t indicted concentrtion in medium contining 10% FCS for further 24 h. Therefter, cells were lysed nd ssessed for luciferse ctivity using the Luciferse Reporter Assy Kit (Promeg Corp, Mdison, WI) following the mnufcturers instructions. Immunoprecipittion nd immunolotting After trnsfection, cells were lysed in lysis uffer (50 mm Tris, 150 mm NCl, 1% Triton-X-100, 50 mm NF, 2 mm MgCl 2,1mMN 3 VO 4,25μg/ml leupeptin nd 25 μg/ml protinin) nd cell lystes were sujected to immunoprecipittion with pproprite ntiody conjugted sephrose protein G ed or nti-flag eds (Sigm-Aldrich) for 4 h. Immunoprecipittes were wshed three times with ice-cold PBS contining 0.5% Tween-20 nd immunoprecipitted proteins were seprted y SDS-PAGE (Invitrogen) nd lotted onto nitrocellulose memrne nd proed with the indicted primry ntiodies. The signl ws visulized using the ECL chemoluminescence detection kit (GE Helthcre, Rydelmere, N.S.W., Austrli) following incution with pproprite secondry ntiodies. Qulittive nlysis for protein hlf life The intensity of the nds in western lot imges ws mesured using imge J. Rectngulr selection tool ws used to select the re where the nds were locted (the intensity of nds tht were used to clculte the hlf-life of the protein ws mesured together in one selected re). The gps etween ech nd were used s reltive ckground. The intensity of ech nd ws mesured 3 times y selecting three different gp intensities s the reltive ckground (ckground intensity selected t low, medium nd high). Protein stility curves were generted y smoothly joining the intensity vlues of ech set of nds in the Y-xis, with their corresponding tretment times in the X-xis using Microsoft excel. Hlf-life ws determined s the time t which protein nd intensities were 50% of the strting level (time 0). The vlue of hlf-life shown in the results is the men of the three estimted hlf-life vlues for ech four nds. The results re shown s the men of estimted hlf-life vlues +/ SD. Immunofluorescence stining nd confocl microscopy After trnsfection with pproprite DNA constructs using FuGENE HD for 48 h, cells were wshed once in preheted 37 C PBS nd fixed with 3.7% formldehyde (Sigm) in PBS for 7 min. Following two PBS wshes, cells were permeilized with 0.2% Triton-X-100 (Merck) in PBS for nother 7 min. Cells were then wsh 3 times with PBS nd locked with PBS contining 5% BSA for 1 h t room temperture. Following nother 3 wshes in PBS, cells were stined with relevnt primry ntiody (diluted in PBS contining 2% BSA) for 1 h t room temperture nd wshed in PBS 3 more times. Visulistion ws chieved with either Alex 546 or Alex 488 -conjugted secondry ntiody using the Nikon TE2000-E & C1 Confocl
Liu et l. Cell Communiction nd Signling (2018) 16:10 Pge 4 of 15 Microscope with Nikon 60X wter immerged lens. Nikon confocl EZ-C1 v.1.4 ws used to collte imges. In vitro scrtch ssy nd fluorescence microscopy 21D1 cells were trnsfected with indicted DNA constructs nd seeded onto 12-well culture plte until 100% confluent. Forty-eight hours post-trnsfection, scrtches were creted using P1000 pipette tip to scrtch stright line on the culture plte. The culture medium ws replced with fresh medium to remove detched cells. Phse-contrst nd fluorescence imges were cquired t 0 nd 24 h postscrtch using n inverted microscope (IX50, Olympus) equipped with CCD cmer (Model 11.3, Dignostics instruments, MI), nd SPOT dvnced imging softwre (v4.0.4) ws used to cquire nd process imges. In vitro invsion nd migrtion ssy 21D1 cells were trnsfected with indicted DNA constructs in 6-well plte. Forty-eight hours posttrnsfection, 21D1 (20,000 cells/chmer) cells were resuspended in serum free DMEM nd seeded in the top chmer of 70 μl solidified mtrigel (BD Biosciences, 1:1 mixed with DMEM) coted, 8 μm, polycronte memrne trnswell insert (Corning Incorported, Corning NY). Serum free DMEM ±2 ng/ml of TGF-β ws dded to the ottom chmer. Cells were then incuted for 24 h t 37 C with 10% CO 2. Therefter, cells tht invded through the coted mtrigel nd migrted to the other side of the memrne of the trnswell insert were fixed with 3.7% formldehyde (Sigm) for 7 min. Cells were then wshed nd stined with Hoechst for 5 min. Any remining cells in the top chmer of the trnswell insert were removed y using cotton sw. Only cells in the ottom side of the trnswell insert were counted. Fluorescent imges were tken in three rndom fields (20 ) per insert. Assys were performed in triplicte. Sttistics All sttisticl nlyses were performed using two-til Students T-test (P < 0.05 indicting sttisticl significnce). Results Rs reduces SPSB1 expression levels We hve previously generted mesenchyml cellulr model 21D1 y trnsforming MDCK cells using v-h- Rs [34, 38]. While ctivtion of oth Rs nd TGF-β signlings re required for the mintennce of 21D1 cells mesenchyml phenotype, it is interesting tht Smd2 phosphoryltion levels re incresed in 21D1 cells in comprision to the prtentl epithelil MDCK cells (Fig. 1). Further exmintion reveled tht oth the TGF-β type I nd type II receptors (TβRI nd TβRII) levels re elevted in 21D1 cells (Fig. 1, similr results re otined in nother clone 21F3, results not shown). The SPRY domin contining SOCS ox protein 1 (SPSB1, lso known s SSB1), is newly discovered TGF-β signling negtive regultor y trgeting TβRII for degrdtion. We investigte whether SPSB1 hs the ility to reduce Rs cused elevtion of TβRII. Surprisingly, while there ws no difficulty to over-express SPSB1 protein in the prentl MDCK cells [31], expression of SPSB1 in 21D1 cells ws very difficult s demonstrted in Fig. 1 tht there were hrdly ny positive immunofluorescence stining. In contrst, the SOCS ox deletion mutnt (SPSB1Δ) or the interction defective SPRY domin mutnt (SPSB1(Y129A)) of SPSB1 ws redily to e detected y immunofluorescence stining fter trnsfection (Fig. 1). Those oservtions suggest tht Rs my ply role in suppressing the expression of SPSB1. To investigte the effect of Rs on the expression of SPSB1, we co-trnsfected FLAG-SPSB1 with v-h-rs in 293 T cells. As shown in lne 2 of Fig. 1c, SPSB1 ws redily expressed in the sence of Rs. However, the expression level of SPSB1 ws reduced in the presence of Rs (lne 1, Fig. 1c), suggesting tht Rs suppresses SPSB1 expression directly. Indeed, when Rs expression levels were progressively reduced, the expression levels of SPSB1 were progressively restored with or without TGF-β tretment (Fig. 1d), confirming the notion tht Rs reduces SPSB1 expression level. Furthermore, EGFinduced ctivtion of endogenous Rs hs no effect on the degrdtion rte of SPSB1 (Additionl file 1: Figure S1), suggesting Rs ctivtion independent mechnism. Rs intercts with SPSB1 through the SPRY domin We next exmined its interction with SPSB1 using 293 T cells. Western lot nlysis of immunoprecipittes of FLAG-tgged SPSB1 showed the existence of Rs (Fig. 2), indicting complex formtion etween Rs nd SPSB1. Like SPSB1 interction with TβRII [31], the SOCS ox is not required for its Rs interction since the deletion mutnt (SPSB1Δ) formed complex s efficient s the wild type (Fig. 2). Those results indicte tht the interction is medited through the SPRY domin of SBSP1. Reversed immunoprecipittion using Rs ntiody confirmed Rs interction with SPSB1 (Fig. 2). Tht muttion t position 129 of SPSB1 disrupted its ililty to form complex with Rs (Fig. 2) identifies the criticl role of Y129 in the SPRY domin for the interction with Rs. It is noted tht this Rs ntiody lso pulled-down the endogenous Rs which formed immuno-complex with over-expressed SPSB1 (Fig. 2) suggesting endogenous Rs interction with SPSB1. Furthermore, this interction is not significntly ffected y
Liu et l. Cell Communiction nd Signling (2018) 16:10 Pge 5 of 15 c d Fig. 1 Oncogenic Rs reduces SPSB1 expression level. Cultured MDCK nd 21D1 cells () were treted ± TGF-β (2 ng/ml) for 15 min nd then lysed. Whole cell lystes were exmined for indicted proteins y immunolotting (IB). 21D1 cells () were trnsfected with indicted DNA constructs (0.2 μg/well ech) in 12 well plte for 48 h. Fixed cells were then immunostined with mouse nti-myc followed y Alex488-conjugted secondry nti-mouse IgG. Cell nuclei ws stined with Hoechst dye. The expression of SPSB1/SPSB1 mutnts (green) ws nlyzed y fluorescent microscope (mgnifiction = 40 ). 293 T cells(c) were trnsfected with indicted DNA constructs for 48 h. Cells in (d)weretrnsfectedwiththeflag-spsb1(0.5μg/well) nd decresing concentrtion of v-h-rs (0.5, 0.25, 0.125, 0.0625, 0 μg/well), the totl mount of DNA per trnsfection ws kept thesmeycompenstingwithpcdna3vector.24hlter, cells were treted with ± TGF-β (2 ng/ml) for further 24 h. Whole cell lystes were exmined for indicted proteins y immunolotting (IB). In ll cse, ech experiment ws repeted, with representtive results shown EGF stimultion (Additionl file 1: Figure S2), suggesting Rs-ctivtion independent interction. Using nother Rs ntiody which did not pull-down endogenous Rs, there ws no SPSB1 oserved in the immuno-complex without over-expression of Rs (Fig. 2d), confirming the specificity of the interction. However, the doule mutnt in the SPRY domin (SPSB1 T160A, Y161A) did not pper to interrupt the Rs-SPSB1 interction (Fig. 2 & d). The differentil effect of Y129 from T160/Y161 in interction with Rs ws lso confirmed y trgeting SPSB1 for immunoprecipittion using MYC-tgged constructs (Fig. 2c). To confirm tht the Rs-SPSB1 interction ws not n rtifct of cell lysis, we performed coimmunofluorescence stining. When expressed lone in 293 T cells, SPSB1 ws diffusely loclized in the cytoplsm region (Fig. 2e, top pnel). Rs hd similr locliztion pttern s SPSB1 except it could lso e detected on the cell memrne when expressed lone (Fig. 2e, top pnel). Interestingly, in the presence of Rs, sustntil portion of SPSB1 ws found redistriuted to the cell surfce (Fig. 2e, ottom pnel), co-loclizing with Rs on the cell memrne nd in the endosome like vesicles. This result is consistent with the coimmunoprecipittion dt demonstrting Rs-SPSB1 interction. Tking together, Rs intercts with the SPRY domin of SPSB1, supporting the previous finding tht SPRY domin is functioning s protein-protein interction interfce [35, 39]. The EGF independent endogenous Rs interction with SPSB1 oserved in Fig. 2 & Additionl file 1: Figure S2 suggests tht the ctive GTPound Rs my not e required for the Rs-SPSB1 interction since the endogenous Rs re lrgely not ctive in GDP-ound form. Rs N85 nd N86 re not responsile for its interction with SPSB1 We nd others hve previously shown tht SPSB1 could recognize D-I-N-N-N-X or similr sequence motifs present in multiple trget proteins [31, 39]. In order to further investigte the Rs-SPSB1 interction, we serched for similr motifs in Rs. Our sequence lignment shows Rs contins stretch of Ile 84 -Asn-Asn-Thr-Lys 88 (I-N-N-T-K) in the middle region of the protein. Bsed on the importnce of the sprgine residues in other SPSB1 intercting proteins (TβRII, Pr4, VASA nd inos) [31, 35, 40 42], we generted two mutnt v-h-rs DNA constructs, one contining N85A sustitution nd the other N86A. Neither muttion disrupted the function of the v-h-rs in
