Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c

Similar documents
control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

SUPPLEMENTARY INFORMATION

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1

Supplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

SUPPLEMENTARY INFORMATION

Supplementary Figure 1

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure 1

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Figure 1

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

Tissue factor-par2 signaling promotes diet-induced obesity and adipose

ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)

SUPPLEMENTARY INFORMATION

(#4685) and p- AKT (S473) Rb mab (#9271) purchased from cell signaling Technology (Beverly,

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

Figure S1A. Blood glucose levels in mice after glucose injection

1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8

Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

a b c Physical appearance of mice Lean mass Adipocyte size d e f

Supplementary Figures

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

Supplementary Information

Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and

Fig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT

Supplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia

Effect of BI-1 on insulin resistance through regulation of CYP2E1

For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin

Supplementary Figure 1

FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle

Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow

Supplementary Figure 1

SUPPLEMENTARY INFORMATION

Supplementary Materials for

Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice

Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h)

COPD lungs show an attached stratified mucus layer that separate. bacteria from the epithelial cells resembling the protective colonic

Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue. Rinke Stienstra

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

Table 1. Oligonucleotides and RT-PCR conditions Supplementary Material and Methods Fig. 1

Gut Microbiomes of Malawian Twin Pairs Discordant for Kwashiorkor

High Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]

Supplementary methods:

Supplementary Figures

An introduction to the COCVD Metabolic Phenotyping Core

Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),

Supplemental data Supplemental Figure Legends Supplemental Figure 1. Supplemental Figure 2.

Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were

SUPPLEMENTARY INFORMATION

Supplemental Table 1. Primer sequences for transcript analysis

Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment

Nature Immunology: doi: /ni eee Supplementary Figure 1

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

Supplementary Figure 1

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr

Control. csarnt -/- Cre, f/f

glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

Metformin activates a duodenal Ampk-dependent pathway to lower hepatic glucose production

Supplementary Figures

Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets

Gut Reaction. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD

Supplementary Figure 1

chapter 1 - fig. 2 Mechanism of transcriptional control by ppar agonists.

The Gut Microbiota: Evidence For Gut Microbes as Contributors to Weight Gain

Transcription:

ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless of gender. ody weights from ages 7 to 23 weeks in male (left) and female (right) and mice fed normal chow diet.

ody weight (g) 24 22 2 18 16 Supplementary Figure 2. Lean phenotypes of mice were also detected in mice given the high-fat diet (HFD). The body weight of and mice (n = 4) were monitored following feeding with HFD for 3 weeks. Data shown are at age 12 weeks and are mean ± s.e.m. Statistical analyses were done with two-tailed paired t-test. P<.5.

Relative mrna expression Relative mrna expression pg / ml of serum A 8 6 4 2 1.5 1. F4/8 2. 1.5 TNFα 1..5.5 C Small Intestine Large Intestine Supplementary Figure 3. Lean phenotypes of 24-week-old mice were not associated with inflammation. (A) Levels of proinflammatory cytokines in serum of and mice (total n = 7) by cytometric bead array mouse-inflammatory kit (D iosciences). () mrna expression levels of F4/8 (left) and TNFα (right) in adipose tissue by real-time PCR. (C) Hematoxylin-eosin staining of small and large intestines. Scale bar = 1 μm. Data shown are the mean values ± SEM from individual mice from 2 independent experiments with 3 to 5 mice per experiment. Statistical analyses were done with two-way ANOVA with onferroni post-hoc test (A) and two-tailed paired t- test (). P<.5;, not significant.

Orthogonal component 1 Modeled correlation A 6 1. 4 2 Lactic acid. -2-4 Acetic acid utyric acid C -6-6 -4-2 2 4 6 Acetate 15 12 9 6 3 Predictive component utyrate 4 3 2 1 4 3 2 1 Propionate 1 8 6 4 2 Lactate Propionic acid -1. -.8 -.4..4.8 Covariance Supplementary Figure 4. Orthogonal partial least squares discriminate analysis (OPLS-DA) of fecal metabolome data of and mice. (A) Cross-validated score plots from OPLS-DA of 1 H-nuclear magnetic resonance (NMR) data in feces of and mice (total n = 7). () S-plots for predictive component from OPLS-DA of 1 H-NMR data of in feces of and mice (total n = 7). (C) Quantification of shortchain fatty acids (i.e., acetate, butyrate, and propionate) and lactate in feces of and mice (total n = 7) by gas chromatography-mass spectrometry. Data shown are the mean values ± SEM from individual mice from 2 independent experiments with 3 to 4 mice per experiment. Statistical analyses were done with two-tailed paired t-test. P<.5, P<.1.

ody weight (g) 32 3 (S) (CH) (CH) (S) 28 26 24 15 16 17 18 19 2 21 Age (weeks) Supplementary Figure 5. Compeatory body weight of mice in co-housing (CH) cages and shared fecal microbes. ody weights of (n = 5) and (n = 4) mice in CH cages. ody weights of and mice housed separately (S) are shown by linear graphs of filled gray and blue circles, respectively.

