Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,

Similar documents
ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed

Supplementary Figure 1.

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies

Metformin inhibits hepatic gluconeogenesis in mice independently of the LKB1/AMPK pathway via a decrease in hepatic energy state

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

SUPPLEMENTARY INFORMATION

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

SUPPLEMENTARY INFORMATION

Salt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice

Effect of BI-1 on insulin resistance through regulation of CYP2E1

Supplementary Information

Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

SUPPLEMENTARY INFORMATION

7/31/2009. G.Y. Prince Used Cars 10 am Los Angelos, CA Mullholland Drive..later that day. Would you buy a car without taking it for a spin first?

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin

Requires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c

1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

AN ABSTRACT OF THE DISSERTATION OF. Sasmita Tripathy for the Doctor of Philosophy in Nutrition presented on July 11, 2012.

The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism

Hepatic insulin signaling regulates VLDL secretion and atherogenesis in mice

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Endothelial PGC 1 - α 1 mediates vascular dysfunction in diabetes

Supplementary Information

Identified proteins interacting with TMBIM1 by mass spectrometry

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

HSP72 HSP90. Quadriceps Muscle. MEF2c MyoD1 MyoG Myf5 Hsf1 Hsp GLUT4/GAPDH (AU)

SREBPs suppress IRS-2-mediated insulin signalling in the liver

Supporting Information Table of content

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

Modifications of Pyruvate Handling in Health and Disease Prof. Mary Sugden

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages

Ginsenoside Rg1 Inhibits Glucagon-Induced Hepatic Gluconeogenesis through Akt-FoxO1 Interaction

SUPPLEMENTARY INFORMATION

Jang, H; Lee, GY; Selby, CP; Lee, G; Jeon, YG; Lee, JH; Cheng, KY; Titchenell, P; Birnbaum, MJ; Xu, A; Sancar, A; Kim, JB

Supplementary Figure 1

Supplementary Figure 1

Synthesis of Substituted 2H-Benzo[e]indazole-9-carboxylate as Potent Antihyperglycemic Agent that May Act through IRS-1, Akt and GSK-3β Pathways

Regulation of Hepatic Gluconeogenesis by an ER-Bound Transcription Factor, CREBH

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Information. Cryptochrome Mediates Circadian Regulation of camp. Signalling and Hepatic Gluconeogenesis

Last updated Glycogen synthesis, glycogenolysis, and gluconeogenesis in primary mouse hepatocytes

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

SUPPLEMENTARY INFORMATION

Figures S1-S5, Figure Legends, Table S1 List of primers used in the study

Insulin-inducible SMILE inhibits hepatic gluconeogenesis

Supplementary Figure 1

Hepatic insulin signaling regulates VLDL secretion and atherogenesis in mice

Supplementary Figure 1.

SUPPLEMENTARY INFORMATION

glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged

Plasma exposure levels from individual mice 4 hours post IP administration at the

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)

Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Phospho-AKT Sampler Kit

a b c Physical appearance of mice Lean mass Adipocyte size d e f

Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene. Fig. S1. STING ligands-mediated signaling response in MEFs. (A) Primary MEFs (1

Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury

Body Mass Index Chart = overweight; = obese; >40= extreme obesity

Gene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D

Excessive intake of diets rich in fat results in the. Endoplasmic Reticulum Stress Promotes LIPIN2-Dependent Hepatic Insulin Resistance

SUPPLEMENTARY FIGURES AND TABLE

2.5. AMPK activity

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

REGULATION OF GLUCOSE HOMEOSTASIS THROUGH XBP1-FOXO1 INTERACTION

Supplementary Materials and Methods

Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice.

PEPCK. The Regulation of Eukaryotic Gene Expression. Why choose PEPCK? PEPCK. PEPCK overexpression in muscle. The Supermouse.

Transcriptional coactivator NT-PGC-1a promotes gluconeogenic gene expression and enhances hepatic gluconeogenesis

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Figure S1A. Blood glucose levels in mice after glucose injection

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Glucocorticoids, Metabolism and Metabolic Diseases

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress

Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3

TITLE: Maintenance of Glucose Homeostasis through Acetylation of the Metabolic Transcriptional Coactivator PGC-1alpha

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Contents Materials and Methods Figs. S1 and S8 References and Notes

SUPPLEMENTARY INFORMATION

B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer

Adiponectin suppresses gluconeogenic gene expression in mouse hepatocytes independent of LKB1-AMPK signaling

Hepatic gluconeogenesis is essential for maintenance

Transcription:

SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp, shmkp-3, shfoxo1 at MOI 5. For RNA extraction, cells were incubated in William s E medium containing.5% SA, 1 μm dexamethasone and 1 mm 8-bromo-cAMP for 8 hr forty-eight hours post infection. For glucose production, cells were incubated in William s E medium containing.5% SA, 1 μm dexamethasone and 1 mm 8-bromocAMP for 5 hr forty-eight hours post infection, then incubated in.5 ml/well of phenol red-free, glucose-free DMEM containing 1μM dexamethasone, 2 mm pyruvate, 2 mm lactate and 1mM 8-bromo-cAMP for 3h. Medium was collected and subjected to glucose measurement. The glucose output rate was normalized by cellular protein content. Immunolocalization Fao cells were infected with adenoviruses expressing a control protein (an inactive kinase) or MKP-3. Twenty-four hours post infection, cells were transfected with GFP- FOXO1 expression plasmid. Forty-eight hours after infection, cells were incubated in serum-free RPMI 164 medium in the presence of Veh, 1μM Dex or 1μM Dex plus 1ng/ml insulin overnight. Next day, cells were incubated in serum-free and glucosefree DMEM medium supplemented with 2mM sodium pyruvate and 2mM sodium lactate for another three hours in the presence of veh, Dex or Dex plus insulin. Cells were 39

then fixed in 5% PS-buffered formalin for 1 minutes and examined for FOXO1 localization. Mouse model To study the regulation of MKP-3 protein by hormones, glucagon was injected into lean mice fasted for 3 hours at the dose of 1mg/kg i.p. and livers were collected 1, 5 and 2 hours post injection; insulin was injected into lean mice fasted for 6 hours at the dose of.5u/kg, and livers were collected 1, 5 and 2 hours post injection. Male ob/ob mice were purchased from The Jackson Laboratory at 7 weeks of age and fed on a chow diet with 5% calories derived from fat. After one week of acclimation, ob/ob mice were randomized into two groups with equal body weight and postprandial blood glucose levels. Adenoviruses expressing shgfp or shmkp-3 were injected at the dose of 3x1 9 pfu/mouse via tail vein. Mice were sacrificed in fasted condition for plasma and tissue collection. 4

Saline 1h Glucagon 1h Saline 1h Insulin 1h Saline 5h Glucagon 5h Saline 5h Insulin 5h Saline 2h Glucagon 2h Saline 2h Insulin 2h MKP-3/Tubulin 2.5 2. 1.5 1..5. Saline + + + Glucagon + + + 1h 5h 2h MKP-3/Tubulin 1..8.6.4.2. Saline + + + Insulin + + + 1h 5h 2h Supplemental Figure 1. Regulation of MKP-3 protein by glucagon and insulin. A. Effect of glucagon on expression of MKP-3 protein in the liver of lean mice (n=4 each group).. Effect Of insulin on expression of MKP-3 protein in the liver of lean mice (n=3-4 each group). P<.5, hormone treated group vs. saline treated group.

MKP-3 mrna C E G6Pase 1 Glucose (nm/mg protein) 8 6 4 2 Dex GFP MKP-3 - - GFP MKP-3 + + 4 3 2 1 GFP MKP-3 GFP MKP-3 12 9 6 3 1 2 3 4 1 2 3 4 GFP MKP-3 GFP MKP-3 PEPCK D PGC-1α 6 5 4 3 2 1 GFP MKP-3 GFP MKP-3 3 2 1 GFP MKP-3 GFP MKP-3 Supplemental Figure 2. MKP-3 overexpression in rat primary hepatocytes. A-E. MKP-3 overexpression in rat primary hepatocytes. MKP-3 is overexpressed in rat primary hepatocytes through adenovirus-mediated gene transfer. Expression of MKP-3 (A), PEPCK (), G6Pase (C), and PGC-1α (D) genes as well as glucose output (E) was measured. P<.5, bar 2 vs.1; 4 vs. 3. P<.5, bar 3 vs. 1.

FAS 1..8.6.4.2. PEPCK 2.5 2. 1.5 1..5. VLCAD PDK4 1.8 1.6 1.4 1..8.6.4.2. 6 5 4 3 2 1 PGC-1a G6Pase 3 2 1 4 3 2 1 shgfp shmkp3 shgfp shmkp3 shgfp shmkp3 shgfp shmkp3 PS Dex PS Dex Supplemental Figure 3. Gene expression analysis in DIO mice with reduced hepatic MKP-3 expression. FAS was measured in fed state and the rest genes were measured in fasted state. P<.5, mice injected with Ad-shGFP vs. mice injected with Ad-shMKP-3.

Relative MKP-3 mrna 1..8.6.4.2. Ob/ob, shgfp Ob/ob, shmkp-3 MKP-3 Tubulin ob/ob shgfp ob/ob shmkp-3 C ody weight (gram) 5 45 4 35 3 25 2 15 1 5 Ob/ob, shgfp Ob/ob, shmkp-3 Glucose (mg/dl) 5 45 4 35 3 25 2 15 1 5 Ob/ob, shgfp Ob/ob, shmkp-3 Supplemental Figure 4. MKP-3 knockdown in the liver of ob/ob mice. Male ob/ob mice in C57L/6J background were injected with adenoviruses expressing either shgfp or shmkp-3 at the dose of 3x1 9 pfu/mouse. ody weight and blood glucose levels were measured in fasted state. Liver samples were collected on the same day in fasted state for determination of MKP-3 mrna and protein levels. A. Relative MKP-3 mrna level (n=6 each group);. MKP-3 protein expression (n=6 each group); C. ody weight and glucose levels (n=14-16 each group)., P<.5, mice injected with Ad-shGFP versus mice injected with Ad-shMKP-3.

C MKP-3 mrna G6Pase 2.8 2.1 1.4.7 1 2 3 4 1 2 3 4. shgfp shmkp-3 shgfp shmkp-3 7 6 5 4 3 2 1 shgfpshmkp-3 shgfpshmkp-3 PEPCK D PGC-1α 4 3 2 1 shgfpshmkp-3 shgfpshmkp-3 7. 6. 5. 4. 3. 2. 1.. shgfpshmkp-3 shgfpshmkp-3 E Glucose (nm/mg.protein) 4 35 3 25 2 15 1 5 shgfpshmkp-3 shgfp shmkp-3 Supplemental Figure 5. MKP-3 knockdown in rat primary hepatocytes. MKP-3 is knocked down in rat primary hepatocytes through adenovirusmediated expression of a short hairpin interfering RNA against MKP-3. Expression of MKP-3 (A), PEPCK (), G6Pase (C), and PGC-1α (D) genes as well as glucose (E) output was measured. Dex, Dexamethasone. P<.5, bar 2 vs.1; 4 vs. 3. P<.5, bar 3 vs. 1.

C E Relative MKP-3 expression Relative PEPCK expression Relative FOXO1 expression 6 5 4 3 2 1 1.4 1..8.6.4.2. 2. 1.8 1.6 1.4 1..8.6.4.2. D F Relative PGC-1α expression Relative G6Pase expression Glucose (μm/μg protein) 4. 3.5 3. 2.5 2. 1.5 1..5. 4.5 4. 3.5 3. 2.5 2. 1.5 1..5..6.5.4.3.2.1. GFP + - + - MKP-3 - + - + shgfp + + - - shfoxo1 - - + + GFP + - + - MKP-3 - + - + shgfp + + - - shfoxo1 - - + + Supplemental Figure 6. Effect of FOXO1 knockdown on MKP-3 stimulated glucose production. A. Relative MKP-3 mrna levels in rat primary hepatocytes infected with Ad-shGFP or Ad-shMKP-3 together with Ad-shScramble or Ad-shFOXO1; -E. Relative PGC-1α, PEPCK, G6Pase and FOXO1 mrna levels in the same cells as described in A; F. Glucose production in the same cells as described in A. P<.5.

Insulin - - + + GFP + - + - MKP-3 - + - + Insulin - - + + GFP + - + - MKP-3 - + - + MKP-3 IP: IR; WS: P-Tyr IP: IR; WS: IR IP: IRS-1; WS:P-Tyr IP: IRS-1; WS: IRS-1 p-akt Ser 473 Akt p-akt Thr 38 Akt Tubulin Control+Veh MKP3+Veh Control+Dex MKP3+Dex Control+Dex/Ins MKP3+Dex/Ins Supplemental Figure 7. Effect of MKP-3 on insulin signaling and FOXO1 nuclear translocation. A. Effect of MKP-3 over-expression on insulin signaling.. Effect of MKP-3 over-expression on FOXO1 nuclear translocation. Representative fluorescent photos of GFP-FOXO1 expressing cells under various conditions. Veh, Vehicle; Dex, dexamethasone; Ins, insulin.

Firefly/Renilla 7 6 5 4 3 2 1 Vec + + + - CRTC2 - + - + MKP-3 - - + + PEPCK-Luc + + + + Firefly/Renilla 3.5 3. 2.5 2. 1.5 1..5. Vec + + + - CRTC2 - + - + MKP-3 - - + + PEPCK-Luc + + + + Supplemental Figure 8. CRTC2 and MKP-3 on transcription of gluconeogenic genes. A. CRTC2 and MKP-3 do not have additive effect on transcription of PEPCK promoter.. CRTC2 and MKP-3 do not have additive effect on transcription of G6Pase promoter. P<.5 as indicated.