Liu et l. Cell Communiction nd Signling (2018) 16:10 Pge 6 of 15 c d e f Fig. 2 Rs intercts with the SPRY domin of SPSB1. 293 T cells (,, c, d, f) were trnsfected with indicted DNA constructs (0.5 μg/well ech). 48 h lter, cell lystes were immunoprecipitted (IP) with nti-rs ntiody (, d, f) or nti-myc ntiody (c) conjugted with protein G eds or nti-flag eds (). Both whole cell lystes nd immunoprecipttes were exmined for indicted proteins y immunolotting (IB). 293 T cells (e) were trnsfected with v-h-rs or FLAG-SPSB1 singly (top two imges) or co-trnsfected with v-h-rs nd FLAG-SPSB1 (ottom imges) for 48 h. Fixed cells were then immunostined with rit nti-flag followed y Alex 546 -conjugted secondry nti-rit IgG nd/or mouse nti-rs followed y Alex 488 -conjugted secondry nti-mouse IgG s indicted. The su-cellulr locliztion of SPSB1 (red) nd v-h-rs (green) ws nlyzed y confocl microscope (mgnifiction = 60 ). Co-locliztion of merged imges ppers s yellow. All experiments were repeted three times, with representtive results shown. A figure illustrtion of SPSB1 protein is shown in mediting Erk1/2 phosphoryltion (Additionl file 1: Figure S3), indicting correct folding of the expressed mutnts. Anti-Rs immuoprecipittion showed tht the SPSB1 ws co-precipitted with Rs(N85A) nd Rs(N86A) t similr potency s the wild-type Rs (Fig. 2f). This non-disruption of interction ws confirmed y performing reciprocl immunoprecipittion of SPSB1 (Additionl file 1: Figure S4). This suggests tht lthough Rs protein contins similr motif s D-I-N-N-N-X, the sprgine residues re unlikely to e involved in the Rs- SPSB1 interction. To further investigte the Rs-SPSB1 interction, n lterntive strtegy ws employed. Infct, Rs is not the first protein identified to interct with SPSB1 without crrying the D-I-N-N-N-X motif. The HGF receptor c-met hs een reported to interct with SPSB1, however, sequence lignment suggests tht c-met does not contin ny sequence similr to the D-I-N-N-N-X motif [32]. We hypothesize tht Rs my shre similr interction motif with c-met to interct with SPSB1. Sequence lignment etween Rs nd c-met identified n identicl short stretch of Asp 120 -Leu-Al-Al-Arg 124 (D-L-A-A-R). The chrged residues in the D-L-A-A-R sequence were mutted into lnine (v-h-rs(d120a, R124A)). Surprisingly, the mutnt protein expression level ws low (Additionl file 1: Figure S3), however, the doule mino cid sustitutions did not impir the ility of oncogenic Rs to medite Erk1/2 phosphoryltion (Additionl file 1:FigureS3).Interestingly, while Rs(D120A, R124A) ws expressed t much lower levels thn its wild-type conterprt, significntly more Rs(D120A, R124A) ws detected in the nti-myc immunoprecipittes (Additionl file 1: Figure S5). Furthermore, this interction etween Rs(D120A, R124A) nd SPSB1 ws confirmed y performing reciprocl immunoprecipittion of Rs (Additionl file 1: Figure S6). As such, the D-L-A-A-R sequence in Rs my e involved for the Rs-SPSB1 interction. Rs down-regultes the expression levels of SPSB1 y enhncing SPSB1 uiquitintion How does Rs interction with SPSB1 suppresses the expression of SPSB1? Reduced protein expression cn e cused y enhnced protein uiquitintion nd hence degrdtion. FLAG-SPSB1 ws co-trnsfected with v- H-Rs/mutnts/pcDNA3 vector s indicted with or without MYC-uiquitin in 293 T cells. As shown in the lst lne of Fig. 3, when SPSB1 ws expressed lone with uiquitin, mono-uiquitinted, di-uiquitinted nd
Liu et l. Cell Communiction nd Signling (2018) 16:10 Pge 7 of 15 Fig. 3 Oncogenic Rs enhnces the uiquitintion levels of SPSB1. 293 T cells (, ) were trnsfected with indicted FLAG-SPSB1 construct together with v-h-rs/v-h-rs mutnts or pcdna3 control vector ± MYC-uiquitin. Cells were lysed 48 h post-trnsfection. Cell lystes were immunoprecipitted (IP) with FLAG eds () or nti-myc ntiody conjugted with protein G eds (). Both whole cell lystes nd immunoprecipttes were exmined for indicted proteins y immunolotting (IB). Reltive densities of mono-uiquitinted nds re list elow the top pnels. Results re representtive of experiments repeted t lest once poly-uiquitinted SPSB1 could e detected in the nti- FLAG immunoprecipittes. This is consistent with our erly result tht SPSB1 itself is trget for uiquitintion [31]. In contrst, when oncogenic Rs ws co-expressed, lthough we did not oserved ny significnt chnges in levels of poly-uiquitinted SPSB1, detectle enhncement of the mono-uiquitinted (quntitted), diuiquitinted nd possily tri-uiquitinted SPSB1 levels ws oserved (Fig. 3). To confirm this notion, reciprocl immunoprecipittion of MYC for uiquitin ws performed. In the MYC immunoprecipittion, monouiquitinted SPSB1 were only detected in the presence of oncogenic Rs (Fig. 3). Since erly result indictes tht oncogenic Rs does not require the I-N-N-T-K sequence for its interction with SPSB1, Rs(N85A) nd Rs(N86A) s ility to enhnce SPSB1 uiquitintion were exmined. As we expected, oth Rs(N85A) nd Rs(N86A) enhnced the levels of mono-uiquitinted, di-uiquitinted nd possily tri- uiquitinted SPSB1 (Fig. 3). Agin, the result ws confirmed y reciprocl immunoprecipittion of MYC for uiquitin (Fig. 3). Collectively, these results suggest tht oncogenic Rs hs the ility to induce the mono-, di- nd possily tri-uiquitintion of SPSB1. Normlly, incresed uiquitintion of protein decreses its stility, nd consequently its hlf-life. To mesure the protein hlf-life, the protein synthesis inhiitor cycloheximide ws used. Consistent with our previous result [31], the degrdtion of SPSB1 ws oserved during the 8 h of cycloheximide tretment when it ws expressed lone (Fig. 4). In the presence