EF62759_s DQ815942_s DQ815871_g_uc EF62759_f_uc_s acteroides acidifacie acteroides sartorii 4P363_s EF64598_s EF46456_s Parabacteroides distasonis A21165_s EF96_s EF63769_s DQ815871_s EU622763_s EU791194_s A66322_s AY239469_g_uc acteroidales_uc_s EF46459_s DQ815748_s EF97615_s EF64981_s EF4686_s EF6376_s HM12428_g_uc A66319_s acteroides_uc EF6319_s EF46536_s EF62759_g_uc EF46817_s EU457676_s acteroides uniformis EU456683_s EF4683_s Prevotellaceae_uc_s EF9757_s HM123997_s FJ511984_s acteroides coprocola EF63121_s EF63835_s EF46481_s EF46712_s EF46368_s Parabacteroides_uc EF63734_s A66279_s EU643_s FJ88499_s DQ815599_s EU6213_s A66254_s EF46417_s EF46766_s FJ879877_s EF63798_s EF63662_s HQ74248_s JQ8513_s DQ815311_s EU5541_s EU791177_s EF64622_s Pseudoflavonifractor_uc A626943_s EF6461_s Oscillibacter_uc GQ451281_s Lachnospiraceae_uc_s HM123978_s A66283_s DQ815599_g_uc DQ815781_s Lactobacillus brevis Ruminococcaceae_uc_s EU51538_s EU6321_s Coprobacillus_f_uc_s Faecalibacterium prausnitzii FJ881243_s EF64623_s A626922_s EF6288_s 4P1451_s JQ84524_s DQ81597_s AJ38395_s HM124141_s Helicobacter mastomyrinus Parasutterella excrementihominis A2741_s 4P3191_s EF46813_s Mycoplasmataceae_f1_uc_s AJ4239_s DQ7779_s AJ4239_g_uc Mucispirillum schaedleri ETC Supplementary Figure 6. Color legend of pyrosequencing data for species levels in feces of mice shown in Fig. 3C.

Relative abundance (%) 6 5 4 3 2 1 5 Supplementary Figure 7. iological assignment of acteroides contigs in DNA metagenomes. The comparison of relative abundance of contigs number in feces of and mice (total n = 6). Data shown are the mean values ± SEM from individual mice from 2 independent experiments with 3 mice per experiment. Statistical analyses were done with two-way ANOVA with onferroni post-hoc test. P<.5; P<.1;, not significant.

Colony-Forming Units A 15 1 -CH -CH 5 - CH - CH 216 bp 15 15 Supplementary Figure 8. Expanded were determined in feces of mice co-housed with mice. (A) Colony-forming units (CFUs) of. acidifacie on acteroides ile Esculin (E) agar with feces of and mice (n = 3) in co-housing (CH) cage for 23 weeks. () Representative gel images of PCR analysis using -specific primer (F : 5 -CTGCCTCATACTCGGGGATA-3, R : 5 - CGTAGGAGTTTGGACCGTGT- 3 ; product size : 216 bp). The 15 colonies were randomly picked per plate for DNA templates. Data shown are the mean values ± SEM from individual mice. Statistical analyses were done with two-tailed paired t-test. P<.5.

A Nil Day 1 after feeding DAPI. acidifacie number (x1 7 / g) 25 2 15 1 5 Nil 1 2 3 4 5 Days after administration Supplementary Figure 9. Orally administered. acidifacie () can temporarily reside in colon. Colon tissues and feces were obtained at Nil and on days 1 5 after oral administration of (5 1 9 CFU / 1 μl ; total n = 6) and stained with -specific FISH (fluorescence in situ hybridization) probes. (A) Representative confocal images of (white arrows) in the colon tissues. () Quantification of in the feces at indicated time points. were counted in 2 regio per slide. Data shown are the mean values ± SEM from individual mice from 3 independent experiments with 2 mice per experiment. Statistical analyses were done with two-way ANOVA with onferroni post-hoc test. P<.1;, not detected.

Energy expenditure (kcal kg -1 hr -1 ) Total activity (x1 4 ) (beam breaks per day) RER (VCO 2 / VO 2 ) lood glucose (mg dl -1 ) lood glucose (mg dl -1 ) (mm 2 ) (μm 2 ) ody weight change Food uptake (g / mouse / day) A C NCD (%) 18 16 14 12 1 8 1 2 3 4 5 6 7 8 9 1 (Weeks) Area 4 35 3 25 2 D 4 3 2 1 8 6 4 2 Area E 4 3 2 GTT 3 2 ITT 1 1 F 26 22 3 6 9 Time (min) 12 6 4 3 6 9 Time (min) 12 1. 18 14 2.75 Light Dark 1 2 4 6 8 1 12 14 16 18 2 22 Light Dark.5 Light Dark 2 4 6 8 1 12 14 16 18 2 22 Supplementary Figure 1. Effective functio of. acidifacie () in regulating body weight and fat mass in normal chow diet (NCD)-fed 6 mice given or. (A) Representative photos and body weight over 1 weeks (left and right panels, respectively). was administered orally (5 1 9 CFU / 1 μl) daily (total n = 1). () Oral food intake with or. (C) Magnetic resonance imaging analysis (total n = 6). (D) Histological changes of adipose tissues (left panel) and size of adipocytes (right panel) of - and -fed mice during NCD (total n = 6). (E) Glucose tolerance test (GTT) (left panel, n = 9) and iulin tolerance test (ITT) (right panel, total n = 12) results by time point after intraperitoneal injection of glucose or iulin. (F) Energy expenditure, total activity, and respiratory exchange ratio (RER) of - or -fed mice (total n = 1). Data shown are the mean values ± SEM from individual mice from 2 independent experiments with 3 to 6 mice per experiment. Statistical analyses were done with two-tailed paired t-test (-D) and with two-way ANOVA with onferroni post-hoc test (A and E-F). P<.5, P<.1, P <.1;, not significant.

ody weight change Food uptake (g / mouse / day) A (%) 26 22 18 NCD+ NCD+S HFD+ HFD+S 4 3 2 NCD + NCD + S HFD + HFD + S 14 1 1 1 2 3 4 5 6 7 8 9 1 Weeks post administration Supplementary Figure 11. Mice given. sartorii (S) and normal-chow diet (NCD) or highfat diet (HFD) had similar body weight and food intake. (A) ody weight over 1 weeks following oral administration of S (total n = 1) (5 1 9 CFU / 1 μl). () Oral food intake with or S (total n = 1). Data shown are the mean values ± SEM from individual mice from 2 independent experiments with 5 mice per experiment. Statistical analyses were done with two-way ANOVA with onferroni post-hoc test (A) and two-tailed paired t-test ()., not significant.

mg/kg/min mg/kg/min Glucose infusion rate (GIR) 75 6 Hepatic glucose production (HGP) 3 15 Heat-inactivated 45 3 15-15 -3 Supplementary Figure 12.. acidifacie () administration improves both hepatic and peripheral iulin seitivity. Hyperiulinemic-euglycemic clamp studies of -, heat-inactivated -fed mice for 6 weeks and their control mice (total n = 6) fed a normal chow diet. Infusion dose of iulin during the clamp study were determined 3mU based on preliminary experiments. Whole-body glucose uptake (peripheral iulin seitivity, A) and iulin-mediated suppression of hepatic glucose production rates (hepatic iulin seitivity, ) are significantly increased in -fed mice compared to heat inactivated -fed group. Data shown are the mean values ± SEM from individual mice from 2 independent experiments with 3 mice per experiment. Statistical analyses were done with two-tailed paired t-test. P<.5;, not significant.

A Acetate utyrate Propionate Lactate ( P =.5742 ) ( P =.28 ) ( P =.693 ) ( P =.934) 12 25 25 5 1 2 2 4 8 15 15 3 6 4 1 1 2 2 5 5 1 Acetate ( P =.8652 ) 2 15 1 5 utyrate ( P =.596 ) 2. 1.5 1..5 Propionate ( P =.215 ) 6. 4.5 3. 1.5 Lactate ( P =.9693) 1..8.6.4.2 Supplementary Figure 13. Levels of short-chain fatty acids (SCFAs) and lactate in feces after oral. acidifacie () administration for 1 weeks. Levels of acetate, butyrate, propionate, and lactate in feces measured by gas chromatographymass spectrometry in mice given normal chow diet (A; total n = 6) or high-fat diet (; total n = 6). Data shown are the mean values ± SEM from individual mice from 2 independent experiments with 3 mice per experiment. Statistical analyses were done with two-tailed paired t-test. P<.1;, not significant.

Relative mrna expression Relative mrna expression A Fatty acid synthesis β-oxidation Thermogenesis 2.5 2. 1.5 1..5 2. Fatty acid synthesis β-oxidation Thermogenesis 1.5 1..5 Supplementary Figure 14. Similar expression levels of lipid oxidation in livers and small intestines of and mice. Expression level of mrna genes related to fatty acid synthesis (FasN, HSL, PEPCK, SCD1, and PPARγ), β-oxidation (PPARα), and thermogenesis (PRDM16, PGC1a, Cidea, and GLUT4) were determined by real-time PCR using livers (A) and small intestines () of and mice (total n = 8). Data shown are the mean values ± SEM from individual mice from 2 independent experiments with 3 to 5 mice per experiment. Statistical analyses were done with two-way ANOVA with onferroni post-hoc test.

Area (x 1 3, μm 2 ) A 2 15 1 5 Supplementary Figure 15.. acidifacie () administration does not induce β-cell overstimulation. Pancreas tissues were obtained from mice (total n = 6) administrated with (5 1 9 CFU / 1 μl) for 1 weeks. (A) Representative confocal images of islets (red color for α-cell and green color for β-cell). Scale bar = 5 μm. The sectio were sequentially reacted with mouse anti-glucagon immunoglobulin G (IgG) Ab (K79b1; Sigma-Aldrich, St. Louis, MO) and rabbit polyclonal anti-iulin Ab (Santa Cruz iotechnology, Santa Cruz, CA), and then PE-conjugated anti-mouse IgG (eioscience, San Diego, CA) and FITC-conjugated anti-rabbit IgG (eioscience, San Diego, CA), respectively. () The size of β-cells region was quantified using ImageJ software program. The islet were randomly selected in 1 regio per slide. Data shown are the mean values ± SEM from individual mice from 2 independent experiments with 3 mice per experiment. Statistical analyses were done with two-tailed paired t-test. P<.1;, not significant.

Triglyceride (mg dl -1 ) Total cholesterol (mg dl -1 ) Triglyceride (mg dl -1 ) Total cholesterol (mg dl -1 ) Triglyceride (mg dl -1 ) Total cholesterol (mg dl -1 ) Triglyceride (mg dl -1 ) Total cholesterol (mg dl -1 ) A 5 12 4 3 2 1 9 6 3 15 1 8 6 6 6 6 6 4 5 2 C 8 6 4 2 15 1 5 1 8 6 4 2 3 2 1 NCD HFD Supplementary Figure 16. Triglyceride and cholesterol levels were similar in serum of, fecal microbiota traplantation (FMT), and. acidifacie ()-fed mice. Concentratio of serum triglycerides and total cholesterol were analyzed using enzymatic assay kits in mice (A; total n = 5), FMT mice (; total n = 5), and -fed mice (C; total n = 5). Data shown are the mean values ± SEM from individual mice from 2 independent experiments with 2 to 3 mice per experiment. Statistical analyses were done with two-tailed paired t-test., not significant. NCD, normal chow diet; HFD, high-fat diet.

(nmol / g feces) (nmol / g feces) (nmol / g feces) (nmol / g feces) (nmol / g feces) 1 85 7 3 2 1 1 5 A (2) 3 2 1 1 5 (3) 15 5 6 C (2) 4 15 1 8 D (1) E-F (5) 5 4 3 2 3 4 1 2 15 1 5 3 G (25) 8 6 4 2 1 H (1) 2 1 5 12 I (1) 7 L-M (12) 9 5 6 4 3 2 2 1 25 N (31) 8 O (9) 15 5 3 6 4 2 1 2 1 5

(nmol / g feces) (nmol / g feces) (nmol / g feces) (nmol / g feces) 3 P (26) 3 U-X (13) 2 1 2 1 2 45 1 3 15 R-S (19) 7 5 3 1 6 4 2 4 3 2 1 4 3 2 1 T (2) 3 1'- & 2'- (23) 2 1 12 9 6 3 2 3'- & 4'- (21) 4 3 2 1 3 5'- & 6'- & 7'- (15) 1 2 1 Supplementary Figure 17. The profiles of 292 metabolites in feces of and mice. The metabolites in feces of and mice (n = 7) were measured by capillary electrophoresis timeof-flight mass spectrometry (CE-TOF-MS). All metabolites are arranged in alphabetical order. Data shown are the mean values ± SEM from individual mice. Statistical analyses were done with two-way ANOVA with onferroni post-hoc test. P<.5, P<.1 and P<.1;, not detected.

Colony-Forming Units (Log 1 ) 7 6 5 4 3 2 1 6 24 Time for co-culture (hours) Supplementary Figure 18.. acidifacie () can be regulated by autophagy machinery of CD11c + cells. Numbers of in bone marrow-derived CD11c + cells were determined on EG agar plate at 6 and 24 hours after co-cultured with (MOI=1). one marrow were obtained from or mice (total n = 6). Data shown are the mean values ± SEM from individual mice from 3 independent experiments with 2 mice per experiment. Statistical analyses were done with two-tailed paired t-test. P<.5;, not detected.