Soluble ADAM33 initiates airway remodeling to promote susceptibility for. Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David I Wilson,

Similar documents
Soluble ADAM33 initiates airway remodeling to promote susceptibility for allergic asthma in early life

Supplementary Information

Soluble ADAM33 initiates airway remodeling to promote susceptibility for. Faculty of Medicine, University of Southampton, Southampton, United Kingdom

Nature Immunology: doi: /ni Supplementary Figure 1

Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and

Supplementary Figure 1

Role of Tyk-2 in Th9 and Th17 cells in allergic asthma

Supplementary Figure 1

Supplementary table I. Real-time primers used in the study. The fold change was obtained by

B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN

Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

COPD lungs show an attached stratified mucus layer that separate. bacteria from the epithelial cells resembling the protective colonic

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr

Life-long asthma and its relationship to COPD. Stephen T Holgate School of Medicine University of Southampton

Asthma Pathophysiology and Treatment. John R. Holcomb, M.D.

Supplementary Information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin

Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al

Supplementary Figure 1.

Eosinophils! 40! 30! 20! 10! 0! NS!

Neonatal Exposure to Microbial Phosphorylcholine Modulates the Development of House Dust Mite Allergy During Adult Life

Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice

CHAPTER 5 RESULTS Previous study: cell culture and organotypical slices

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine

Nature Medicine: doi: /nm.3922

Senior Thesis. Presented to. The Faculty of the School of Arts and Sciences Brandeis University

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

(Stratagene, La Jolla, CA) (Supplemental Fig. 1A). A 5.4-kb EcoRI fragment

Asthma Phenotypes, Heterogeneity and Severity: The Basis of Asthma Management

IL-13 Augments Compressive Stress-induced Tissue Factor Expression in Human Airway Epithelial Cells

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.

Searching for Targets to Control Asthma

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

SUPPLEMENTARY INFORMATION

Allergy and Immunology Review Corner: Chapter 75 of Middleton s Allergy Principles and Practice, 7 th Edition, edited by N. Franklin Adkinson, et al.

Age-related changes of IgE-mediated allergic reaction in patients with late onset asthma.

Potent and Selective CRTh2 Antagonists are Efficacious in Models of Asthma, Allergic Rhinitis and Atopic Dermatitis

NMED-A65251A. Supplementary Figures.

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with

Immunology of Asthma. Kenneth J. Goodrum,Ph. Ph.D. Ohio University College of Osteopathic Medicine

Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice.

Supplementary Materials for

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Impact of Asthma in the U.S. per Year. Asthma Epidemiology and Pathophysiology. Risk Factors for Asthma. Childhood Asthma Costs of Asthma

Supplementary Materials for

Supplementary Information Titles Journal: Nature Medicine

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer

Expanded View Figures

Supplementary Information. Paired immunoglobulin-like receptor A is an intrinsic, self-limiting

Supplementary Figure 1

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min

Differentiation-induced Changes of Mediterranean Fever Gene (MEFV) Expression in HL-60 Cell

Nature Immunology: doi: /ni Supplementary Figure 1. IC261 inhibits a virus-induced type I interferon response.

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

SUPPLEMENTARY METHODS

T H E J O U R N A L O F C E L L B I O L O G Y

The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep

and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the

CD4 + and CD8 + T cells play a central role in a HDM driven model of allergic asthma

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)

IgE-mediated allergy in elderly patients with asthma

Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times.

Sponsor. Generic drug name. Trial indication(s) Protocol number. Protocol title. Clinical trial phase. Study Start/End Dates.

Allergic diseases and treatment. Feng Qian ( 钱峰 )

Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.