of oncogenic Rs, not only ws the stedy stte levels of SPSB1 reduced, ut lso the protein degrdtion rte of SPSB1 ws incresed (Fig. 4). The SPSB1 protein hlf-life ws clculted y quntittively mesuring the intensity of ech nd using ImgeJ. The expression of oncogenic Rs reduced the protein hlf-life of SPSB1 from ~ 6 h to ~ 3.2 h (Fig. 4). In contrst, oncogenic Rs filed to promote the protein degrdtion of SPSB1(Y129A) (SPSB1 mutnt tht disrupted the Rs- SPSB1 interction, Fig. 4c). Furthermore, the expression of oncogenic Rs did not lter the protein stility of SPSB1Δ (Fig. 4) which ws consistent with our erly results tht the SOCS ox ws required for the degrdtion of SPSB1 [31]. Since Rs(N85A) nd Rs(N86A) enhnce the uiquitintion of SPSB1, they should lso enhnce the protein degrdtion of SPSB1. As expected, similr to the wildtype oncogenic Rs, the presence of Rs(N85A) nd Rs(N86A) oth resulted in oservle enhncement of protein degrdtion of SPSB1 (Fig. 4). TGF-β tretment ppered to hve little effect on the SPSB1 degrdtion rte (Additionl file 2: FigureS7). To further confirm the uiquitintion degrdtion of SPSB1 y oncogenic Rs, we used protesome inhiitor MG132 to lock the protein degrdtion. As expected, oncogenic Rs induced protein degrdtion of SPSB1 slowed y tretment of MG132 (Fig. 4d). Collectively, our results suggest tht the oncogenic Rs-SPSB1 interction results in the enhnced uiquitintion nd degrdtion of SPSB1. Rs inhiits SPSB1 medited uiquitintion of TβRII nd hence stilizes TβRII Our erly dt suggest tht Rs down-regultes SPSB1 y enhncing its degrdtion. Since SPSB1 is
Liu et l. Cell Communiction nd Signling (2018) 16:10 Pge 8 of 15 c d Fig. 4 Oncogenic Rs increses the degrdtion rte of SPSB1. 293 T cells (,, c, d) were co-trnsfected with vrious SPSB1 nd Rs/control construct s indicted. 36 h lter, cells were exposed to cycloheximide (20 μg/ml) for indicted periods. Cells in (d) were co-treted with MG132 (25 μm) for indicted periods. Whole cell lystes were then exmined for indicted proteins y immunolotting (IB). Reltive intensity of ech SPSB1/SPSB1 mutnt nd ( nd c) ws qulittively mesured using ImgeJ, the numer under ech nd indicted its corresponding reltive intensity (Aritrry Units). The hlf life ± S.D. (n = 3 technicl replictes) for SPSB1/SPSB1 mutnt degrdtion is shown underneth. In ll cse, ech experiment ws repeted t lest once, one representing result is showing negtive regultor of TβRII, cn Rs regulte TβRII levels vi SPSB1 nd hence the TGF-β signling? HAtgged TβRII [33] ws co-trnsfected with v-h-rs or pcdna3 vector with or without uiquitin followed y the immunoprecipittion of TβRII. Consistent with our previous results [31], TβRII ws uiquitinted when it ws expressed lone (Fig. 5). In the presence of oncogenic Rs, we oserved no ovious chnges in the uiquitintion levels of TβRII (Fig. 5, lst four lnes). As expected, expression of SPSB1 resulted in the increse of uiquitintion levels of TβRII without oncogenic Rs expression (Fig. 5) [31]. However, coexpression of oncogenic Rs with SPSB1 reduced TβRII uiquitintion levels nd SPSB1 expression levels (Fig. 5). Those dt suggest role of Rs in inhiiting SPSB1 s regultionoftβrii uiquitintion. Since oncogenic Rs inhiits SPSB1-medited TβRII uiquitintion, we next investigted the effect of oncogenic Rs on the SPSB1-medited TβRII degrdtion using cyclohexmide tretment. As shown in Fig. 5, in the presence of SPSB1, the hlf-life of TβRII ws mesured t ~ 6 h. In contrst, when oncogenic Rs ws co-expressed, the degrdtion rte of TβRII ws slowed with its hlf-life incresed to more thn 8 h (Fig. 5). Consistent with those over-expression dt, the endogenous TβRI nd TβRII levels in the 21D1 cells were oserved to e higher thn the ones in the prtentl MDCK cells (Fig. 1). Collectively, our results suggest tht oncogenic Rs compromises the ility of SPSB1-medited TβRII uiquitintion, nd hence, stilizes TβRII. TGF-β receptor levels regulte TGF-β signling sensitivity nd durtion To investigte the effect of TGF-β receptor levels on signling ctivity, we used sensitive TGF-β Smd3 reporter, pcaga-luciferse. As shown in Fig. 6, overexpression of TβRI lone in 293 T cells resulted in douling of sl ctivity of the luciferse reporter while there ws no chnge of TGF-β (2 ng/ml) stimulted reporter ctivity in comprison with without ny receptor expression. However, over-expression of TβRII lone resulted in even more increse of reporter ctivity
Liu et l. Cell Communiction nd Signling (2018) 16:10 Pge 9 of 15 Fig. 5 Oncogenic Rs reduces the enhnced uiquitintion of TβRII y SPSB1 nd hence stilizes TβRII. 293 T cells (, ) were trnsfected with indicted FLAG-SPSB1/pEF-BOS control vector together with v-h-rs/pcdna3 control vector nd HA-TβRII ± MYC-uiquitin. Cells () were lysed 48 h post-trnsfection. Cell lystes were immunoprecipitted (IP) with nti-tβrii ntiody conjugted with protein G eds. 36 h post-trnsfection, cells () were exposed to cycloheximide (20 μg/ml) for indicted periods nd lysed. In ll cses, oth whole cell lystes nd immunoprecipttes were exmined for indicted proteins y immunolotting (IB). Reltive intensity of ech TβRII nd () ws qulittively mesured using ImgeJ s descried in Fig. 4.In ll cse, results re representtive of experiments repeted t lest once t oth sl level (~ 4-fold) nd with TGF-β tretments (Fig. 6). Importntly, over-expression of oth TβRI nd TβRII elevted significntly the sl reporter ctivity to similr level s TGF-β tretments (~ 9-fold) (Fig. 6), indicting n importnt role of the receptor levels in regulting TGF-β signling ctivity. Similr results were lso otined using MDCK cells (Additionl file 2: Figure S8). While pcaga-luciferse reporter mesures Smd3 trnscriptionl ctivity, we further investigted the effect of the receptor levels on their nother effector Smd2. Without over-expression of either TβRI or TβRII, TGF-β tretment of 293 T cells resulted in phosphoryltion of the Smd2 (Fig. 6). A slight increse of Smd2 phosphoryltion levels were oserved when TβRI ws over-expressed (Fig. 6). However, over-expression of TβRII lone in 293 T cells resulted in sustntil increse of Smd2 phosphoryltion levels nd the effect lsted 12 h (the mximum durtion exmined in experiment). Similrly, such increse of Smd2 phosphoryltion levels were lso ovious when oth TβRI nd TβRII were over-expressed (Fig. 6). Those results re consistent with ove oservtions using Smd3 reporter ssy, further suggesting the importnt regultory role plyed y the levels of TGF-β receptors in its signling. Rs enhnces TGF-β signling through increse of TβRII levels Since receptor levels regulte TGF-β signling ctivity (Fig. 6) nd Rs stlizes receptor levels through destiliztion of SPSB1 (Figs. 4 nd 5), we further exmined the effect of Rs expression on TGF-β signling. To tht end, we generted doxycycline-inducile Rs expression stle cell line using MDCK cells (Fig. 7). Indeed, there ws significnt increse of TGF-β signling ctivity mesured y pcaga-luciferse reporter when the expression of Rs is induced (~ 4-fold) (Fig. 7). Consistently, TGF-β signling reporter ctivity in the Rs trnsformed 21D1 cells were mrkedly incresed in comprison with prentl MDCK cells (~ 32-fold) (Fig. 7). Those results re in greement with the oservtion tht Rs trnsformed 21D1 cells express higher levels of TβRI nd TβRII thn MDCK cells (Fig. 1). Conversely, induced expression of SPSB1 (though t low level) in 21D1 cells resulted in reduced TβRII levels (Additionl file 2: Figure S9). Consequently, the induction of SPSB1 expression resulted in the reduction of TGF-β reporter ctivity in 21D1 cells (Additionl file 2: Figure S10). To further investigte the interply mong Rs, SPSB1 nd TβRII in TGF-β signling, we used over-expression nd TGF-β-Smd3 reporter ssy in 293 T cells. While exprssion of SPSB1 suppressed the reporter ctivity s expected, however, further over-expression of Rs negted SPSB1 s suppressive effect (Fig. 7c). On the other hnd, coexpression of Rs with TβRII mrkedly incresed the reporter ctivity nd tht increse ws lrgely suppressed y over-expression of SPSB1 (Fig. 7d). Reducing TGF-β signling in Rs trnsformed 21D1 cells y SPSB1 suppresses cell migrtion nd invsion It hs een shown tht oncogenic Rs must cooperte with high TGF-β-Smd2 signling to induce EMT in mouse skin tumour cells [10]. We firstly exmined the effect of SPSB1 on the migrtory ility of 21D1 cell using wound heling ssy. Given the difficulty to express nd visulize SPSB1 in 21D1 cells due to the destilizing effect of Rs, we cotrnsfected SPSB1 with egfp construct to mrk SPSB1 expressing cells. Indeed, in 293 T cells, the egfp expressing cells lso expressed SPSB1 (Additionl file 2: Figure S11).
Liu et l. Cell Communiction nd Signling (2018) 16:10 Pge 10 of 15 Fig. 6 TGF-β receptor levels regulte TGF-β signling sensitivity nd durtion. 293 T cells () were co-trnsfected with pcaga-luc nd indicted TβRII nd/or TβRI nd/or pcdna3 control vector. 24 h lter, cells were treted with ± TGF-β t indicted concentrtion for further 24 h. Cells were then lysed, nd luciferse ctivity ws determined. Dt re expressed s reltive Smd3 luciferse ctivity (fold of induction) y stndrdizing the luciferse ctivity of un-stimulted cells trnsfected with contorl vector to 1, nd normlizing llotherrwvluesccordingly.resultsfromrepresenttive experiment re shown s the men of triplictes±s.d. * P < 0.05. 293 T cells () were co-trnsfected with indicted DNA constructs. 36 h lter, cells were stimulted with ± TGF-β (2 ng/ml) for indicted periods then lysed. Whole cell lystes were exmined for indicted proteins y immunolotting (IB). In ll cse, ech experiment ws repeted three times, one representing result is shown Since the wild type SPSB1 is not stle in Rs trnsformed 21D1 cells, we used non Rs intercting mutnt SPSB1(Y129A) to demonstrte the co-expression of egfp in the sme cells (Additionl file 2: Figure S12). As shown in Fig. 8, 21D1 cells lmost closed the wounded re in 24 h with or without trnsfection of SPSB1, while TGF-β tretment resulted in complete closing of the wounded re. Consistently, there were more egfp lelled cells moved into the wounded re when treted with TGF-β thn the cells were not co-trnsfected with SPBS1 (Fig. 8 & ). However, when cells were co-trnsfected with SPSB1, non-egfp lelled cells still moved into the wounded re, ut most egfp lelled cells hrdly moved (red circle highlighted cells) nd there were pprent reduced numers of egfp lelled cells in the wounded re (Fig. 8 & ). While the reduction occured with TGF-β tretment, it lso ppered to e ture without TGF-β tretment (Fig. 8 &). We then exmined the effect of SPSB1 on the invsion property of 21D1 cells using mtrigel coted trnswell chmer. Agin, cells were co-trnsfected with egfp construct to mrk SPSB1 expressing cells. In the sence of TGF-β, there were hrdly ny egfp lelled 21D1 cells on the ottom side of the memrne regrdless SPSB1 expression (Fig. 8c). In contrst, with TGF-β tretment ut without SPSB1 expression, mny egfp expressing cells moved through the mtrigel to the ottom side of the memrne (Fig. 8c). With SPSB1 expression, the numer of egfp lelled cells were reduced y ~ 50% (Fig. 8c). Collectively, those results demonstrte tht SPSB1- medited reduction of TGF-β signling in Rs trnsformed 21D1 cells suppresses cell migrtion nd invsion. Discussion TGF-β signling oth suppresses nd promotes tumor progression [11]. Functionlly, Rs ctivtion overides the cytosttic growth regultion of TGF-β in erly tumor development yet synergises with TGF-β signling to medite epithelil to mesenchyml trnsition (EMT) which is the sic cellulr process for tumor invsion nd metstsis
