MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

Similar documents
Citation for published version (APA): Verbeek, H. (2015). Medullary Thyroid Carcinoma: from diagnosis to treatment [S.l.]: [S.n.]

2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein

Supplementary data Supplementary Figure 1 Supplementary Figure 2

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL

Online Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

Figures S1-S5, Figure Legends, Table S1 List of primers used in the study

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis

Protocol for Gene Transfection & Western Blotting

HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of

Data Sheet TIGIT / NFAT Reporter - Jurkat Cell Line Catalog #60538

The Schedule and the Manual of Basic Techniques for Cell Culture

Supplementary Data Table of Contents:

Supplementary Figure 1

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supporting Information

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were

RayBio KinaseSTAR TM Akt Activity Assay Kit

Plasma exposure levels from individual mice 4 hours post IP administration at the

Supplementary Materials for

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

Essential Medium, containing 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin. Huvec were cultured in

Supplementary Information

Doctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,

SUPPLEMENTARY MATERIAL

1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive

Supplemental Information

SUPPLEMENTAL INFORMATION

Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3

Supplementary Materials and Methods

HIV-1 Virus-like Particle Budding Assay Nathan H Vande Burgt, Luis J Cocka * and Paul Bates

HEK293 cells transfected with human MATE1, MATE2-K, or vector control were established by

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages

Boucher et al NCOMMS B

Supporting Information

Cell Lysis Buffer. Catalog number: AR0103

SUPPLEMENTAL MATERIAL. Supplementary Methods

Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3

Validation & Assay Performance Summary

Nuclear Extraction Kit

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.

Mammalian Tissue Protein Extraction Reagent

Supplementary Materials for

Table S1. Sequence of human and mouse primers used for RT-qPCR measurements.

Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells.

PRODUCT INFORMATION & MANUAL

Supplemental Information. Inhibition of the Proteasome b2 Site Sensitizes. Triple-Negative Breast Cancer Cells

INTRODUCTION. Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells

MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function

Erzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen,

Supplementary Information Titles Journal: Nature Medicine

Protocol for purification of recombinant protein from 300 ml yeast culture

Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5

ab Nuclear Extract Kit

(Stratagene, La Jolla, CA) (Supplemental Fig. 1A). A 5.4-kb EcoRI fragment

Supplementary Data. Supplementary Methods:

ECL Plex Western Blotting Detection System

Supplemental information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC

Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

Supplementary Figure 1

Advances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016)

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Western Immunoblotting Preparation of Samples:

SUPPORTING MATREALS. Methods and Materials

Synthesis of Substituted 2H-Benzo[e]indazole-9-carboxylate as Potent Antihyperglycemic Agent that May Act through IRS-1, Akt and GSK-3β Pathways

Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival

Supplementary Figure 1

PRODUCT INFORMATION & MANUAL

Supporting Information

Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow

Dissected tissues were minced and lysed in lysis buffer (1x Tris buffered saline (TBS), 1% NP-40,

STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

TECHNICAL BULLETIN. Catalog Number RAB0447 Storage Temperature 20 C

Mammalian Cell PE LB

GLUCOSE CONCENTRATION INCREASES IGF EXPRESSION FROM SYNOVIAL MEMBRANE

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

TECHNICAL BULLETIN. Phospho-Akt (pser 473 ) ELISA Kit for detection of human, mouse, or rat phospho-akt (pser 473 ) in cell and tissue lysates

Requires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c

Nuclear Extraction Kit

Original Article Differential expression profile analysis of mirnas with HER-2 overexpression and intervention in breast cancer cells

Amersham ECL Prime Western blotting reagent

Transcription:

Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum (FBS, BioWhittaker, Lonza,Verviers, Belgium), 1% L-glutamine (Gibco) and 1% penicillin/streptomycin (Gibco). MZ-CRC-1 and HEK293 cell lines were cultured in DMEM high medium containing 4.5 g/l of glucose, L-glutamine and pyruvate (Gibco), supplemented with 15% or 10% (for HEK293) FBS and 1% penicillin/streptomycin. All cells were maintained at 37 C and 5% CO 2 atmosphere. Cell lysates and Western blot analysis Cells were washed with ice-cold PBS and incubated with lysis buffer (m-per, Thermo Fisher Scientific, Rockford, IL, USA) containing protease (Thermo Fisher Scientific) and phosphatase (Thermo Fisher Scientific) inhibitors, for 30 min on ice. Cell lysates were collected by scraping and cleared by centrifugation at 14,000 rpm for 10 min in a pre-cooled (4 C) centrifuge. The following antibodies were used for Western blot: RET (H-300), RET (C-19), p-ret (Y1062) (Santa Cruz Biotechnology, Heidelberg, Germany); ERK, p-erk (Cell Signaling, Danvers, MA, USA) and actin (C4, MP Biomedicals, Illkirch, France). Secondary antibodies used were goat anti-rabbit IgG-HRP (Bio-Rad, Veenendaal, The Netherlands) and goat anti-mouse IgG-HRP (Bio-Rad). All the experiments were performed in duplicates RNA extraction and RT-PCR Cells were washed with PBS (Gibco) and RNA extraction was performed using the RNeasy mini kit (Qiagen, Venlo, The Netherlands). First strand cdna was originated using the Ready-To-Go You- Prime First-Strand Beads kit (GE Healthcare, Zeist, The Netherlands) according to the manufacturer s instructions. The following primers were used: RET forward (5 - CCGTGAAGATGCTGAAAGAG-3 ); RET reverse (5 -AGAGGCCGTCGTCATAAATC-3 );

GAPDH forward (5 -TGAAGGTCGGAGTCAACGGATTTGGT-3 ); GAPDH reverse (5 - GCAGAGATGATGACCCTTTTGGCTC -3 ). Supplemental Table 1. IC50 concentrations of the different tyrosine kinase inhibitors in different cell lines Cell-line Compound MTC-TT MZ-CRC TPC-1 Sunitinib 0.78 + 0.19 μm 0.71 + 0.15 μm 0.37 + 0.03 μm Vandetanib 0.47 + 0.33 μm 0.26 + 0.07 μm 0.41 + 0.09 μm Axitinib 1.56 + 0.04 μm > 5 μm 1.14 + 0.03 μm XL184 0.04 + 0.03 μm > 5 μm 0.06 + 0.02 μm MTC-TT cells express a MEN2A mutation, MZ-CRC-1 cells express a MEN2B mutation, and TPC-1 cells express a RET/PTC rearrangement. Supplemental Table 2. Effect of DMSO on cell proliferation of MZ-CRC-1, MTC-TT and TPC-1 Cell proliferation Control (SD) 0 concentration (SD) Sign. MZ-CRC-1 104.7% (10.2%) 100% (7.0%) 0.35 (NS) MTC-TT 94.2% (18.4%) 100% (14.5%) 0.11 (NS) TPC-1 100.3% (10.4%) 100% (12.1%) 0.93 (NS) Control cells were grown without DMSO or inhibitors, cells in the 0 condition were grown without inhibitors but in the presence of 0.1% DMSO. Supplemental figure legends FIG. 1. Additional dose response curves for (A) MTC-TT cells treated with sunitinib, (B) MTC-TT cells treated with axitinib, (C) MZ-CRC-1 cells treated with sunitinib and (D) TPC-1 cells treated with axitinb. FIG. 2. (A) Dose response curves for HEK293 cell line incubated with different concentrations of XL184, vandetanib, sunitinib and axitinib. (B) Overview of the IC50 values (the concentration that

lead to 50% cell death) of the four tyrosine kinase inhibitors for MTC-TT, MZ-CRC-1 and TPC-1 cell lines. Error bars shown correspond to standard deviation. * Concentrations are above 5 M. FIG. 3. Effects of XL184 and vandetanib on RET mrna levels. (A) MTC-TT cells treated with IC50 concentration and 5 M of XL184 showed no effect on RET transcription levels. (B) MZ-CRC-1 cells treated with IC50 concentration and 5 M of vandetanib showed a decrease in RET transcription levels after prolonged exposure (5 days) to 5 M of this inhibitor. (C) Graphical representation of RET bands intensity after correction for GAPDH levels confirmed a reduction of RET mrna levels for MZ-CRC-1 cells after prolonged exposure to 5 M of vandetanib. MTC-TT cells express a MEN2A mutation (RET C634R) and MZ-CRC-1 cells express a MEN2B mutation (RET M918T). IC50 = concentration that leads to 50% cell death. GAPDH was used as an internal control.

Verbeek Supp. Fig1 A) C) B) D)

A) Verbeek Supp. Fig2 B)

Verbeek Supp. Fig3 A) MTC-TT treated with XL184 C) 2 days 5 days 0,6 C 0 IC50 max 0 IC50 max 0,5 Control RET GAPDH Expression levels 0,4 0,3 0,2 0,1 2d, 0 2d, IC50 2d, max 5d, 0 5d, IC50 5d, max B) MZ-CRC-1 treated with vandetanib 0 XL184 Vandetanib 2 days 5 days C 0 IC50 max 0 IC50 max RET GAPDH

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback