Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization

Similar documents
Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

Supplementary Figure 1.

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

In The Name Of God. In The Name Of. EMRI Modeling Group

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8

SUPPLEMENTARY INFORMATION

Supplementary Figure 1.

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages

SUPPLEMENTARY INFORMATION

Supplementary Information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171

Supplementary Figure 1

For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory

Entrainment of the mouse circadian clock by sub-acute physical and psychological

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

SUPPLEMENTARY INFORMATION

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy

SUPPORTING MATREALS. Methods and Materials

Supplementary Information

SUPPLEMENTARY INFORMATION

Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.

RayBio KinaseSTAR TM Akt Activity Assay Kit

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

Supplementary Materials for

SUPPLEMENTARY INFORMATION

Supplementary Materials and Methods

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments:

Supplementary Information

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin

AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

SUPPLEMENTARY INFORMATION

Supplementary Figure 1

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr

Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Glucose. Glucose. Insulin Action. Introduction to Hormonal Regulation of Fuel Metabolism

(Stratagene, La Jolla, CA) (Supplemental Fig. 1A). A 5.4-kb EcoRI fragment

Supplementary Figure 1

Supporting Information

Supplementary Information Titles Journal: Nature Medicine

GENE Forward primer Reverse primer FABP4 CCTTTGTGGGGACCTGGAAA TGACCGGATGACGACCAAGT CD68 AATGTGTCCTTCCCACAAGC GGCAGCAAGAGAGATTGGTC

Supplementary Figures

Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

doi: /nature14508 Rappsilber et al.

Supporting Online Material for

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

Effect of BI-1 on insulin resistance through regulation of CYP2E1

VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization

Supplementary Information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Effec<ve Use of PI3K and MEK Inhibitors to Treat Mutant K Ras G12D and PIK3CA H1047R Murine Lung Cancers

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets

Supplementary Figure S1

SUPPLEMENTARY FIGURES AND TABLE

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β

Supplementary Figure 1.

Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

Supporting Information Table of content

SUPPLEMENTARY FIGURES

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and

Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3

Mesenchymal Stem Cells Reshape and Provoke Proliferation of Articular. State Key Laboratory of Bioreactor Engineering, East China University of

Metformin inhibits hepatic gluconeogenesis in mice independently of the LKB1/AMPK pathway via a decrease in hepatic energy state

Nature Protocols: doi: /nprot Supplementary Figure 1. Fluorescent titration of probe CPDSA.

Supporting Online Material for

B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer

Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.

Transcription:

Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization

Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation Parasympathetic Sympathetic Glycogen FFA glycerol Supplementary Figure S1. Graphical abstract. Liver glycogen shortage activates a liver-brain-adipose neural axis composed of afferent vagal and efferent sympathetic nerves, promoting fatty acid and glycerol release from white adipose tissue as a response to starvation.

Supplementary Figure S2. a Body weight(g) 3 25 2 15 1 5 1 4 7 14 21 WAT (g) 5 4.5 4 3.5 3 2.5 2 1.5 1.5 1 4 7 14 21 POD (Day) POD (Day) POD (Day) Lean (g) 25 2 15 1 5 1 4 7 14 21 No significant di erence vs No significant di erence vs No significant di erence vs b Food intake(g/day) 5 4.5 4 3.5 3 2.5 2 1.5 1.5 3 7 14 21 POD (Day) No significant di erence vs Supplementary Figure S2. Hepatic vagotomy does not affect post-operated body weight, epididymal fat weight and lean body weight and the amount of food intake. a, Sequential body weight, epididymal fat weight and lean body weight were measured by dual energy X-ray analysis (DEXA). No significant difference. Error bars, S.E.M. (n=7) b, The amount of food consumption was measured after hepatic vagus nerve resection (). No significant difference. Error bars, S.E.M. (n=7)