Liu et l. Cell Communiction nd Signling (2018) 16:10 Pge 11 of 15 c d Fig. 7 Oncogenic Rs enhnces TGF-β signling. Doxycycline inducile v-h-rs MDCK cells () were cultured in ± doxycycline (2 μg/ml) for 2 weeks. Cells were then trnsfected with pcaga-luc. MDCK nd 21D1 cells () were trnsfected with pcaga-luc. 293 T cells (c, d) were co-trnsfected with pcaga-luc nd indicted comintion of TβRII, TβRI, SPSB1, Rs, pcdna3 nd pef-bos constructs. In ll cses, 24 h post-trnsfection, cells were treted with ± TGF-β (2 ng/ml in ) t indicted concentrtion for further 24 h nd lysed. Luciferse ctivity ws determined s desried in Fig. 6. Dtre expressed s men reltive Smd3 luciferse ctivity (fold-induction) nd error rs represent S.D. from representtive experiments performed 3 times. * P < 0.05. Western lot of the expression levels of v-h-rs () ws conducted using the sme cell lystes for lucifersμe ssy. Results re representtive of experiments repeted t lest once [10, 11, 19]. At moleculr level, it hs een demonstrted tht persistent ctivtion of the MAPK pthwy y oncogenic Rs suppresses TGF-β/Smd signling y inhiiting the nucler ccumultion of R-Smds [24, 43, 44]. Indeed, humn colon crcinom cell lines of known Rs ctivting muttions show correltion etween the oncogenic Rs nd deficient nucler ccumultion of ctivted Smd2 nd Smd3 [24, 45]. In contrst, Rs signling hs lso een shown to up-regulte TGF-β production [27], to enhnce endogenous TGF-β signling [10]. A numer of reports hve shown tht ctivtion of Rs-MAPK pthwy cn enhnce TGF-β-medited responses in cell-specific mnner. In humn mesngil cells, ctivtion of the Erk signling medites the TGF-β-induced phosphoryltion of Smd3 nd leds to the induction of α2(i) collgen promoter ctivity [46]. Furthermore, in series of wellchrcterized tumour cell line derived from sequentil stges of mouse skin crcinogensis, ctivted H-Rs overexpression in squmous crcinom cells demonstrte tht Rs stimultes TGF-β-induced trnscription nd enhnces TGF-β-induced phosphorylted Smd2 levels [10]. However, how Rs positively regultes the TGF-β signling is not cler. The mechnisms of cross-tlk etween the Rs nd TGF-β signling re eing investigted in numer of cell lines, with controversil results [30]. Here, we provide the first experimentl evidence tht Rs cn positively regulte the TGF-β signling y mediting the protein degrdtion of SPSB1, newly discovered negtive regultor of TβRII. This leds to the stiliztion of TβRII. The initil evidence tht led to the notion tht Rs destilizes SPSB1 ws the difficulty expressing it in Rs trnsformed 21D1 cells, while its degrdtion defective mutnt SPSB1Δ ws redily to e expressed (Fig. 1). SPSB1 contins unique SPRY domin which medites protein-protein interction [35, 39] nd indeed, we identified this domin ws involved in its interction with Rs (Fig. 2). Endogenous Rs interction with SPSB1 is supported y the oservtion of light nd (MYC) in lne 5 in Fig. 2, nd to less extent in the lst lne in Fig. 2f. Importntly, single mino cid muttion (Y129A) in the SPRY domin disrupted not only Rs-SPSB1 interction (Fig. 2), lso negted the ility of Rs to destilize SPSB1 (Fig. 4c). Using the known SPSB1 recognition motif (D-I- N-N-N-X) [39, 41, 42], we hve previously identified similr motif in TβRII (N 234 -I-N-H-N-T 239 ) mediting its interction with SPSB1 [31]. Use this pproch, we
Liu et l. Cell Communiction nd Signling (2018) 16:10 Pge 12 of 15 c Fig. 8 Reducing TGF-β signling in oncogenic Rs trnsformed MDCK cells y SPSB1 suppresses cell migrtion nd invsion. 21D1 cells ( nd c) were co-trnsfected with egfp construct nd FLAG-SPSB1 or pef-bos for 48 h. Cell monolyers () were then scrtched s descried in mterils nd methods, treted with ± TGF-β (2 ng/ml) nd phse contrst/fluorescence imges were recorded t 0 nd 24 h post-scrtching. Totl cell numer (denomintor) nd egfp expressing cell numer (numertor) tht migrted into the wounded re were counted nd represented s reltive cell migrtion in B. Similr results were otined in three independent experiments. c Following DNA trnsfection, cell were collected nd re-seeded into the upper chmer of 8 μm pore mtrigel-coted trnswell pltes (mtrigel 1:1 mixed with DMEM, 70 μl/well) ± TGF-β (2 ng/ml) s indicted for nother 24 h. Cells tht migrted to the ottom side of the upper chmer were then fixed nd stined with Hoechst dye. Imges were tken using fluorescence microscope (mgnifiction = 20 ) in 4 rndom fields. Totl cell numer (denomintor) nd egfp expressing cell numer (numertor) tht migrted to the ottom side of the upper chmer were counted nd represented s reltive cell migrtion. Brs represent the men ± S.D. of triplicte wells from one of three representtive experiments identified short sequence, I84-N-N-T-K88, in Rs s cndidte SPSB1 intercting motif. However, Rs(N85A) nd Rs(N86A) mutnts did not disrupt the Rs-SPSB1 interction (Fig. 2f nd Additionl file 1: Figure S4), indicting there re other recognition motifs for SPSB1. In serching of them, we ligned the sequences of Rs nd cmet (which lso intercts with SPSB1 without contining the D-I-N-N-N-X motif), identifying n identicl short sequence (D120-L-A-A-R124). Interestingly, muttions within this sequence (Rs(D120A, R124A)) resulted in reduced expression level ut showed likely enhnced interction with SPSB1 (Additionl file 1: Figure S3 nd Figs. 5 nd 6). The exct motif, which differs from the currently known ones, in mediting Rs-SPSB1 interction is yet to e identified. Polyuiquitintion is the generl mechnsim leds to protein degrdtion [42] nd polyuiquitintion of SPSB1 is oserved (Fig. 3, [31]). Surprisingly, Rs expression hd little effect on the polyuiquitintion levels of SPSB1 (Fig. 3), even though Rs hs destilizing effect on SPSB1 (Fig. 4). Crful nlysis of SPSB1
Liu et l. Cell Communiction nd Signling (2018) 16:10 Pge 13 of 15 Fig. 9 Schemtic illustrtion of Rs enhncing TGF-β signling through decresing of SPSB1, TβRII uiquitintion regultor. SPSB1 intercts with TβRII/TβRI (RII/RI), resulting in polyuiquitintion nd degrdtion of the type II receptor (lck rrows). Rs intercts with SPSB1, resulting in its protein level decrese through mono-, di-uiquitintion of SPSB1 (green rrows). Consequentluy, Rs enhnces TGF-β signling uiquitintion reveled enhncement of mono-, di- nd possily tri-uiquitintion of SPSB1 y Rs (Fig. 3). Whether those mono-, di- nd tri-uiquitintionmedited degrdtion of SPSB1 is new mechnsim of protein degrdtion in ddition to the norml polyuiquitintion requires further investigtion. The consequence of Rs-medited destiliztion of SPSB1 is the stiliztion of TβRII (Fig. 5). Like some erly reports [33], we demonstrted tht incresed TGF-β receptor levels, prticulrly TβRII, enhnced TGF-β signling sentsitivity (Fig. 6). As such, Rs enhnces TGF-β signling through stilizing TβRII. It is prticulrly evident in the Rs trnsformed mesenchyml 21D1 cells tht TGF-β signling is much enhnced in comprison with the prentl epithelil MDCK cells through incresed TGF-β receptor levels (Figs. 1 nd 7). This is the first time moleculr link is demonstrted in which Rs enhnces TGF-β signling (Fig. 9). Furthermore, this Rs-medited enhncement of TGF-β signling ppers to e responsile for the incresed migrtion nd invsion of mesenchyml 21D1 cells since the expression of SPSB1 reduced TGF-β signling nd migrtion nd invsion (Fig. 8). This moleculr mechnism underlines the synergistic effect of Rs nd TGF-β signling in mediting EMT. Recently, SPSB2 hs een shown to interct with inos nd trgets inos for protesoml degrdtion, hence, regulting nitric oxide (NO) production in prsite killing [42]. Soon fter, the sme group hs lso demonstrted tht SPSB1 is the only SPSB fmily memer to e regulted y the sme toll-like receptor (TLR) pthwys tht induce inos expression. And SPSB1 cts through negtive-feedck loop tht, together with SPSB2, controls the extent of inos induction nd NO production [47]. On the other hnd, Rs proteins hve een shown to positively regulte the nitric oxide synthse fmily proteins [48, 49]. Our identifiction of the negtive regultory effect of Rs on SPSB1 my provide moleculr link etween the Rs pthwy nd the nitric oxide synthse pthwy. Conclusions We identify Rs s the first negtive regultor of SPSB1. In ddition, we lso uncover new mechnism of how Rs up-regultes the TGF-β signling. Rs downregultes SPSB1 y inducing its protein degrdtion. This leds to the up-regultion of the TGF-β receptors nd consequently, results in the high TGF-β signling ctivity (Fig. 9). This is the first report tht directly involves Rs protein in the up-regultion of the TGF-β signling. Additionl files Additionl file 1: Figure S1. EGF stimultion hs no effect on SPSB1 protein degrdtion. 293 T cells were trnsfected with FLAG-SPSB1. 40 h post-trnsfection, cells were exposed to cycloheximide (20 μg/ml) for indicted periods with or without EGF (50 μg/ml, 5 mins pretreted) nd lysed. Cell lystes were exmined for indicted proteins y immunolotting (IB). Results re representtive of experiments repeted t lest once. Figure S2. EGF stimultion does not lter the interction etween endogenouse Rs nd SPSB1. 293 T cells were trnsfected with FLAG-SPSB1. 48 h post-
Liu et l. Cell Communiction nd Signling (2018) 16:10 Pge 14 of 15 trnsfection, indicted cells were stimulted with EGF (50 μg/ml) for 10 min nd lysed. Therefter, cell lystes were immunoprecipitted (IP) with nti-rs ntiody conjugted with protein G eds. Both whole cell lystes nd immunoprecipttes were exmined for indicted proteins y immunolotting (IB). Results re representtive of experiments repeted t lest once. Figure S3 6. v-h-rs N85A, v-h-rs N86A nd v-h-rs D120A, R124A mutnts do not disrupt their ility to interct with SPSB1. 293 T cells (S.3, 4, 5, 6) were trnsfected with indicted DNA constructs for 48 h. Therefter, cell lystes were immunoprecipitted (IP) with nti-spsb1 niody (S.4) or nti-myc ntiody (S.5) or nti-rs ntiody (S.6) conjugted with protein G eds. Both whole cell lystes nd immunoprecipttes were exmined for indicted proteins y immunolotting (IB). In ll cse, ech experiment ws repeted t lest once, one representing result is shown. (PPT 3970 k) Additionl file 2: Figure S7. v-h-rs N85A nd v-h-rs N86A increse the degrdtion rte of SPSB1. 293 T cells were co-trnsfected with indicted FLAG-SPSB1 nd v-h-rs/v-h-rs mutnt/pcdna3 control vector for 24 h, then cells were treted with TGF-β (2 ng/ml). 36 h post-trnsfection, cells were exposed to cycloheximide (20 μg/ml) for indicted periods nd lysed. Whole cell lystes were then exmined for indicted proteins y immunolotting (IB). Results re representtive of experiments repeted t lest once. Figure S8. TGF-β receptors levels regulte TGF-β signling sensitivity nd durtion. MDCK cells were co-trnsfected with pcaga-luc nd indicted TβRII nd/or TβRI nd/or pcdna3 control vector. 24 h lter, cells were treted with ± TGF-β t indicted concentrtion for further 24 h nd lysed. Luciferse ctivity ws determined s desried in Fig. 6. Dtre expressed s men reltive Smd3 luciferse ctivity (fold-induction) nd error rs represent S.D. from representtive experiments performed 3 times. * P <0.05.Figure S9 & 10. Induced expression of SPSB1 suppresses TGF-β signling in Rs trnsformed 21D1 cells through destilizing TβRII. Doxycycline inducile FLAG-SPSB1 21D1 cells were cultured in ± doxycycline (2 μg/ml) for 2 (S.10) or 7 dys (S.9). Whole cell lystes (S.9) were then exmined for indicted proteins y immunolotting (IB). Cells (S.10) were then trnsfected with pcaga-luc. 24 h post-trnsfection, cells were treted with ± TGF-β (0.2 ng/ml) for further 24 h nd lysed. Luciferse ctivity ws determined s desried in Fig. 6. Dt re expressed s men reltive Smd3 luciferse ctivity (fold-induction) nd error rs represent S.D. from representtive experiments performed 3 times. * P < 0.05. In ll cse, ech experiment ws repeted t lest once, one representing result is showing. Figure S11 & 12. FLAG-SPSB1 nd egfp co-expression in the cells. 293 T cells (S.11) nd 21D1 cells (S.12) were co-trnsfected with egfp construct nd FLAG-SPSB1/MYC-SPSB1 Y129A s indicted for 48 h. Fixed cells were stined with Hoechst dye. FLAG-SPSB1 ws immunostined with mouse nti-flag ntiody followed y Alex546-conjugted secondry nti-mouse IgG. MYC-SPSB1 Y129A ws immunostined with mouse nti-myc ntiody followed y Alex546-conjugted secondry nti-mouse IgG. The expression of SPSB1/SPSB1 mutnt (red) nd egfp ws nlyzed y fluorescent microscope (mgnifiction = 20 ) in 4 rndom fields. (PPT 3720 k) Acknowledgements Not pplicle. Funding This work ws prtilly supported y Austrlin Commonwelth Government Ntionl Helth nd Medicl Reserch Council (NHMRC) funding to H-JZ (#433618&433619). Avilility of dt nd mterils Avilility in supplementry dt. Authors contriutions SL nd JI conducted ll the experiments, RJS nd H-JZ initited the work, H-JZ designed ll experiments in consulttion with SL, JI&RJS. SL&H-JZ drfted the mnuscript nd JI&RJS mde modifictions. All uthors red nd pproved the finl mnuscript. Ethics pprovl nd consent to prticipte Gene mnipultions were conducted in ccording with University of Melourne Gene Technology nd Biosfety Committee (IBC No 301) pprovl 2014/008. Consent for puliction All uthors consent for puliction. Competing interests The uthors declre tht they hve no competing interests. Pulisher s Note Springer Nture remins neutrl with regrd to jurisdictionl clims in pulished mps nd institutionl ffilitions. Author detils 1 Deprtment of Surgery (RMH), The University of Melourne, The Royl Melourne Hospitl, Prkville, VIC 3010, Austrli. 2 Deprtment of Biochemistry, L Troe Institute for Moleculr Science, L Troe University, Bundoor, VIC, Austrli. Received: 8 Ferury 2018 Accepted: 5 Mrch 2018 References 1. Zhu HJ, Burgess AW. Regultion of trnsforming growth fctor-et signling. Mol Cell Biol Res Commun. 2001;4:321 30. 2. Mrkowitz S, Wng J, Myeroff L, Prsons R, Sun L, Lutterugh J, Fn RS, Zorowsk E, Kinzler KW, Vogelstein B, et l. Inctivtion of the type II TGFet receptor in colon cncer cells with microstellite instility. Science. 1995;268:1336 8. 3. Hhn SA, Schutte M, Hoque AT, Moskluk CA, d Cost LT, Rozenlum E, Weinstein CL, Fischer A, Yeo CJ, Hrun RH, Kern SE. DPC4, cndidte tumor suppressor gene t humn chromosome 18q21.1. Science. 1996;271:350 3. 4. Ds P, Mduzi LL, Pdgett RW. Genetic pproches to TGFet signling pthwys. Cytokine Growth Fctor Rev. 1999;10:179 86. 5. Akhurst RJ, Derynck R. TGF-et signling in cncer doule-edged sword. Trends Cell Biol. 2001;11:S44 51. 6. Akhurst RJ, Blmin A. Genetic events nd the role of TGF et in epithelil tumour progression. J Pthol. 1999;187:82 90. 7. Welch DR, Fr A, Nkjim M. Trnsforming growth fctor et stimultes mmmry denocrcinom cell invsion nd metsttic potentil. Proc Ntl Acd Sci U S A. 1990;87:7678 82. 8. Cui W, Fowlis DJ, Bryson S, Duffie E, Irelnd H, Blmin A, Akhurst RJ. TGFet1 inhiits the formtion of enign skin tumors, ut enhnces progression to invsive spindle crcinoms in trnsgenic mice. Cell. 1996;86: 531 42. 9. Oft M, Heider KH, Beug H. TGFet signling is necessry for crcinom cell invsiveness nd metstsis. Curr Biol. 1998;8:1243 52. 10. Oft M, Akhurst RJ, Blmin A. Metstsis is driven y sequentil elevtion of H-rs nd Smd2 levels. Nt Cell Biol. 2002;4:487 94. 11. Derynck R, Akhurst RJ, Blmin A. TGF-et signling in tumor suppression nd cncer progression. Nt Genet. 2001;29:117 29. 12. Downwrd J. Trgeting RAS signlling pthwys in cncer therpy. Nt Rev Cncer. 2003;3:11 22. 13. Bos JL. Rs oncogenes in humn cncer: review. Cncer Res. 1989;49:4682 9. 14. Der CJ. The rs fmily of oncogenes. Cncer Tret Res. 1989;47:73 119. 15. Chin L, Tm A, Pomerntz J, Wong M, Holsh J, Brdeesy N, Shen Q, O'Hgn R, Pntginis J, Zhou H, et l. Essentil role for oncogenic Rs in tumour mintennce. Nture. 1999;400:468 72. 16. Birchmeier C, Birchmeier W. Moleculr spects of mesenchyml-epithelil interctions. Annu Rev Cell Biol. 1993;9:511 40. 17. Hy ED. An overview of epithelio-mesenchyml trnsformtion. Act Ant (Bsel). 1995;154:8 20. 18. Grunert S, Jechlinger M, Beug H. Diverse cellulr nd moleculr mechnisms contriute to epithelil plsticity nd metstsis. Nt Rev Mol Cell Biol. 2003; 4:657 65. 19. Jnd E, Lehmnn K, Killisch I, Jechlinger M, Herzig M, Downwrd J, Beug H, Grunert S. Rs nd TGF[et] coopertively regulte epithelil cell plsticity nd metstsis: dissection of Rs signling pthwys. J Cell Biol. 2002;156: 299 313.