Supplementary Figure 1

Similar documents
Supplementary Materials for

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Supplementary Figure 1

(#4685) and p- AKT (S473) Rb mab (#9271) purchased from cell signaling Technology (Beverly,

Tissue factor-par2 signaling promotes diet-induced obesity and adipose

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency

Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI

Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

perk/erk STAT5B

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

Effect of BI-1 on insulin resistance through regulation of CYP2E1

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supporting Information Table of Contents

Supplementary Figures

Supplementary Information

HSP72 HSP90. Quadriceps Muscle. MEF2c MyoD1 MyoG Myf5 Hsf1 Hsp GLUT4/GAPDH (AU)

Supplementary Figure 1.

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Expanded View Figures

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

SUPPLEMENTARY INFORMATION

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Title: Obesity in mice with adipocyte-specific deletion of clock component Bmal1

SUPPLEMENTARY INFORMATION

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

Nature Immunology: doi: /ni.3631

Regulation of Systemic Energy Balance and Glucose Homeostasis by Protein-Tyrosine Phosphatase 1B

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

SUPPLEMENTARY INFORMATION

Supplementary Figure 1

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

STAT4 Deficiency Reduces Obesity-Induced Insulin Resistance and Adipose Tissue Inflammation

Imtiyaz et al., Fig. S1

University of California, San Diego La Jolla CA 92093

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

a b c Physical appearance of mice Lean mass Adipocyte size d e f

Supplementary Figure 1 a


Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice.

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

Altered Mouse Adipose Tissue IGF-1 Expression Influences Glucose Control

BIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity

Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were

Supplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed

Supplemental Information. The Hormone FGF21 Stimulates Water Drinking. in Response to Ketogenic Diet and Alcohol

Supplementary Figure 1

W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.

SUPPLEMENTARY INFORMATION

Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the

Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Supplementary Figure 1

Analysis of AVP functions via V1a and V1b receptors with knockout mice. Akito Tanoue

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

7/31/2009. G.Y. Prince Used Cars 10 am Los Angelos, CA Mullholland Drive..later that day. Would you buy a car without taking it for a spin first?

Molecular pathways linking metabolic inflammation and thermogenesis G. Solinas Summary

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c

Supplementary Figures

A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat

scientific report A functional role for the p62 ERK1 axis in the control of energy homeostasis and adipogenesis scientificreport

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.

Supplementary Information

Supplementary Information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.

Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance

SUPPLEMENTARY INFORMATION

Supplementary Figure 1

a b c d e C 3 ]Aspartate [ 20 minutes C 3 ]Hexose-P * * *

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

Control. csarnt -/- Cre, f/f

SUPPLEMENTARY INFORMATION

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR

Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplemental Figure 1

Transcription:

Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular Proinflammatory ytokines, Growth factors MEK Intracellular MEK Supplementary Figure 1: Effect of obesity and insulin resistance on ERK phosphorylation. Western blotting of phosphorylated and relative to total and in () epididymal white adipose tissue (ewt), inguinal white adipose tissue (iwt), brown adipose tissues (T), and liver. () perk/erk levels in hypothalamus, kidney, muscle (quadriceps), spleen, and heart from age-matched 16 week old chow fed and HFD fed (8 weeks on HFD) mice. Mice were fasted for 4 hours prior to sacrifice. () Schematic depicting elevated ERK signaling attributed to obesityinduced pro-inflammatory cytokines in adipose tissue.

Relative Peptide Phosphorylation Relative Peptide Phosphorylation Relative Peptide Phosphorylation Supplementary Figure 2 0 0.5 1 6 12 Hours of MEK inhibition 0 0.5 1 6 12 Hours of MEK inhibition 0 0.5 1 6 12 Hours of MEK inhibition Supplementary Figure 2: MEK inhibition in vivo decreases phosphorylation of ERK and PK substrates. (- ) Temporal clustering of quantitative mass spectrometry on WT phosphopeptides from diet induced obese mice following MEKi treatment for 0, 0.5, 1, 6, or 12 hours as in Figs 2-. Each line represents a unique peptide, and line color represents putative ERK phosphorylation motif (orange) or PK (black) phosphorylation motif.

pkt/kt Glucose (mg/dl) % Initial glucose Relative mrn Level Relative mrn Level Supplementary Figure 3 Heart Kidney Liver Lung KO KO KO KO ctin 1.5 dipocyte fraction KO In vitro differentiated adipocytes 1.5 KO 0.5 * 0.5 D 400 350 ap2 /EPα PPRγ Glucose tolerance test KO n.d. E 120% 100% ap2 /EPα PPRγ Insulin tolerance test KO n.d. 300 80% 250 60% 200 40% 150 20% 100 0 30 60 90 120 Minutes 0% 0 30 60 90 120 Minutes F G 5 4 * 3 2 1 0 * * Liver ewt iwt ontrol ontrol KO Insulin Insulin KO Supplementary Figure 3: haracterization of KO mice. () Protein levels of and levels in heart, kidney, liver and lung from wild type () and KO (KO) mice. (-) Expression of and adipocyte marker genes (ap2, /EPα, PPRγ) from and KO (KO) mice in () primary floated adipocytes () in vitro differentiated adipocytes derived from SVF (n=3 per genotype). (D) lood glucose levels following IP-GTT on 13 to 15 weeks HFD-fed and KO (KO) mice (n=9 per genotype). (E) lood glucose levels following ITT (represented as % initial blood glucose levels) from 13 to 15 weeks HFD-fed and KO (KO) mice (n=9 per genotype). (F) Insulin Signaling in vivo. Western blotting for phospho-kt and total KT after 4-hr fast (ontrol) or 4-hr fast ending with a bolus of insulin (Insulin). Tissues examined were liver, ewt and iwt. n.d., not detected, Error bars represent SEM. *, p < 5, Student s t-test.

Supplementary Figure 4 HFD KO HFD D E F how KO how G H Supplementary Figure 4: Energy alance in KO mice on standard or HFD. (-D) Mice on HFD for 20 weeks were monitored for three days following acclimation. () Time plot of Energy Expenditure. () Overall 24-hr, dark and light photoperiod means are reported. () Time plot of food intake and (D) food intake overall and photoperiod means. n=9 male mice per genotype. (E-H) Mice on a standard chow diet for 16 weeks were monitored for two days following acclimation. (E-F) Energy Expenditure and (G-H) Food intake as above. n=8 male mice per genotype. ll experiments were conducted at 30. Error bars represent SEM. Statistical analysis with alr was used to perform NOV using lean body mass as a covariate.

Relative mrn Level Supplementary Figure 5 1.6 1.4 ontrol 1nM 1 nmeki MEKi 10nM nm MEKi 100nM MEKi 1.2 ap2 /EPα PPRγ Supplementary Figure 5: MEKi treatment had no effect on adipocyte differentiation markers. Expression of adipocyte marker genes (ap2, /EPα, PPRγ) in fully differentiated 3T3-L1 adipocytes after overnight treatment with the indicated doses of MEKi.

Relative mrn Level Supplementary Figure 6 drb3ko 1.4 1.2 3T3-L1 drb3ko+β3r- drb3ko+gfp drb3ko+β3r-s L1 GFP drb3ko β3r β3r S β3r N.S. ctin ap2 /EPα PPRγ Supplementary Figure 6: onfirmation of β3r deletion and overexpression in 3T3-L1 adipocytes. () Sequencing results of genomic DN from wild type 3T3-L1 () and β3r knockout 3T3-L1 (drb3ko) confirmed a deletion of 112 base pairs (the fragment between the red box and the purple box) in β3r knockout 3T3-L1 cell line, which contains part of exon 1 and intron 1 of the drb3 gene. () Expression of adipocyte marker genes (ap2, /EPα, PPRγ) in wild type 3T3-L1 adipocytes (3T3-L1) and β3r null cells with overexpression of green fluorescent protein (drb3ko+gfp), wild type β3r (drb3ko+β3r-) or β3r with Ser247-la mutation (drb3ko+β3r-s). () Endogenous and exogenous expression of β3r in wild type 3T3-L1 adipocytes (L1) and drb3ko null cells with overexpression of green fluorescent protein (GFP), wild type β3r (β3r-), or β3r with Ser247-la mutation (β3r-s).

Supplementary Figure 7 atecholamines DR3 ERK substrate S247 GRK2 TP PDE4 cmp Free fatty acids Glycerol Pro-inflammatory cytokines Insulin, growth factors Supplementary Figure 7: Putative ERK substrates which may impact lipolysis. Schematic of proteins which may impact lipolysis due to ERK phosphorylation. ERK is activated by multiple signaling pathways in obese adipose tissue. The proteins listed have decreased phosphorylation levels following MEK inhibition at a possible ERK phosphorylation motif. Proteins are also known to affect cmp levels or adrenergic signaling. Potential ERK target proteins include the DY6, DR3, GRK2/DRK1, and PDE4/PDE4D. DY6 and PDE4 control levels of cmp necessary for PK activation. GRK2 may phosphorylate adrenergic receptors.

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback