Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC Acc2 ACAGAGATTTCACCGTTGCGT CGCAGCGATGCCATTGT Acox GTGCAGCTCAGAGTCTGTCCAA TACTGCTGCGTCTGAAAATCCA Cpt1a TGCACTACGGAGTCCTGCAA GGACAACCTCCATGGCTCAG Dgat1 TGGTGTGTGGTGATGCTGATC GCCAGGCGCTTCTCAA Fasn CTGACTCGGCTACTGACACG TGAGCTGGGTTAGGGTAGGA G6pc GTCTGGATTCTACCTGCTAC AAAGACTTCTTGTGTGTCTGTC Insig1 TCACAGTGACTGAGCTTCAGCA TCATCTTCATCACACCCAGGAC Insig2a CCCTCAATGAATGTACTGAAGGATT TGTGAAGTGAAGCAGACCAATGT Insig2b CCGGGCAGAGCTCAGGAT GAAGCAGACCAATGTTTCAATG Pck1 CCTGGAAGAACAAGGAGTGG AGGGTCAATAATGGGGCACT Pdk4 TTCCATGAGAAGAGCCCAGAAG ATCCGAGTAGAAATGCGGTTCA Phlpp1 AGGGTCCCGGAGACGATAAG AGGGCGGAGATGTCTTTTGC Phlpp2 GCCACAATCTTCTTACAGAGGTC TCGAGGGGAATGTGCTCCA PPARalpha GGGTACCACTACGGAGTTCACG CAGACAGGCACTTGTGAAAACG PPARgamma GTGCCAGTTTCGATCCGTAGA GGCCAGCATCGTGTAGATGA Scd1 CTCCTGCTGATGTGCTTCAT AGGGTGCTAACGAACAGGCT Srebp1c GAAGCTGTCGGGGTAGCGTCT CTCTCAGGAGAGTTGGCACCTG
Supplementary Figure 1 a DMSO DSS young adult young adult b DMSO DSS NCD HFD NCD HFD 2 2 2 (long) (short) (long) (short) c d 2 2 NCD HFD 1.4 1.2 P=.64 1.8.6.4.2 Rictor IgG IP: anti- DMSO DSP lean ob/ob lean ob/ob Signal intensity (a.u.) Rictor -tubulin 2 Rictor (long) 2 G L IP Rictor (short) -tubulin 2 G L 5% input
e 2 IgG IP: anti- lean ob/ob G L IP f 2 2 Ctrl -AAs Rapa Supplementary Figure 1 IP: anti- 5% input 2 G L 5% input g DMSO DSS 1 1 1 1 Insulin (nm) Supplementary Figure 1. C1-independent is reduced in insulin-resistant liver (a-c) Western blots from livers of (a) young (8-week-old) or adult (24-week-old) male mice, showing the whole blots corresponding to Figure 1c, and(b) normal chow diet (NCD) or HFD-fed male mice, crosslinked with DSS, and (c) quantitation of signal as a percentage of control (DMSO-treated liver lysate). (d,e) Western blots from livers of lean or ob/ob mice (8-week-old) following immunoprecipitation (IP) with anti-, (d) with or without prior crosslinking with DSP, (e) or in the presence of CHAPS to sustain - interaction. (f) Western blot from primary hepatocytes deprived of amino acids (-AA) or treated with rapamycin (Rapa) for 1 h prior to IP with anti-. (g) Western blot from Hepa1c1c7 cells, treated with varying concentrations of insulin for 24 hours, prior to DSS crosslinking. Statistical analysis were performed using two-way ANOVA. All data are shown as the means s.e.m. Blots are representative of three independent experiments, and samples within groups chosen randomly.
Supplementary Figure 2 a young adult Ad- Ad- -tubulin b Hepatic triglyceride (mg per mg protein).24.2.16.12.8.4 young adult aged c Liver weight (g per g BW).6.5.4.3.2.1 * Ad- d Liver weight (g per g BW).7.6.5.4.3.2.1 p=.79 Ad- Supplementary Figure 2. Rescue of free reduces liver weight and TG content in older or obese mice (a) Western blot from livers of young or adult and Ad- mice sacrificed after a 16 h fast followed by 4 h refeeding (n=6/group). (b) Hepatic TG content in young (8-week-old), adult (24-week-old) or aged (1- to 12-month-old) male mice sacrificed after a 16 h fast followed by 4 h refeeding (n=6/group). (c,d) Liver weight in (c) aged (1- to 12-month-old, n=7/group) or (d) DIO (n=5 or 4/group) and Ad- mice. *P <.5 as compared to the indicated control by two-way ANOVA. All data are shown as the means s.e.m. Blots are representative of three independent experiments, and samples within groups chosen randomly.
d mrna (a.u.) a Body weight (g) 2.5 2 1.5 1.5 35 3 25 2 15 1 5 Ad- young, young Ad-, young, adult Ad-, adult adult b ewat weight (g per g BW).24.2.16.12.8.4 Ad- young adult c NEFA (meq L -1 ) e -OH butyrate (mm).35.3.25.2.15.1.5 1.8.6.4.2 Supplementary Figure 3 Ad- young adult Ad- fasted refed f mrna (a.u.) 1.2 1.8.6.4.2 Ad- * * ** Srebp1c Fasn Acc1 Scd1 Supplementary Figure 3. Free reduces lipogenesis without affecting body weight, adiposity or fatty acid oxidation (a-e) Body weight (a), epidydimal fat pad (ewat) weight (b), non-esterified fatty acid (NEFA) levels (c), liver mrna expression (d) and plasma hydroxybutyrate levels (e) in young or adult and Ad- mice, sacrificed after a 16 h fast followed by 4 h refeeding (n=6/group). (f) Srebp1c-dependent lipogenic gene expression in primary hepatocytes transduced with or Ad- (n=4 biologic replicates). *P <.5 and **P <.1 as compared to the indicated control control by two-way ANOVA. All data are shown as the means s.e.m.
c a Hepatic protein (mg per mg liver) f 2 2 2.5.4.3.2.1 IP: anti- fasted refed Ad- Ad- Ad- young adult d young adult Ad- Ad- p-4e-bp1 (T/46) Ad- g PKC 2 p-akt (T4) C1 kinase assay Total lysates e b p-irs1 (S636/639) 2 2 Supplementary Figure 4 Ad- p-s6k1 (T389) p-s6 (S24/244) p-4e-bp1 (T/46) IgG IP: anti- Ad- young adult young adult young adult fasted refed fasted refed Ad- Ad- Ad- Ad- Rictor G L Rictor G L Rictor IP 5% input p-akt (T4) PKC Supplementary Figure 4. Increase in free levels does not affect C1 or C2 activity (a) C1 kinase activity on 4E-BP1 substrate. (b-d) Western blots (b and d) and protein concentration (c) measured from livers of adult and Ad- male mice, sacrificed after a 16 h fast followed by 4 h refeeding (n=6/group). (e-g) Western blots following IP with anti- antibody (e) from livers of young or adult and Ad- male mice, sacrificed after a 16 h fast followed by 4 h refeeding (f), or after a 16 h fast with or without 4 h refeeding (g). Blots are representative of three independent experiments, and samples within groups chosen randomly. 2 2 2 2
a adult Ad- p-gsk3 (S9) b 2 1 adult Ad- p-akt substrate Supplementary Figure 5 c mrna (a.u.) 2.5 2 1.5 1.5 ** Ad- Insig1 Insig2a Insig2b d 25 young adult Ad- Ad- p-akt (S473) Akt e Insulin (ng ml -1 ) 8 6 4 2 young adult Ad- Supplementary Figure 5. Free reduces hepatocyte Akt activity (a, b) Western blots from liver of adult or Ad- male mice, sacrificed after a 16 h fast with or without 4 h refeeding. c) Liver mrna expression in adult and Ad- mice (n=6/group). (d) Western blots from ewat of young or adult and Ad- male mice sacrificed after a 16 h fast followed by 4 h refeeding. (e) Plasma insulin levels in young or adult and Ad- male mice sacrificed after a 16 h fast followed by 4 h refeeding (n=6/group). **P <.1 as compared to the indicated control control by two-way ANOVA. All data are shown as the means Blots are representative of three independent experiments, and samples within groups chosen randomly.
d a AAV-TBG -GFP fold (a.u.) 1.5 1.5 Hepa1c1c7 fl/fl i AAV-TBG -Cre ** TBG-GFP TBG-Cre 2 Liver 2 p-s6 (S24/244) S6 e PHLPP1 fold (a.u.) 1.5 - + ++ +++ - - - - + - PHLPP1 - - - - + ++ +++ - - + - - - - - - - + + + PHLPP1 1.5 b GFP - + - - + - Rapamycin - - + - - + Torin1 AAV-TBG -GFP fl/fl AAV-TBG -Cre TBG-GFP TBG-Cre ** p-s6 (S24/244) S6 j f g IgG mrna (a.u.) 2 1.5 1.5 Supplementary Figure 6 c sh - #1 #2 Ad- Tsc2 +/+ Tsc2 -/- 2 Phlpp1 Phlpp2 IP: anti- h mrna (a.u.) DMSO MG-132 + + - + - GFP - - + - + -TrCP -TrCP 1.6 1.2.8.4 p-s6k1 (T389) S6K1 p-s6 (S24/244) S6 shrictor - + ++ 2 IP 5% input GFP Phlpp1 Rictor Phlpp2
Supplementary Figure 6 Supplementary Figure 6., but not C1 activity, post-transcriptionally regulates (a) Western blots of PHLPP isoforms from Hepa1c1c7 cells and liver. (b,c) Western blots from primary hepatocytes transduced with or Ad-, then treated with vehicle, Rapamycin, or Torin1 (b), or Tsc +/+ and Tsc2 -/- MEFs (c). (d,e) Western blot from adult (d) orhfd-fed(e) fl/fl liver transduced with AAV8-TBG-GFP or AAV8-TBG-Cre, normalized to. (f) Western blot from primary hepatocytes transduced with Ad-shControl, Ad-sh, or Ad-shRictor. (g,h) Phlpp1 and Phlpp2 gene expression in Ad- GFP or Ad--transduced liver (n=6/group) (g) or primary hepatocytes (n=4/group) (h). (i) Western blot of primary hepatocytes co-transduced with PHLPP1 or and Ad- (or control). (j) Western blot of (or GFP control)-transduced Hepa1c1c7 cells following immunoprecipitation with anti-, with or without MG-132. Blots are representative of two independent experiments. **P <.1 as compared to the indicated control control by two-way ANOVA. All data are shown as the means s.e.m. Blots are representative of three independent experiments, and samples within groups chosen randomly, unless otherwise stated.
a 2 + - - shcontrol - + - shphlpp1 - - + shphlpp2 PHLPP1 p-akt (S473) b Liver weight (g per g BW).9.8.7.6.5.4.3.2.1 Supplementary Figure 7 ** c Ad-shControl Ad-shPhlpp1 Ad-shPhlpp2 Oil Red O H&E 2 m Supplementary Figure 7. knockdown increases Akt S473 phosphorylation and causes hepatic steatosis (a) Western blot from primary hepatocytes transduced with Ad-shControl, Ad-shPhlpp1, or Ad-shPhlpp2. (b,c) Liver weight (b) and Oil-Red-O or H&E staining (c) in livers of adult Ad-shControl, Ad-shPhlpp1, or Ad-shPhlpp2 mice sacrificed after a 16 h fast followed by 4 h refeeding (n=6/group). **P <.1as compared to the indicated control by two-way ANOVA. All data are shown as the means s.e.m. Blots are representative of three independent experiments, and samples within groups chosen randomly.
Supplementary Figure 8 a b.4 c Ad-.35 4.3 Body weight (g) 3 2 1 fasted refed ewat weight (g per g BW).25.2.15.1.5 Ad- Liver weight (g per g BW).5.4.3.2.1 * Ad- Supplementary Figure 8. Rescue of aging/obesity-reduced levels prevents hepatic steatosis (a-c) body weight (a), ewat weight (b), and liver weight (c) in adult, HFD-fed or Ad- male mice, sacrificed after a 16 h fast followed by 4 h refeeding (n=6 or 7/group). *P <.5comparedtothe indicated control by two-way ANOVA. All data are shown as the means s.e.m.
a Body weight (g) 35 3 25 2 15 1 5 Ad-shControl Ad-shPhlpp1 Ad-shPhlpp2 Ad- Ad- fasted refed b ewat weight (g per g BW).2.1 Ad-shControl Ad-shPhlpp1 Ad-shPhlpp2 Ad- c -OH butyrate (mm) 1.8.6.4.2 Supplementary Figure 9 Ad-shControl Ad-shPhlpp1 Ad-shPhlpp2 Ad- Ad- fasted refed d NEFA (meq L -1 ) 3.5 3 2.5 2 1.5 1.5 Ad-shControl Ad-shPhlpp1 Ad-shPhlpp2 e Hepatic protein (mg per mg liver).7.6.5.4.3.2.1 Ad-shControl Ad-shPhlpp1 Ad-shPhlpp2 Ad- Ad- Ad- fasted refed Supplementary Figure 9. Metabolic effects of free are -dependent (a-e) Body weight (a), ewat weight (b), -hydroxybutyrate (c), NEFA levels (d), and hepatic protein concentration (e) of adult and Ad- mice co-transduced with control (Ad-shControl), AdshPHLPP1 or Ad-sh adenoviruses, sacrificed after a 16 h fast followed by 4 h refeeding (n=6/group). **P <.1 as compared to the indicated control by two-way ANOVA. All data are shown as the means s.e.m.
a Blood glucose level (mg dl -1 ) 2 16 12 8 4 Ad- fasted refed fasted refed young d Blood glucose level (mg dl -1 ) adult 18 16 14 12 1 8 6 4 2 b mrna (a.u.) 1.6 1.2.8.4 Ad- fasted 2 refed fasted refed fasted refed G6pc e Insulin (ng ml -1 ) 4.5 4 3.5 3 2.5 2 1.5 1.5 Ad- Pck1 Ad- fasted Supplementary Figure 1 c Blood glucose level (mg dl -1 ) refed 4 3 2 1, young Ad-, young, adult Ad-, adult 3 6 9 12 Time after injection (min) Supplementary Figure 1. Rescue of free or does not affect glucose homeostasis (a,b) Blood glucose levels (a) and hepatic gluconeogenic gene expression (b) in young or adult and Ad- male mice sacrificed after a 16 h fast with or without 4 h refeeding (n=6/group). (c) Intraperitoneal glucose tolerance test (GTT) in young or adult and Ad- mice (n=6/group). (d,e) Blood glucose (d) and plasma insulin levels (e) in adult, HFD-fed and Ad- male mice, sacrificed after a 16 h fast followed by 4 h refeeding (n=6 or 7/group). All data are shown as the means s.e.m.
Supplementary Figure 11 Uncropped images of the original scans of representative immunoblots Figure 1a young G L adult G L ob/ob G L
Figure 1c Top Bottom 2 2 2 2 Rictor 2 Rictor -tubulin -tubulin
Figure 1e Figure 1f Figure 2a 2 G L
Figure 3a top pakt (S473) Akt bottom pakt (S473) Akt Stripped 45 (Restore), then reprobed for actin Figure 3b top Stripped 45 (Restore), then reprobed for total Akt pakt (T38) bottom pakt (T38) Stripped 45 (Restore), then reprobed for actin
Figure 3c Figure 3d Akt kinase assay p-gsk3 (S9) Akt Total lysates Stripped 45 (Restore), then reprobed for total Akt p-akt (S473) p-akt (T38) Akt PHLPP1 2 2
Figure 3e Figure 3f p-s6 (S24/244) 25 2 2 S6 25 2
Figure 3g Figure 3h Figure 3i 2 -TrCP IP 2 HA (Ub) IP -tubulin 2 HA (Ub) 2 -TrCP 2 5% input 2 HA (Ub) 5% input 2 2 -tubulin
Figure 4b 2 PHLPP1 2 Figure 4c Figure 4d PHLPP1 2 2 PHLPP1 2 2
Figure 4e Figure 5a p-akt (S473) p-akt (T38) p-akt (T4) Akt p-akt (S473) GSK3 p-gsk3 (S9) Akt 2
Supplementary Figure 1b Supplementary Figure 1d 2 2 Rictor 2 IP G L -tubulin 5% input 2 G L
Supplementary Figure 1e Supplementary Figure 1f IP 2 IP 2 G L 5% input 2 5% input 2 G L Supplementary Figure 1g 2
Supplementary Figure 2c Supplementary Figure 4a IP 2 p-4e-bp1 (T/46) -tubulin 2 5% input 2
Supplementary Figure 4b Supplementary Figure 4d p-s6k1 (T389) ps6 (S24/244) p4e-bp1-t/46 2 p-irs1 (S636/639)
Supplementary Figure 4e Supplementary Figure 4f 2 PKC IP Rictor 2 pakt (T4) G L Stripped 45 (Restore), then reprobed for actin 2 2 Rictor 5% input G L
Supplementary Figure 4g 2 Rictor p-akt (T4) PKC Supplementary Figure 5a p-gsk3 Stripped 45 (Restore), then reprobed for actin
Supplementary Figure 5d p-akt (S473) Akt Supplementary Figure 6a Left Right 2 PHLPP1 2
Supplementary Figure 6b Supplementary Figure 6c S6K1 p-s6 (S24/244) p-s6k1 (T389) S6
Supplementary Figure 6d Supplementary Figure 6e p-s6 (S24/244) S6 p-s6 (S24/244) S6
Supplementary Figure 6f Left Right 2 Rictor
Supplmentary Figure 6i Supplementary Figure 6j PHLPP1 -TrCP IP -TrCP 5% input
Supplementary Figure 7a 2 PHLPP1 p-akt (S473)