Abnormal Spirometry Medical Risk in Aviation Conference Royal Aeronautical Society, Dec 2017

Supplementary Figure 1

Supplementary Figure 1. c Human

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

DR REBECCA THOMAS CONSULTANT RESPIRATORY PHYSICIAN YORK DISTRICT HOSPITAL

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Supplementary Materials for

Supplementary Figures

The independent effects of vitamin D deficiency and house dust mite exposure on lung function are sexspecific

Abhd2 regulates alveolar type Ⅱ apoptosis and airway smooth muscle remodeling: a key target of COPD research

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

SUPPLEMENTARY INFORMATION

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

Abstract. IgE. IgE Th2. x x IL-4 IL-5 IgE CD4 +

The clathrin adaptor Numb regulates intestinal cholesterol. absorption through dynamic interaction with NPC1L1

FIG S1 Examination of eif4b expression after virus infection. (A) A549 cells

Supplementary Table 1. List of primers used in this study

SUPPLEMENTARY INFORMATION

Supplementary Figure S1 Supplementary Figure S2

Transcription:

Revised Suppl. Data: Soluble ADAM33 1 Soluble ADAM33 initiates airway remodeling to promote susceptibility for allergic asthma in early life Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David I Wilson, Stephen T. Holgate, Donna E. Davies, Jeffrey A. Whitsett, Hans Michael Haitchi Supplemental data

Revised Suppl. Data: Soluble ADAM33 2 Supplemental Table 1. Subject characteristics of bronchoalveolar lavage fluid (BALF) groups. Healthy Asthma Subjects (n=5) (n=10) Age, yrs 19 (19-21) 42 (21-69)* Male/Female 4/1 3/7 Atopy 0 6 FEV1% predicted 96 (83-101) 70 (30-101)* SABA N/A 10 ICS N/A 7 LABA N/A 7 OCS N/A 2 Other meds N/A 3 Eosinophilic only 1 2 Neutrophilic only 0 3 Eosin.+Neutr. 0 4 Neither 4 1 * Unpaired Student s t-test with Welch's correction (P < 0.05) Number of patients with eosinophilic ( 1%), neutrophilic ( 5%) or both inflammation in bronchoalveolar lavage fluid (BALF) Inhaled short-acting ß2-agonists (SABA), Inhaled corticosteroids (ICS), Inhaled long-acting ß2-agonists (LABA), Oral steroids (OCS), Other medications (Other meds), not applicable (N/A)

Revised Suppl. Data: Soluble ADAM33 3 Supplemental Figure 1: Increased soluble ADAM33 (sadam33) Pro- Metalloprotease in bronchoalveolar lavage fluid (BALF) in human asthma. (A) Western blotting of BALF proteins from healthy (n=5) and asthmatic (n=10) subjects using an antibody recognizing the Pro domain of human ADAM33; representative blots are shown. (B) Combined ADAM33 immunoreactive bands (at ~52-76kDa) were analyzed by densitometry in arbitrary units (AU) (Mann Whitney test). Box plots show medians and 25th to 75th percentiles, and whiskers min to max/all points. Full unedited Western blots are available in the Supplemental Material.

Revised Suppl. Data: Soluble ADAM33 4 Supplemental Figure 2: ADAM33 metalloprotease (MP) and pro domain (Pro) antibodies do not crossreact with ADAM8 or ADAM12. (A,B,C) Dot blots of 100, 75, 50, 25 and 0 ng recombinant ADAM8, ADAM12 (both with a polyhistidine (HIS) tag) and ADAM33 blotted with antibodies against (A) ADAM33-MP, (B) ADAM-Pro and (C) HIS tag.

Revised Suppl. Data: Soluble ADAM33 5 Supplemental Figure 3: Mouse model of house dust mite (HDM)-induced allergic airway inflammation Protocol for intra-peritoneal (i.p.) sensitization (S) of 6-8 week old mice at day 0 and day 7 and intra-tracheal (i.t.) challenges with Saline (Sal) or HDM extract in saline (HDM) on day 14 and 19. Harvesting (Harvest) of mouse bronchoalveolar lavage fluid (BALF) and lung tissue (Harvest), on day 21-22 after first sensitization.

Revised Suppl. Data: Soluble ADAM33 6

Revised Suppl. Data: Soluble ADAM33 7 Supplemental Figure 4: Generation of the human sadam33 double transgenic (Ccsp/ADAM33) mouse model. (A) Diagram of the full length ADAM33 protein domain structure, the corresponding mrna exonic structure and the cdna used for cloning sadam33 which contains the signal sequence (SS), pro-domain (PRO) and metalloprotease (MP) domain. (B-F) Plasmid constructs and steps for generation of the linearized TRES-hADAM33-SS-PRO-MP-3Flag DNA construct for microinjection into pro-nuclei from FVB/N mice. (G) Ccsp-rtTA mice line 2 were crossed with founder mice containing the tetracycline response element 2- ADAM33-PRO-MP (TRES-ADAM33-PRO-MP) to generate Doxycycline (Dox)- inducible double transgenic mice expressing human soluble ADAM33 (Ccsp/ADAM33). (H) Agarose gel electrophoresis of PCR products from CcsprtTA (440 base pairs (bp)) or ADAM33-PRO-MP (636 bp) transgenes. Results from DNA of single (STg; Ccsp-rtTA or ADAM33-PRO-MP) or double transgenic (DTg; Ccsp/ADAM33) mice, and negative (H2O) and positive control DNAs are shown.

Revised Suppl. Data: Soluble ADAM33 8 Supplemental Figure 5: Expression of sadam33 does not induce airway inflammation or airway resistance. (A) Six to eight week old double transgenic (DTg) Ccsp/ADAM33 (n=8-12) and single transgenic (STg) litter-mate control (n=8-10) mice were fed on Dox diet for 8 weeks. (B) shows differential inflammatory cell counts for macrophages (M ), lymphocytes (Ly), neutrophils (Neu) and eosinophils (Eo) in bronchoalveolar lavage fluid (BALF) from adult DTg Ccsp/ADAM33 or STg control mice (n=8 per group) for 8 weeks on Dox diet; (C) shows airway resistance in response to increasing concentrations of methacholine (Me) in phosphate buffered saline (PBS) in adult DTg Ccsp/ADAM33 (n=12) and litter STg control (n=10) mice. (D) DTg Ccsp/ADAM33 (n=6-13) and STg litter-mate control (n=6-8) were fed on Dox from in utero until 4 weeks post partum to induce transgene expression. (E) shows differential inflammatory cell counts in BALF from young DTg Ccsp/ADAM33 or STg control mice on Dox from in utero for 4 weeks (n=6 per group); (F) shows airway resistance in response to increasing concentrations of methacholine (Me) in phosphate buffered saline (PBS) in DTg Ccsp/ADAM33 (n=13) and litter STg control (n=8) in 4 week old mice on Dox from in utero (twoway ANOVA, Tukey s multiple comparison test). Results are from 3 independent experiments (B,C,E,F).

Revised Suppl. Data: Soluble ADAM33 9 Supplemental Figure 6: Adam33 mrna expression in wild type, heterozygous and Adam33 -/- mice. Relative mrna expression of Adam33 in whole lung lysates from wild-type (WT), heterozygous (Adam33 +/- ) and ADAM33 knock out (Adam33 -/- ) mice (n=9/group) was determined by reverse transcription quantitative PCR (RT-qPCR) analysis.

Revised Suppl. Data: Soluble ADAM33 10 Supplemental Figure 7: Bronchoalveolar lavage fluid (BALF) enzymatic activity and airway resistance are decreased in Adam33 -/- mice following HDM challenge. Wild-type (WT), heterozygote (Adam33 +/- ) and ADAM33 knock out (Adam33 -/- ) mice were sensitized and challenged with saline or house dust mite extract HDM following the standard protocol. (A) shows ADAM33 enzymatic activity measured using an ADAM33-selective fluorescence resonance energy transfer (FRET) peptide cleavage assay using BALF from mice after HDM or saline challenge as indicated (n = 3/group) (two-way ANOVA, Tukey s multiple comparison test). Data are expressed as mean ± s.d. Results are from 1 experiment (B). (B) shows airway resistance in response to increasing concentrations of methacholine in PBS measured using the forced oscillation technique in anesthetized mice after HDM or saline challenge as indicated (n=9 per group) (one-way ANOVA, Tukey s multiple comparison test). Data are expressed as medians, boxes 25th to 75th percentiles and whiskers min to max/all points. Results are from 3 independent experiments (B

Revised Suppl. Data: Soluble ADAM33 11 Supplemental Figure 8: IL13 challenge model and concentration dependence of house dust mite extract (HDM) on bronchial hyperresponsiveness (BHR) and eosinophilic inflammation. (A) Ccsp/ADAM33 mice were mated and double transgenic (DTg) Ccsp/ADAM33 and single transgenic (STg) litter-mate control offspring mice were on Doxycycline (Dox) diet from in utero until day 42 after birth to induce transgene expression; they were then challenged with saline (Sal) or 5 μg of murine IL13 by intra-tracheal (i.t.) installation and harvest of lung tissue after 24 hours (n=4 per group). (B-E) Wild-type mice were sensitized and challenged with saline or 6.25, 12.5 or 25 μg of HDM in saline (n=3 per group) following the standard protocol. (B) shows airway resistance in response to increasing concentrations of methacholine in PBS measured using the forced oscillation technique in anesthetized mice after HDM or saline challenge as indicated; (C) shows differential inflammatory cell count for eosinophils (Eo) in bronchoalveolar lavage fluid (BALF) from mice after HDM or saline challenge as indicated (one-way ANOVA, Tukey s multiple comparison test). (D,E) shows mrna expression

Revised Suppl. Data: Soluble ADAM33 12 measured by reverse transcription quantitative PCR (RT-qPCR )using whole lung lysates from mice after HDM or saline challenge as indicated: (D) Ccl11/Eotaxin and (E) Muc5ac (one-way ANOVA, Tukey s multiple comparison test). Data are expressed as mean ± s.d. Results are from 1 experiment (B-E).

Revised Suppl. Data: Soluble ADAM33 13 Supplemental Figure 9: Increased airway responsiveness after exposure to a low concentration of house dust mite extract (HDM) allergen in human soluble ADAM33 (sadam33) expressing transgenic mice. (A) Double transgenic (DTg) Ccsp/ADAM33 (n=9/group) and single transgenic (STg) litter-mate control (n=9/group) mice were fed on Doxycycline (Dox) diet for 6 weeks to induce transgene expression; they were then sensitized and challenged with 6.25 μg of HDM or saline. (B,C) show airway resistance in response to increasing concentrations of methacholine (Me) in PBS measured using the forced oscillation technique in anesthetized mice after HDM or saline challenge as indicated (two-way ANOVA, Tukey s multiple comparison test). Data are expressed as mean ± s.d. Results are from 3 independent experiments (B and C).

Revised Suppl. Data: Soluble ADAM33 14 Supplemental Figure 10: ADAM33 expression is arrested after 28 days on and 28 days off Doxycycline (Dox). (A) Double transgenic (DTg) Ccsp/ADAM33 and single transgenic (STg) littermate control were fed on Dox from in utero until 28 and 56 days post partum to induce transgene expression. In one group Dox was stopped for 28 days to arrest transgene expression. (B) shows reverse transcription quantitative PCR (RT-qPCR) for ADAM33 mrna expression in whole lungs from DTg Ccsp/ADAM33 or STg control mice on Dox from in utero for 28 (light gray boxes) and 56 days (dark gray boxes) and 28 days on followed by 28days off Dox (white boxes) (n=9 per group) (two-way ANOVA, Tukey s multiple comparison test). Results are from 2 independent experiments (B).

Unedited Western blots: Soluble ADAM33 1 Full unedited blots for Figure 1A (top) & Supplementary Figure 1A (bottom):

Unedited Western blots: Soluble ADAM33 2 Full unedited blot for Figure 1D:

Unedited Western blots: Soluble ADAM33 3 Full unedited Ponceau stain and blot for Figure 2D: