SALSA MLPA probemix ME011-B3 Mismatch Repair genes Lot B3-1017 and B3-0715. As compared to the previous version B2 (lot B2-0614), one probe has a small change in length but no change in the sequence detected. The Mismatch Repair (MMR) system is critical for the maintenance of genomic stability. Defects in the cell s MMR system may lead to the accumulation of mutations resulting in the initiation of cancer. Several MMR genes are involved in hereditary nonpolyposis colon cancer (HNPCC). Mutations in the MLH1 and MSH2 genes have been found in about 90% of HNPCC cases. Mutations in other MMR genes are less frequently detected in HNPCC patients. In sporadic colon cancer hypermethylation is a more frequent mechanism than point mutations for transcriptional silencing of the MLH1 gene. Methylation analysis of MLH1 by MS-MLPA can improve the selection of patients for genetic testing for Lynch syndrome (Perez-Carbonell L et al. 2010, J Mol Diagn. 12:498-504). This ME011-B3 Mismatch Repair genes MS-MLPA probemix has been developed to detect aberrant CpG island methylation of several MMR genes and includes six probes for MLH1 (3p22.1), four probes for MSH2 (2p21), three probes for MSH6 (2p16), three probes for PMS2 (7p22), two probes for MSH3 (5q14.1), and one probe for MLH3 (14q24.3). Furthermore, this probemix contains six probes specific for the MGMT promoter region at 10q26. MGMT promoter methylation is an important molecular marker in various tumours such as glioblastomas. MGMT plays a role in removing O(6)-alkylguanine, which is the major mutagenic and carcinogenic lesion induced by alkylating mutagens. This probemix includes 22 probes containing a HhaI recognition site, which yields information about the methylation status of a target sequence. In addition, 13 reference probes are present which are not influenced by the HhaI digestion. Besides the detection of aberrant methylation, all probes present will give information on copy number changes in the analysed sample. More information about MS-MLPA can be found on page 3. This SALSA MS- probemix can be used to detect aberrant methylation of one or more sequences of the MMR genes in a DNA sample. Methylation levels can be different for different tissues. If possible, use identically treated test and reference samples (same tissue type and extraction method). This SALSA MS- probemix can also be used to detect deletions and duplications of one or more sequences of the MMR genes. Heterozygous deletions of probe recognition sequences should give a 35-50% reduced relative peak height of the amplification product of that probe. Note that a mutation or polymorphism in the sequence detected by a probe can also cause a reduction in relative peak height, even when not located exactly on the ligation site! In addition, some probe signals are more sensitive to sample purity and small changes in experimental conditions. Therefore, deletions and duplications detected by MLPA should always be confirmed by other methods. Not all deletions and duplications detected by MLPA will be pathogenic; users should always verify the latest scientific literature when interpreting their findings. Finally, note that most defects in this gene are expected to be small (point) mutations which will not be detected by this SALSA MS- test. We have no information on what percentage of defects in these genes is caused by deletions/duplications of complete exons. This SALSA MLPA probemix is not CE/FDA registered for use in diagnostic procedures. Purchase of this product includes a limited license for research purposes. The use of this SALSA MS- probemix and reagents requires a thermocycler with heated lid and sequence type electrophoresis equipment. Different fluorescent PCR primers are available. The MLPA technique has been first described in Nucleic Acid Research 30, e57 (2002). The MS-MLPA method for the detection of both copy numbers and methylation changes was described in Nucleic Acid Research 33, e128 by Nygren et al. 2005. More information Website : www.mlpa.com E-mail : info@mlpa.com (information & technical questions); order@mlpa.com (for orders) Mail : bv; Willem Schoutenstraat 1, 1057 DL Amsterdam, the Netherlands SALSA probemix ME011 Mismatch Repair genes Page 1 of 11
Related SALSA probemixes P003 MLH1/MSH2: Hereditary nonpolyposis colon cancer (HNPCC) genes included: MSH2, MLH1. P072 MSH6: HNPCC genes included: MSH6, MUTYH, EPCAM. P248 MLH1/MSH2: HNPCC confirmation genes included: MSH2, MLH1. P008 PMS2: HNPCC gene included: PMS2. References for SALSA MS- probemix ME011 Mismatch Repair genes Zauber P et al. (2017) Molecular genetic changes in benign colorectal tumors synchronous with microsatellite unstable carcinomas do not support a field defect. Int J Mol Epidemiol Genet.. 8:27-39. Takahashi K et al. (2017) Clinical characteristics of Lynch-like cases collaterally classified by Lynch syndrome identification strategy using universal screening in endometrial cancer. Gynecol Oncol. 47:388-95. Morak M et al. (2017) Loss of MSH2 and MSH6 due to heterozygous germline defects in MSH3 and MSH6. Familial cancer. 16:491-500. Kato A et al. (2016) Isolated Loss of PMS2 Immunohistochemical Expression is Frequently Caused by Heterogenous MLH1 Promoter Hypermethylation in Lynch Syndrome Screening for Endometrial Cancer Patients. Am J Surg Pathol. 40:770-776. Zauber P et al. (2015) Strong correlation between molecular changes in endometrial carcinomas and concomitant hyperplasia. Int J Gynecol Cancer. 25:863-8. Sahnane N et al. (2015) Microsatellite unstable gastrointestinal neuroendocrine carcinomas: a new clinicopathologic entity. Endocr Relat Cancer. 22:35-45. Castillejo A et al. (2015) Prevalence of MLH1 constitutional epimutations as a cause of Lynch syndrome in unselected versus selected consecutive series of patients with colorectal cancer. J Med Genet. 52:498-502. Mur P et al. (2014) Identification of a founder EPCAM deletion in Spanish Lynch syndrome families.clin Genet. 85:260-6. Crucianelli F et al. (2014) MLH1 constitutional and somatic methylation in patients with MLH1 negative tumors fulfilling the revised Bethesda criteria. Epigenetics. 9:1431-8. Molenaar RJ et al. (2014) The combination of IDH1 mutations and MGMT methylation status predicts survival in glioblastoma better than either IDH1 or MGMT alone. Neuro Oncol. 16:1263-73. Appelqvist F et al. (2014) Deletion of the MGMT gene in familial melanoma. Genes Chromosomes Cancer. 53:703-11. Rodríguez-Hernández I et al. (2013) Integrated analysis of mismatch repair system in malignant astrocytomas. PLoS One. 8(9):e76401. Ozer O et al. (2013) Methylation profile analysis of DNA repair genes in hepatocellular carcinoma with MS- MLPA. Diagn Mol Pathol. 22:222-7. Jensen LH et al. (2013) Regulation of MLH1 mrna and protein expression by promoter methylation in primary colorectal cancer: a descriptive and prognostic cancer marker study. Cell Oncol. 36:411-9. Pineda M et al. (2012) MLH1 methylation screening is effective in identifying epimutation carriers. Eur J Hum Genet. 20:1256-64. Gausachs M et al. (2012) MLH1 promoter hypermethylation in the analytical algorithm of Lynch syndrome: a cost-effectiveness study. Eur J Hum Genet. 20:762-8. Christians A et al. (2012) Prognostic value of three different methods of MGMT promoter methylation analysis in a prospective trial on newly diagnosed glioblastoma. PLoS One. 7:e33449. Zauber NP et al. (2010) Microsatellite instability and DNA methylation of endometrial tumors and clinical features in young women compared with older women. Int J Gynecol Cancer. 20:1549-56. Perez-Carbonell L et al. (2010) Methylation analysis of MLH1 improves the selection of patients for genetic testing in Lynch syndrome. J Mol Diagn. 12:498-504. Ligtenberg MJ et al. (2009) Heritable somatic methylation and inactivation of MSH2 in families with Lynch syndrome due to deletion of the 3' exons of TACSTD1. Nat Genet. 41:112-7. Gylling A et al. (2009) Large genomic rearrangements and germline epimutations in Lynch syndrome. Int J Cancer. 124:2333-40. Jeuken JW et al. (2007) MS-MLPA: an attractive alternative laboratory assay for robust, reliable, and semiquantitative detection of MGMT promoter hypermethylation in gliomas. Lab Invest. 87:1055-65. Note: Here are the most relevant references for this probemix. PubMed and Google Scholar provide more information on the use of ME011 probemix. SALSA probemix ME011 Mismatch Repair genes Page 2 of 11
