Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition

Similar documents
Amelioration of autism-like social deficits by targeting histone methyltransferases EHMT1/2 in Shank3-deficient mice

Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms

Supplementary Figures

SUPPLEMENTARY INFORMATION

Nature Neuroscience: doi: /nn Supplementary Figure 1. Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons

Supporting Information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM.

Two distinct mechanisms for experiencedependent

Supplementary Figure 1. mir124 does not change neuron morphology and synaptic

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.

SUPPLEMENTARY INFORMATION. Rett Syndrome Mutation MeCP2 T158A Disrupts DNA Binding, Protein Stability and ERP Responses

Structural basis for the role of inhibition in facilitating adult brain plasticity

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation

Supplementary Information

Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C

Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

SUPPLEMENTARY INFORMATION

Wenqin Hu, Cuiping Tian, Tun Li, Mingpo Yang, Han Hou & Yousheng Shu

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

SUPPLEMENTARY INFORMATION

Inhibition of Cdk5 Promotes β-cell Differentiation from Ductal Progenitors

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Microglia do not show signs of classical immune activation following MD a-b. Images showing immunoreactivity for MHCII (a)

Control. csarnt -/- Cre, f/f

Zhu et al, page 1. Supplementary Figures

Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development

The subcortical maternal complex controls symmetric division of mouse zygotes by

Supplementary Fig. S1. Schematic diagram of minigenome segments.

SUPPLEMENTARY INFORMATION

Histone deacetylase inhibitor MS-275 restores social and synaptic function in a Shank3-deficient mouse model of autism

SUPPLEMENTARY INFORMATION

Nature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.

Nature Neuroscience: doi: /nn Supplementary Figure 1

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Ube3a is required for experience-dependent maturation of the neocortex

Nature Neuroscience: doi: /nn Supplementary Figure 1. Trial structure for go/no-go behavior

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

Hormonal gain control of a medial preoptic area social reward circuit

File name: Supplementary Information Description: Supplementary Figures, Supplementary Table and Supplementary References

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.

Social transmission and buffering of synaptic changes after stress

Supplementary Figure 1 IL-27 IL

Nature Immunology: doi: /ni eee Supplementary Figure 1

SUPPLEMENTARY FIGURES

Supplementary Figures

Nature Genetics: doi: /ng.3731

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were

mtorc2 controls actin polymerization required for consolidation of long-term memory

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle

Supplemental Materials Molecular Biology of the Cell

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

CHAPTER 5 RESULTS Previous study: cell culture and organotypical slices

Nature Immunology: doi: /ni Supplementary Figure 1 33,312. Aire rep 1. Aire rep 2 # 44,325 # 44,055. Aire rep 1. Aire rep 2.

Cesarini et al., http :// /cgi /content /full /jcb /DC1

Dopamine in Ube3a m-/p+ mice. Online Supplemental Material

Supplementary Figure 1

Inhibition of DYRK1A stimulates human beta-cell proliferation

GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!

Supplementary Information Epigenetic modulation of inflammation and synaptic plasticity promotes resilience against stress in mice

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma

Supplementary Table I Blood pressure and heart rate measurements pre- and post-stroke

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

GABA from reactive astrocytes impairs memory in mouse models of Alzheimer disease

Supplementary Figure 1

Supplementary Table 1. List of primers used in this study

LPS CD40 + IL-4. Vorinostat (24 Hours) Vorinostat (24 Hours) Panobinostat (24 Hours) Panobinostat (24 Hours) Romidepsin (48 Hours)

IgG3 regulates tissue-like memory B cells in HIV-infected individuals

Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547

SUPPLEMENTARY LEGENDS...

Chromatin-Based Regulation of Gene Expression

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplemental Information. Dorsal Raphe Dual Serotonin-Glutamate Neurons. Drive Reward by Establishing Excitatory Synapses

Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses

Supplementary Information

Supplementary Figures

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

Nature Neuroscience: doi: /nn Supplementary Figure 1

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1. PICALM expression in brain capillary endothelium in human brain and in mouse brain.

Transcription:

SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-018-0110-8 In the format provided by the authors and unedited. Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition Luye Qin 1, Kaijie Ma 1, Zi-Jun Wang 1, Zihua Hu 2, Emmanuel Matas 1, Jing Wei 1 and Zhen Yan 1 * 1 Department of Physiology and Biophysics, Jacobs School of Medicine and Biomedical Sciences, State University of New York at Buffalo, Buffalo, NY, USA. 2 Center for Computational Research, New York State Center of Excellence in Bioinformatics & Life Sciences, State University of New York at Buffalo, Buffalo, NY, USA. These authors contributed equally: Luye Qin and Kaijie Ma. *e-mail: zhenyan@buffalo.edu Nature Neuroscience www.nature.com/natureneuroscience 2018 Nature America Inc., part of Springer Nature. All rights reserved.

Supplementary Figure 1 Romidepsin treatment leads to the sustained increase of social interaction time and social preference in young Shank3- deficient mice. (a) Box plots showing the time spent investigating either the social (Soc) or nonsocial (NS) stimulus during sociability testing in young (5-6 weeks old) male Shank3 +/ΔC mice with a brief treatment of romidepsin (RMD, 0.25 mg/kg, i.p., 3x, n=10) or saline (n=10) prior to and at different days after the injection. F 3,36(treatment) =137.4, P<0.0001; +++ P<0.001, (Soc vs. NS), ** P<0.01, *** P<0.001 (saline vs. romidepsin), two-way rmanova. (b) Representative heat maps illustrating the time spent in different locations of the 3 chambers from the social preference tests in Shank3 +/ΔC mice treated with RMD or saline. Locations of Soc and NS stimuli are labeled with the circles. (c) Bar graphs (mean ± SEM) and scatter plots showing the preference index of the sociability testing in adult (10-11 weeks old) Shank3 +/ΔC (n=13) or WT (n=10) mice before and after romidepsin (0.25 mg/kg, i.p., 3x) treatment. F 3,45 =10.5, P<0.0001; * P<0.05,*** P<0.001, one-way ANOVA. (d) Bar graphs (mean ± SEM) and scatter plots showing the social preference index in Shank3 +/ΔC mice (n=9, ~10 weeks old) before and after the second-round romidepsin treatment. F 2,24 =2.6, ^ P=0.09, one-way ANOVA.

Supplementary Figure 2 Current antipsychotics fail to increase social interaction time, while the pan-hdac inhibitor trichostatin A (TSA) transiently improves social behaviors in Shank3-deficient mice. (a-e) Box plots showing the time spent investigating either the social (Soc) or nonsocial (NS) stimulus during sociability testing in young (5-6 weeks old) male Shank3 +/ΔC mice treated with fluoxetine (10 mg/kg, i.p., 14x, a, n=9), clozapine (5 mg/kg, i.p., 3x, b, n=11), valproic acid (VPA, 100 mg/kg, 3x, c, n=11), aripiprazole (1 mg/kg, 3x, d, n=9) or risperidone (0.1 mg/kg, 3x, e, n=10). In (c), F 2,40(treatment) =0.71, P=0.5; +++ P<0.001 (Soc vs. NS), two-way rmanova. (f, g) Plots showing the preference index (f) and the time spent investigating either the Soc or NS stimulus (g) during sociability testing in Shank3 +/ΔC mice before and after TSA treatment (0.5 mg/kg, i.p., 3x, n=8). In (f), F 2,21 =19.7, P<0.0001, one-way ANOVA. In (g), F 2,28(treatment) =4.15, P=0.026; ++ P<0.01, +++ P<0.001 (Soc vs. NS), ### P<0.001 (pre- vs. post-injection), two-way rmanova. Inset (d,e,g): Representative heat maps illustrating the time spent in different locations of the 3 chambers (blue: 0 sec; red: ~20 sec) from the social preference tests of drug-treated Shank3 +/ΔC mice.

Supplementary Figure 3 Histone acetylation sites are identified on Grin2a and Grin2b promoters. (a) PCR images showing the ChIP (AcetyH3-occupied DNA), input (total DNA) and no-template control (NTC) signals with 3 primers (P1, P2, P3) designed against the promoter regions of Grin2a and Grin2b. The expected sizes of PCR products are labeled on the gels. The final primers used in the quantitative ChIP experiments are labeled by red circles. Top: diagram showing the primer locations on the 5' upstream sequence of Grin2a and Grin2b. TSS, transcriptional start site. (b) The amplification curve and melt curve for AcetyH3- ChIP, input, and IgG control samples.

Supplementary Figure 4 Romidepsin treatment restores NMDAR synaptic function and global histone acetylation at 16 18 d, but not 30 32 d, postinjection. (a,b) Input-output curves of NMDAR-EPSC in PFC pyramidal neurons from Shank3 +/ΔC mice (Het, male) receiving treatment of romidepsin (RMD, i.p., 0.25 mg/kg, 3x) or saline. Recordings were performed at 16-18 days (a) or 30-32 days (b) post-injection. n=12 cells/3 mice each group. In (a), F 1,22(treatment) =13.56, P=0.0013; * P<0.05, *** P<0.001, two-way rmanova. Data are mean ± SEM. Inset: representative NMDAR-EPSC traces. (c,d) Immunoblots and quantification analysis of the level of acetylated H3 and total H3 in the nuclear fraction of cortical slices from WT or Shank3 +/ΔC mice (male) treated with saline or romidepsin at 16-18 days or 30-32 days post-injection. n=6 each group. In (d), F 2,15 =12.55, P=0.0006 (16-18 days); F 2,15 =27.72, P<0.0001 (30-32 days); ** P<0.01, *** P<0.001, ns, not significant, one-way ANOVA.

Supplementary Figure 5 Histone acetylation sites are identified on Arhgef7 and Limk1 promoters. (a,b) PCR images showing the ChIP (AcetyH3-occupied DNA), input (total DNA) and no-template control (NTC) signals with 3 primers (P1, P2, P3) designed against the promoter regions of Arhgef7 and Limk1. The expected sizes of PCR products are labeled on the gels. Top Inset: diagram showing the primer locations on the 5' upstream sequence of Arhgef7 and Limk1. TSS, transcriptional start site. Right Inset: The amplification curve and melt curve for AcetyH3-ChIP, input, and NTC samples. The final primers used in the quantitative ChIP experiments are labeled by red circles.

Supplementary Figure 6 Romidepsin treatment restores actin filaments in PFC of Shank3-deficient mice. (a) High magnification confocal images (40x) of F-actin staining with phalloidin (co-stained with PSD-95 and DAPI) in PFC slices of WT vs. Shank3 +/ΔC mice (5-6 weeks old, male) with i.p. injections of saline or romidepsin (0.25 mg/kg, 3x). (b) Quantification of PSD-95 levels (integrated densities) in PFC slices of different animal groups. n=27 images/3 mice each group.

Supplementary Figure 7 Romidepsin treatment has no effect on the expression of genes encoding NMDAR subunits or actin regulators in other brain regions and peripheral organs of Shank3-deficient mice. (a,b) Quantitative real-time RT-PCR data on the mrna level of Grin1, Grin2a, Grin2b, Arhgef7 and Limk1 in striatum, VTA, kidney and heart from WT or Shank3 +/ΔC mice (5-6 weeks old, male) injected with saline or romidepsin (0.25 mg/kg, i.p., 3x). n=6 each group.

Supplementary Figure 8 Full blots for Figures 1, 3 and 4. -

Supplementary Figure 9 Full blots for Figures 5 and 6 and Supplementary Figure 4. -