Please note During testing on various tumour samples, we have observed that many probes show significant signal change depending on the methylation status of the target DNA. However, as we have little access to patient samples, it is unfortunately not possible for to validate each probe on samples with known decreased mrna levels and of which the methylation status of the sequences has been confirmed by independent methods. The MS-MLPA probes target promoter regions which are unmethylated in normal blood-derived control samples, and they do not generate a signal after HhaI digestion. We have tested each probe by in vitro methylation of sample DNAs with HhaI methylase, and found that each signal indeed remains intact after HhaI digestion. Methylation-specific MLPA Please note that each MS-MLPA reaction generates two samples that need analysis by capillary electrophoresis: one undigested sample for copy number detection and one digested sample for methylation detection. A modification of the MLPA technique, MS-MLPA allows the detection of both copy number changes and unusual methylation levels of 10-50 different sequences in one simple reaction. MLPA probes for methylation quantification are similar to normal MLPA probes, except that the sequence detected by the MS-MLPA probe contains the sequence recognised by the methylation-sensitive restriction enzyme HhaI. Similar to ordinary MLPA reactions, the MS-MLPA protocol starts with sample DNA denaturation and overnight hybridisation. The reaction then is split into two tubes. One tube is processed as a standard MLPA reaction. This reaction provides information on copy number changes. The other tube of the MLPA hybridisation reaction is incubated with the methylation-sensitive HhaI endonuclease while simultaneously, the hybridised probes are ligated. Hybrids of (unmethylated) probe oligonucleotides and unmethylated sample DNA are digested by the HhaI enzyme. Digested probes will not be exponentially amplified by PCR and hence will not generate a signal when analysed by capillary electrophoresis. In contrast, if the sample DNA is methylated, the hemi-methylated probe-sample DNA hybrids are prevented from being digested by HhaI and the ligated probes will generate a signal. The MS-MLPA technique should always be internally validated before use in your laboratory. Results of MS- MLPA are highly dependent on the HhaI enzyme used. HhaI enzymes that are resistant to heat inactivation are NOT compatible with the MS-MLPA technique and will give aberrant results. These include, but may not be limited to, Thermo Fisher Scientific enzymes HhaI, ANZA 59 HhaI, and FastDigest HhaI. We recommend using Promega s HhaI enzyme (R6441) as this is the only restriction enzyme that has been validated for use with MS-MLPA by. More information about MS-MLPA can be found in the MS-MLPA protocol. Please note that this product can not be used with an alternative protocol in which the genomic DNA is first digested with HhaI, followed by MLPA reactions on both digested and undigested genomic DNA. Data analysis The ME011-B3 Mismatch Repair genes probemix contains 38 MLPA probes with amplification products between 130 and 418 nt. In addition, it contains 9 control fragments generating an amplification product smaller than 120 nt: four DNA Quantity fragments (Q-fragments) at 64-70-76-82 nt, three DNA Denaturation control fragments (D-fragments) at 88-92-96 nt, one X-fragment at 100 nt and one Y-fragment at 105 nt. More information on how to interpret observations on these control fragments can be found in the MLPA protocol. The analysis of MS-MLPA probemixes consists of two parts: 1) determining copy numbers by comparing different undigested samples, and 2) determining methylation patterns by comparing each undigested sample to its digested counterpart (MS-MLPA probemixes only). The second part is unique for MS-MLPA probemixes and serves to semi-quantify the percentage of methylation within a given sample. 1) Copy number analysis - Selection of reference probes SALSA probemix ME011 Mismatch Repair genes Page 3 of 11
First select suitable reference probes for copy number detection. These are probes detecting relatively quiet regions in the particular type of tumour studied. The reference probes selected will therefore depend on the application. Probes that are suitable to use for reference in many types of tumour are indicated in Table 1. - Intra-sample data normalisation For analysis of MLPA results, not the absolute fluorescence values but intra-normalised data are used (relative peak heights). The data generated in the undigested sample should first be normalised intra-sample by dividing the signal of each probe by the signal of every reference probe in that sample, thus creating as many ratios per probe as there are reference probes. Subsequently, the median of all these produced ratios per probe should be taken; this is the probe s Normalisation Constant. This Normalisation Constant can then be used for sample to reference sample comparison. - Inter-sample normalisation (comparison with reference samples) The final probe ratio, or ploidy status, of each probe in each sample is calculated by dividing a) the Normalisation Constant of each probe obtained on the undigested test sample by b) the average Normalisation Constant of that probe obtained on the undigested reference samples. 2) Methylation analysis - Selection of reference probes Use the reference probes for methylation as marked in Table 1. All reference probes used for methylation analysis do not contain a HhaI site. - Intra-sample data normalisation For analysis of MLPA results, not the absolute fluorescence values but intra-normalised data are used (relative peak heights). The data generated in the digested sample should first be normalised intra-sample by dividing the signal of each probe by the signal of every reference probe in that sample, thus creating as many ratios per probe as there are reference probes. Subsequently, the median of all these produced ratios per probe should be taken; this is the probe s Normalisation Constant. This Normalisation Constant can then be used for sample to reference sample comparison. - Methylation analysis (comparison with reference samples) The methylation status of each MS-MLPA probe* in each sample is calculated by dividing a) the Normalisation Constant of each probe obtained on the digested test sample by b) the Normalisation Constant of each MS- MLPA probe obtained on the corresponding undigested sample. Multiplying this value by 100 gives an estimation of the percentage of methylation. Aberrant methylation can then be identified by comparing the methylation status of one or more MS-MLPA probes in the sample in question to that obtained on reference samples. *Note: An MS-MLPA probe usually targets a single specific HhaI site in a CpG island; if methylation is absent for a particular CpG-site, this does not necessarily mean that the whole CpG island is unmethylated! Data normalisation should be performed within one experiment. Only samples purified by the same method should be compared. Confirmation of most exons deletions and amplifications can be done by e.g. Southern blotting, long range PCR, qpcr, FISH. Warning: MLPA analysis on tumour samples provides information on the average situation in the cells from which the DNA sample was purified. Gains or losses of genomic regions or genes may not be detected if the percentage of tumour cells is low. Furthermore, there is always a possibility that one or more reference probes do show a copy number alteration in a sample. Normal copy number variation in healthy individuals is described in the database of genomic variants: http://dgv.tcag.ca/dgv/app/home. When in doubt, users should always verify the latest updates of the database and scientific literature when interpreting their findings. Note that Coffalyser.Net, the MLPA analysis tool developed at, can be downloaded free of charge from our website www.mlpa.com. This probemix was developed at. Info/remarks/suggestions for improvement: info@mlpa.com. SALSA probemix ME011 Mismatch Repair genes Page 4 of 11
Table 1. SALSA MS-MLPA ME011-B3 Mismatch Repair genes probemix Length (nt) SALSA MLPA probe HhaI site % expected signal reduction Chromosomal position MV location (HG18) 64-70-76-82 Q-fragments: DNA quantity; only visible with less than 100 ng sample DNA 88-92-96 D-fragments: Low signal of 88 or 96 nt fragment indicates incomplete denaturation 100 X-fragment: Specific for the X chromosome 105 Y-fragment: Specific for the Y chromosome 130 Reference probe 03896-L00020 - - 11q13 11-069.957 137 Reference probe 03797-L04594 - - 21q22 21-037.920 142 PMS2 probe 07935-L16571 + 100 7p22.1 07-006.015 149 MLH1 probe 01685-L01265 - - 3p22.2 03-037.010 154 PMS2 probe 11966-L13112 + 100 7p22.1 07-006.015 160 MSH6 probe 06228-L05731 + 100 2p16.3 02-047.864 166 MLH1 probe 01686-L15580 + 100 3p22.2 03-037.010 172 MGMT probe 14133-L15736 + 95 10q26.3 10-131.156 178 Reference probe 00554-L13113 - - 12p13 12-006.321 184 MSH2 probe 06227-L07711 + 100 2p21 02-047.484 190 + Reference probe 11954-L12774 - - 20p12 20-005.243 196 MLH1 probe 06222-L07712 + 100 3p22.2 03-037.010 202 MGMT probe 05670-L14276 + 100 10q26.3 10-131.155 208 MSH6 probe 06230-L05733 + 100 2p16.3 02-047.864 214 MGMT probe 12250-L14205 + 100 10q26.3 10-131.156 220 MSH3 probe 07940-L14208 + 95 5q14.1 05-079.986 232 Reference probe 02334-L13114 - - 12q23 12-101.795 238 MLH1 probe 07187-L07710 + 100 3p22.2 03-037.009 247 MSH2 probe 11634-L12398 - - 2p21 02-047.510 256 Reference probe 09646-L09804 - - 17q25 17-072.958 265 MLH1 probe 06221-L01747 + 100 3p22.2 03-037.010 274 MSH2 probe 06142-L00599 + 100 2p21 02-047.484 283 MSH3 probe 11947-L00795 - - 5q14.1 05-079.986 292 MLH1 probe 02258-L01745 + 100 3p22.2 03-037.010 301 MSH6 probe 06229-L05732 + 100 2p16.3 02-047.864 310 Reference probe 09065-L15938 - - 19p13 19-013.289 321 + Reference probe 15301-L19330 - - 9q34 09-134.768 328 Reference probe 15055-L04802 - - 11p15 11-002.551 338 PMS2 probe 07934-L16147 + 95 7p22.1 07-006.015 346 ๑ MGMT probe 13716-L15582 + 100 10q26.3 10-131.155 355 MLH3 probe 07941-L07722 + 100 14q24.3 14-074.588 364 Reference probe 01234-L00781 - - 10p14 10-011.017 373 Reference probe 04727-L04144 - - 7q21 07-086.891 382 Reference probe 02459-L01903 - - 15q21 15-046.572 391 «MGMT probe 14136-L12791 + 95 10q26.3 10-131.155 400 MSH2 probe 06141-L13115 + 100 2p21 02-047.484 409 ๑ MGMT probe 14135-L16573 + 95 10q26.3 10-131.156 418 + Reference probe 13553-L12763 - - 16p13 16-002.061 Changed in version B3 (from lot B3-0715 onwards). Small change in length, no change in sequence detected. Target sequence of this probe contains SNP rs104894994 (C/T) in the GCGC site, 6 nt right from the ligation site. When the T-allele of this validated SNP (with an allele frequency of 0.068%) is present, HhaI digestion will not occur, resulting in a false methylated site. «This probe is located within, or close to, a very strong CpG island. A low signal of this probe can be due to incomplete sample DNA denaturation, e.g. due to the presence of salt in the sample DNA. + The genomic region targeted by this reference probe is reported to be variable in healthy individuals according to database of genomic variants. More variable. This probe has a high standard deviation. This probe may be sensitive to certain experimental variations. Aberrant results should be treated with caution. ๑ The significance of methylation of CpG site targeted by this probe is not clear. Note: The identity of the genes detected by the reference probes is available in Table 2b. Please notify us of any mistakes: info@mlpa.com. SALSA probemix ME011 Mismatch Repair genes Page 5 of 11
Table 2. ME011 probes arranged according to chromosomal location Table 2a. Target probes arranged according to chromosomal location. Length (nt) SALSA MLPA probe Gene/ Exon Ligation site Partial sequence, for copy number probes (24 nt adjacent to ligation site)/ Complete sequence, for MS-MLPA probes (HhaI site is highlighted in grey) Distance to next probe MSH2, at 2p21 The indicated ligation sites are in the NM_000251.2 sequence (NG_007110.2), with the MSH2 start codon at 126-128 nt in exon 1. 184 06227-L07711 Upstream 144 nt before exon 1; 269 nt before ATG, reverse GAAACCCGCAGACGCGCATCCT- TAGTAGAGCTCCTTTCTGTGTTTACTCAGCTGCAAGGC TTG CGCAGTAGCTAAAGTCACCAGCGTGCGCGGGA- AGCTGGGCCGCGTCTGCTTATGATTGGTTGCCGC 400 06141-L13115 Upstream 67 nt before exon 1; 192 nt before ATG 0.3 kb 274 06142-L00599 Exon 1 252-253; CCTTTTCGACCGGGGCGACTTCT- 124 nt after ATG ATACGGCGCACGGCGAGGACGCGCTGCTG 26.5 kb 247 11634-L12398 Exon 7 1322-1323 AGACAAGCAGCA-AACTTACAAGAT 353.1 kb MSH6, at 2p16.3 The indicated ligation sites are in the NM_000179.2 sequence (NG_007111.1), with the MSH6 start codon at 153-155 nt in exon 1. Another MSH6 exon 1 MS-MLPA probe is present in the ME-002 probemix. 301 06229-L05732 Upstream 208 06230-L05733 Exon 1 160 06228-L05731 Exon 1 165 nt before exon 1; 317 nt before ATG 26-27; 126 nt before ATG 104-103; 49 nt before ATG, reverse CCAGCCCCGCGGCGTGAGGGA- AGGGGAGCTCAGCAGTTCCCCGCGCGGGGCC CGAGGCGCCTGTTGATTGGCCACT- GGGGCCCGGGTTCCTCCGGCGGAGCGCGCCT CGTTCTGTCGGACGGAGCTCCTAAAA- GCACCGCATCTACCGCGCGGCTCCTGCTGGCGGGAAA TCTG MLH1, at 3p22.2 The most important methylation region for MLH1 expression, the Deng C-region, is from -248 nt to -178 nt before the transcription start site. The transcription start site that Deng G et al. (1999) used for reference lies 21 nt before the ATG start codon. The second most important region, the Deng D-region, is from -9 nt to +15 nt (Capel E et al. 2007, Oncogene. 26:7596-600; Deng G et al. 1999, Cancer Research. 59:2029-33). For this reason, methylation of the 196 nt and 166 nt probes will be the most important determinant for mrna expression. It is not possible for us to design extra MLPA probes in these regions as there are no other HhaI sites. Methylation of the Deng A and B regions is not specifically correlated with loss of MLH1 expression. The indicated ligation sites are in the NM_000249.3 sequence (NG_007109.2), with the MLH1 start codon at 199-201 nt in exon 1. 238 07187-L07710 Upstream 149 01685-L01265 Upstream 265 06221-L01747 Upstream 196 06222-L07712 Upstream 166 01686-L15580 Exon 1 292 02258-L01745 Intron 1 460 nt before exon 1; 658 nt before ATG (Deng, A-region) 319 nt before exon 1; 517 nt before ATG (Deng, B-region) 184 nt before exon 1; 382 nt before ATG, reverse (Deng, B-region) 47 nt before exon 1; 245 nt before ATG (Deng, C-region) 186-187; 12 nt before ATG (Deng, D-region) 93 nt after exon 1; 206 nt after ATG TCCGCCACATACCGCTCGTAGTAT- TCGTGCTCAGCCTCGTAGTGGCGCCTGACGTCGCGTT GGCCGGAAAACT-AGAGCCTCGTCG CTGCTGAGGTGATCTGGCGCAGA- GCGGAGGAGGTGCTTGGCGCTTCTCAGGCTCCTCCTC T AAGAGCGGACAGCGATCTCTAACGCGCAA- GCGCATATCCTTCTAGGTAGCGGGCAGTAGCCGCTTCA GG TGAGCATCTAGACGTTTCCTTGGCTCT- TCTGGCGCCAAAATGTCGTTCGTGGCAGGGGTTATTC CGGACACGCCTCTTTGCCCGGGCAGA- GGCATGTACAGCGCATGCCCACAACGGCGGAGGCC MSH3, at 5q14.1 The indicated ligation sites are in the NM_002439.4 sequence (NG_016607.1), with the MSH3 start codon at 81-83 nt in exon 1. 405 nt before exon 1; TTTCTGCTGCGCGGGAGGCCCAGT- 220 07940-L14208 Upstream 0.6 kb 485 nt before ATG, reverse TGCTGATTTCTGCCCGGATTCTGCTGCCCGGTGAGGTCTT 283 11947-L00795 Exon 1 159-160 TTTTGAGCCGAT-TCTTCCAGTCTA - - - SALSA probemix ME011 Mismatch Repair genes Page 6 of 11
Length (nt) SALSA MLPA probe Gene/ Exon Ligation site Partial sequence, for copy number probes (24 nt adjacent to ligation site)/ Complete sequence, for MS-MLPA probes (HhaI site is highlighted in grey) Distance to next probe PMS2, at 7p22.1 The indicated ligation sites are in the NM_000535.6 sequence (NG_008466.1), with the PMS2 start codon at 88-90 nt in exon 1. 154 11966-L13112 Intron 1 20 nt after exon 1; 40 nt after ATG, reverse 142 07935-L16571 Exon 1 25-26; 62 nt before ATG 338 07934-L16147 Upstream 219 nt before exon 1; 306 nt before ATG GCTCGAGGTGAGCGGGGCTCGCAGTCT- TCCGGTGTCCCCTCTCGCGCGCCCTCTTTGAGAC GCCAATGGGAGTTCAGGAGGCGGA- GCGCCTGTGGGAGCCCTGGAGGGAACTTTCCCAGT GGCAGAACCAAAGCAAAAGGGGGTAGCGCGTGCCAAAG -GCCAACGCTCAGAAACCGTCAGAGGTCACGACGGAGAC MGMT, at 10q26.3 Two methylation hot spots near the transcription start site denote silencing of the MGMT gene (Qian XC and Brent TP. 1997, Cancer Res. 57:3672-7). Between these methylation hot spots is a region which is much less frequently methylated (see Figure 3 in the article of Qian and Brent). This ME011-B3 probemix includes six MS-MLPA probes for the MGMT region surrounding the transcription and translation start sites. Based on the article of Qian and Brent, as well as data obtained with this probemix by Judith Jeuken (Nijmegen), we currently recommend disregarding the results obtained with the 346 nt probe (located between the methylation hot spots and showing methylation in only rare cases) and the 409 nt probe (which shows frequent methylation, but at times in cases where the other five probes do not show any methylation). More information on the MGMT probes can be found on page 8. More MGMT probes can be found in the SALSA MLPA probemix ME012-A MGMT-IDH1-IDH2. The indicated ligation sites are in the NM_002412.4 sequence, with the MGMT start codon at 33-35 nt in exon 1. 391 «14136-L12791 Upstream 202 05670-L14276 Upstream 346 ๑ 13716-L15582 Upstream 214 12250-L14205 Intron 1 172 14133-L15736 Intron 1 409 ๑ 14135-L16573 Intron 1 400 nt before exon 1; 432 nt before ATG, reverse 314 nt before exon 1; 345 nt before ATG 61 nt before exon 1; 93 nt before ATG, reverse 73 nt after exon 1; 151 nt after ATG 154 nt after exon 1; 232 nt after ATG, reverse 385 nt after exon 1; 463 nt after ATG, reverse CGTGCAAGCGACCTGCCACGT- GCCCGAGTGGTCCTGAAAGCGCGCGGGGGTCGTAGGA CGGCGCCCGCTTAGTGAGA CGGGCCATTTGGCAAACTAAGGCACAGAGCCTCA- GGCGGAAGCTGGGAAGGCGCCGCCCGGCTTGTAC GCGGAGCCGAGGACCTGAGAAAAGCAA- GAGAGCGCGCGGGGGCGGGGCCGGG TCGGGACGGTGGCAGCCTCGAGTGGT- CCTGCAGGCGCCCTCACTTCGCCGTCGGGTGT GAAAGGCTGGGCAACACCTGGGAGGCACTT- GGGGCGCACCTGGAGCTCGCCCGGGATGGGT GGACTCTGCCTAAGTATGCTAAAGGGTTGCTGCAA- GCCAAGGCCCGCGCAGGGGCTTCTGGAAGCTTCCT MLH3, at 14q24.3 The indicated ligation sites are in the NM_001040108.1 sequence (NG_008649.1), with the MLH3 start codon at 217-219 nt in exon 2. 355 07941-L07722 Exon 1 85-86; 1792 nt before ATG CGTGGGCACGCACGAGCCTCA- AGATCCAAGGTGCGCGCGTCGGCGTCCGAGG The HhaI sites are marked in grey. Ligation sites are marked with -. Target sequence of this probe contains SNP rs104894994 (C/T) in the GCGC site, 6 nt right from the ligation site. When the T-allele of this validated SNP (with an allele frequency of 0.068%) is present, HhaI digestion will not occur, resulting in a false methylated site. «This probe is located within, or close to, a very strong CpG island. A low signal of this probe can be due to incomplete sample DNA denaturation, e.g. due to the presence of salt in the sample DNA. + The genomic region targeted by this reference probe is reported to be variable in healthy individuals according to database of genomic variants. More variable. This probe has a high standard deviation. This probe may be sensitive to certain experimental variations. Aberrant results should be treated with caution. This probe is also present in the SALSA MLPA probemix ME012-A MGMT-IDH1-IDH2. ๑ The significance of methylation of CpG site targeted by this probe is not clear. Notes Exon numbering used here may differ from literature! Please notify us of any mistakes: info@mlpa.com. Please note that several probes have multiple HhaI restriction sites. All of these sites need to be methylated in order to not be digested! - 0.3 kb - - SALSA probemix ME011 Mismatch Repair genes Page 7 of 11
Table 2b. Reference probes arranged according to chromosomal location. Length (nt) SALSA MLPA probe Gene Location Partial sequence (24 nt adjacent to ligation site) 373 04727-L04144 ABCB4 7q21 ACCAGTGTCCTT-TCTGAAGGTCCT 321 + 15301-L19330 TSC1 9q34 CAGCGTGACACT-ATGGTAACCAAG 364 01234-L00781 CELF2 (LINC00710) 10p14 GACATTCACTGT-GGAAATTTGGTG 328 15055-L04802 KCNQ1 11p15 TGGGCCTCATCT-TCTCCTCGTACT 130 03896-L00020 CTTN 11q13 AGGCAGAGCTGA-GCTACAGAGGCC 178 00554-L13113 TNFRSF1A 12p13 CCCTGAGCCCAA-ATGGGGGAGTGA 232 02334-L13114 PAH 12q23 GGTTCCCAAGAA-CCATTCAAGAGC 382 02459-L01903 FBN1 15q21 CAGTGTCCCAGT-GGAATGACTTTG 418 + 13553-L12763 TSC2 16p13 TGGCTCTGGCTT-TCACCATCCTCT 256 09646-L09804 SEPT9 17q25 AGCTGGATCAGA-TCTGAATCCAGA 310 09065-L15938 CACNA1A 19p13 CTCAGGCCTTCT-ACTGGACTGTAC 190 + 11954-L12774 PROKR2 20p12 ATTGCACTGGCA-GGCATCATGCTG 137 03797-L04594 KCNJ6 21q22 CTCGAAGCTCCT-ACATCACCAGTG MGMT probes in ME011 GGTCTCTGCTGGTCTGGGGGTCCCTGACTAGGGGAGCGGCACCAGGAGGGGAGAGACTCG CGCTCCGGGCTCAGCGTAGCCGCCCCGAGCAGGACCGGGATTCTCACTAAGCGGgcgcCG 1 TCCTACGACCCCCgcgcGCTTTCAGGACCACTCGGGCACGTGGCAGGTCGCTTGCACGCC 2 CGCGGACTATCCCTGTGACAGGAAAAGGTACGGGCCATTTGGCAAACTAAGGCACAGAGC CTCAGGCGGAAGCTGGGAAGgcgcCGCCCGGCTTGTACCGGCCGAAGGGCCATCCGGGTC 3 AGgcgcACAGGGCAGCGgcgcTGCCGGAGGACCAGGGCCGGCGTGCCGGCGTCCAGCGAG 4+5 GATgcgcAGACTGCCTCAGGCCCGgcgcCGCCGCACAGGGCATgcgcCGACCCGGTCGGG 6+7+8 CGGGAACACCCCGCCCCTCCCGGGCTCCGCCCCAGCTCCGCCCCCgcgcGCCCCGGCCCC 9 GCCCCCgcgcGCTCTCTTGCTTTTCTCAGGTCCTCGGCTCCGCCCCGCTCTAGACCCCGC 10 CCCACGCCGCCATCCCCGTGCCCCTCGGCCCCGCCCCCgcgcCCCGGATATGCTGGGACA 11 GCCCgcgcCCCTAGAACGCTTTGCGTCCCGACGCCCGCAGGTCCTCGCGGTgcgCACCGT 12+13 TTGCGACTTGGTGAGTGTCTGGGTCGCCTCGCTCCCGGAAGAGTGCGGAGCTCTCCCTCG GGACGGTGGCAGCCTCGAGTGGTCCTGCAGgcgcCCTCACTTCGCCGTCGGGTGTGGGGC 14 CGCCCTGACCCCCACCCATCCCGGGCGAGCTCCAGGTgcgcCCCAAGTGCCTCCCAGGTG 15 TTGCCCAGCCTTTCCCCGGGCCTGGGGTTCCTGGACTAGGCTGCGCTGCAGTGACTGTGG 16 ACTGGCGTGTGGCGGGGGTCGTGGCAGCCCCTGCCTTACCTCTAGGTGCCAGCCCCAGGC CCGGGCCCCGGGTTCTTCCTACCCTTCCATGCTGCCAGCTTTCCCTCCGCCAGCTGCTCC AGGAAGCTTCCAGAAGCCCCTgcgcGGGCCTTGGCTTGCAGCAACCCTTTAGCATACTTA 17 ATG = translation start codon CTC = mrna start (NM_002412.3) gcgc: HhaI sites 1 to 17 Bold/Italic: SNPs according to dbsnp141 Grey text: repeat region according to UCSC Genome Browser website Underlined is the MGMT coding sequence of exon 1. In Italic/Underlined the primers are marked (as used by Danam RP et al. 2005, Mol Cancer Ther. 4:61-69) to amplify the hot spot 1 region located from -250 nt to -101 nt with respect to the transcription start. Hot spot 2 region is located between +97 nt and +196 nt from the transcription start. MGMT probes in the ME011-B probemix (lots 1009, 0710, 0913, 0614, 0715, 1017): Probe 14136-L12791 (391 nt) is sensitive to methylation of HhaI sites 1+2 (reverse) Probe 05670-L14276 (202 nt) is sensitive to methylation of HhaI site 3 Probe 13716-L15582 (346 nt) is sensitive to methylation of HhaI site 10 (reverse) Probe 12250-L14205 (214 nt) is sensitive to methylation of HhaI site 14 Probe 14133-L15736 (172 nt) is sensitive to methylation of HhaI site 15 (reverse) Probe 14135-L16573 (409 nt) is sensitive to methylation of HhaI site 17 (reverse) SALSA probemix ME011 Mismatch Repair genes Page 8 of 11
SALSA MLPA probemix ME011-B3 Mismatch Repair genes sample pictures Figure 1. Capillary electrophoresis pattern of a sample of approximately 50 ng undigested human male control DNA analysed with SALSA MLPA probemix ME011-B3 Mismatch Repair genes (lot B3-1017) for the quantification of copy numbers. Figure 2. Capillary electrophoresis pattern of a sample of approximately 50 ng digested human male control DNA analysed with SALSA MLPA probemix ME011-B3 Mismatch Repair genes (lot B3-1017) to determine the methylation status. SALSA probemix ME011 Mismatch Repair genes Page 9 of 11
Implemented Changes compared to the previous product description version(s). Version 28 4 January 2018 (16) - New references added for ME011 on page 2. - Lengths of several probes have been modified to reflect the true amplification length in Table 1 and Table 2. - Added MV location (HG18) column in Table 1 and removed from Table 2a and 2b. - Removed two columns from Table 1 indicating whether the probes are used as references for copy number and/or methylation analysis. - Added footnotes about variable probes and non-significant MGMT MS-MLPA probes in Table 1 and Table 2a. - Added a footnote about the MGMT probes in ME012 probemix in Table 2a. - Added Distance to the next probe column in Table 2a. - Modified NM-sequence and ligation site information for MGMT probes in Table 2a. - Updated the NM-sequence version for PMS2 probes in Table 2a. - Split Table 2 into Table 2a (target probes) and Table 2b (reference probes). - Added a note about multiple GCGC sites in one MS-MLPA probe on page 7. - Modified formatting of MGMT probe sequences on page 8 for easier visualisation on black and white print. - Removed paragraph on page 8 about MGMT probed in the previous ME011-A1 version. Version 27 28 September 2017 (16) - Three probes (01685-L01265, 11634-L12398, 11947-L00795) adjusted in Table 1 as not being reference probes for methylation in the Reference Probe for methylation column. Version 26 15 February 2017 (16) - Probe length adjusted for reference probe 03797-L04594 in Table 1 and 2. - Probe length adjusted for MGMT probe 14135-L16573 in Table 1. - Minor textual and layout changes. - List of related SALSA MLPA probemixes updated. Version 25 06 December 2016 (16) - Warning regarding HhaI enzymes that are resistant to heat inactivation added under Methylation-specific MLPA section. Version 24 26 October 2015 (15) - Product description adapted to a new product version (version number changed, lot number added, small changes in Table 1 and Table 2, new pictures included). - Footnotes added for Table 1 and 2. - Expected signal reduction percentages added to Table 1. - References modified on page 2. Version 23 06 May 2015 (14) - Product description adapted to a new product version (version number changed, lot number added, small changes in Table 1 and Table 2, new pictures included). Version 22 (13) - New references added on page 2. Version 21 (13) - Product description adapted to a new product version (product version number and lot number changed, small changes in Table 1 and Table 2, new pictures included). - New references added on page 1. Version 20 (12) - Product description adapted to a new product version (version number and lot number changed, small changes in Table 1 and Table 2, new picture included). - New references added on page 1. Version 19 (8) - Electropherogram pictures using the new MLPA buffer (introduced in December 2012) added. Version 18 (8) - The ligation sites for the MSH2 probes are now indicated in Table 2 according to the new version of the reference sequence NM_000251.2. Version 17 (8) SALSA probemix ME011 Mismatch Repair genes Page 10 of 11
- Various minor textual changes. - The gene name has changed for the following probe: 364 nt (probe 01234-L00781). - Ligation sites have been updated according to new version of the NM_reference sequence Version 16 (6) - Note added about SNP present in MLH1 probe 01686-L15580 (166 nt) added to Table 1 and Table 2. Version 15 (6) - Product description adapted to a new lot (lot number added, changes in Table 1 and 2, new picture). - Various minor textual changes on page 1. Version 14 (6) - Two extra references added on page 2. Version 13 (6) - Various textual changes in table 2. - Information added about the MGMT probes on page 7. Version 12 (6) - Product description adapted to a new lot (lot number added, changes in Table 1/2, new picture). - Various minor textual changes on page 1, various minor layout changes, tables have been numbered. - Data analysis section has been modified. For copy number analysis and methylation analysis different reference probes should be used (see Table 1). SALSA probemix ME011 Mismatch Repair genes Page 11 of 11