Supplementary figure S3. a Vehicle Capsaicin Unmyelinated fiber Myelinated fiber b Body weight (g) 18 16 14 12 1 8 6 4 2 Cap vs. Vehicle N.S. Tukeyʼ s post-hoc test Supplementary Figure S3. Effect of neural circuit blockade with hepatic vagotomy or capsaicin. a, Trans Emission Microscopy (TEM) appearance of vehicle or capsaicin treated hepatic vagus nerve Upper, vehicle treated; lower, capsaicin treated group. Left, unmyelinated fiber x5, Bar 1μm; right, myelinated fiber x1, Bar 2μm b, Body weight of sham operated (), capsaicin treated (CAP), or vagotomized () mice. Statistical comparisons were made by Tukey s post-hoc test. No significant difference. Error bars, S.E.M. (n=4-12)

Supplementary Figure S4. a Figure 2b Phospho-HSL (Ser563) HSL ATGL kda 225 hour 2 2 hour 2 2 hour 2 2 kda 225 kda kda 24 24 24 17 12 b Figure 3d Phospho-CREB (Ser133) LacZ Gys2 kda Phospho-HSL (Ser563) LacZ Gys2 kda 226 kda 225 HSL LacZ Gys2 24 c Figure 3h kda Phospho-HSL (Ser563) GFP TFE3 kda 225 HSL GFP TFE3 d Figure 4c Glycogen Synthase PYGL kda LacZ-i Gys2-i Pygl-i kda LacZ-i Gys2-i Pygl-i 225 24 24 e Figure 4f Phospho-AMPKα (Thr172) AMPKα Phospho-AMPKβ (Ser18) AMPKβ kda LacZ-i Gys2-i Pygl-i LacZ-i Gys2-i Pygl-i LacZ-i Gys2-i Pygl-i LacZ-i Gys2-i Pygl-i kda kda kda GS 24 24 AMPKαα Supplementary Figure S4. Full length images of immunoblotting.

Supplementary Figure S5. a Noradrealine content in Epi WAT (mg/g tissue) 45 4 35 3 25 2 15 1 5 Veh GD Dopamine content in Epi WAT (mg/g tissue) 5 4 3 2 1 Veh GD Adrenaline content in Epi WAT (mg/g tissue) 4 35 3 25 2 15 1 5 Veh GD vs. Vehicle p<.5 Tukeyʼ s post-hoc test b Body weight (g) 25 2 15 1 5 Veh GD vs. Vehicle N.S. Tukeyʼ s post-hoc test Supplementary Figure S5. Effect of sympathetic neural circuit blockade on epididymal fat tissue. a, Catecholamine content of epididymal white adipose tissue in mice, either sham or hepatic vagotomized model ablated with sympathetic nerve neurotoxin guanethidine (GD) or vehicle administration (Veh). b, Body weight of sham and hepatic vagotomized mice administrated with vehicle or guanethidine. p<.5 by Tukey s post-hoc test. Error bars, S.E.M. (n=5)

Supplementary Figure S6. Ppargc1a Irs2 Pck G6pc Fasn Cpt1a Fgf21 18s Supplementary Figure S6. Liver mrna expression after selective hepatic vagotomy Effects of hepatic-vagotomy on hepatic gene expression was analyzed by northern blotting of livers in hepatic-vagotomized mice after 24h fasting (pooled individual three samples).

Supplementary Figure S7. a Glucose (mg/ml) 8 7 6 5 4 3 2 1 insulin (ng/ml) 2.5 2 1.5 1.5 Glucagon (pg/ml) 18 16 14 12 1 8 6 4 2 Lept in (ng/ml).7.6.5.4.3.2.1 FGF21 (ng/ml) 2.25 2 1.75 1.5 1.25 1.75.5.25 vs. N.S. Student s t-test b 9 14 12 Noradrenaline (ng/ml) 8 7 6 5 4 3 2 1 Veh GD Dopamine (pg/ml) 12 1 8 6 4 2 Veh GD Adrenaline (pg/ml) 1 8 6 4 2 Veh GD vs. Vehicle p<.5 Tukeyʼ s post-hoc test Supplementary Figure S7. Plasma hormone profiles in the experimental mice. a, Plasma glucagon, leptin, and FGF21 levels in hepatic vagus nerve transected mice fasted for 24 hours. b, Plasma catecholamine levels in vagotomized mice with or without guanethidine treatment on a 24-hour fasting condition. p<.5 by Tukey s post-hoc test. Error bars, S.E.M. (n=4-6)

Supplementary Figure S 8. a Gys2 / 36B4 4. 5 4 3. 5 3 2. 5 2 1. 5 1. 5 LacZ Gys2 b Glycogen (μg/mg protein) 14 12 1 8 6 4 2 LacZ Gys2 TFE3 vs. LacZ p<.5 Tukeyʼ s post-hoc test Supplementary Figure S8. Effect of glycogen accumulation in primary isolated hepatocytes infected with Ad-CMV-Gys2 or Ad-CMV-TFE3 in vitro. a, Primary hepatocytes, isolated from wild mouse were infected with adenovirus vectors, at titer of 5 x 1 9 pfu expressing LacZ, Gys2 or TFE3. Gys2 mrna steady state levels were assessed by qrt-pcr analysis and quantified by densitometric measurement using 36B4 mrna as a reference. There was an Gys2 dose-dependent increase in Ad-CMV-Gys2 transduced livers. b, Glycogen content in primary hepatocytes infected with Ad-LacZ, Ad-Gys2, or Ad-TFE3. p<.5 by Tukey s post-hoc test. Error bars, S.E.M. (n=4)

Supplementary Table S1. LacZ Gys2 LacZ Gys2 Body Weight (g) 18.9±1. 2.7±.7 2.8±.3 2.2±.3 n.s. vs. LacZ- LacZ-i Gys2-i LacZ-i Gys2-i Body Weight (g) 19.4±.3 18.3±.5 2.2±.4 19.9±.4 n.s. vs. LacZ-i - LacZ-i Pygl-i LacZ-i Pygl-i Body Weight (g) 19.4±.3 2.4±.3 2.2±.4 2.5±.3 n.s. vs. LacZ-i- Supplementary Table S1. Body weight change after administration of adenovirus vectors overexpressing Gys2 or those expressing short-hairpin RNA targeted for Gys2 or Pygl. Body weight change after 24 hour fasting. v.s. each sham-control vectors. Tukey s post-hoc test. No significant difference. Mean± S.E.M. (n=4)

Supplementary Table S2. Northern blot reference set Probe Gys2 Sequence NM_145572.2:1669-22 Tcfe3 NM_172472: 911-3266 Ppargc1a NM_894: 14-2533 Irs2 NM_181212: 1971-3442 Pck1 NM_1144: 126-3 G6pc U445: 25-1169 Fasn NM_7988: 6189-7453 Cpt1a NM_13495: 1859-2358 Fgf21 NM_213: 185-817 Supplementary Table S2. List of cdna probes used for Northern blotting.

Supplementary Table S3. Sequences of qpcr Primers Srebf1c 5 -CGGCGCGGAAGCTGT-3 5 -TGCAATCCATGGCTCCGT-3 Lipe (HSL) 5 -TGGTTCAACTGGAGAGCGGAT-3 5 -TGATGCAGAGATTCCCACCTG-3 Atgl 5 -AACACCAGCATCCAGTTCAA-3 5 -GGTTCAGTAGGCCATTCCTC-3 Pdk4 5 -AGAAGACCAGAAAGCCCTGTCA-3 5 -GCCATTGTAGGGACCACATTATG-3 Gys2 5 -GGAAGAAACTCTATGACGGGTTATT-3 5 -TCATCGATCATATTGTGAGTGGTC-3 Pygl 5 -GCACTACTACGACAAGTGTCCC-3 5 -TAAATGGCCTCATCGCAG-3 Ucp2 5 -GACCTCATCAAAGATACTCTCCTGAA- 5 -ATCTCGTCTTGACCACATCAACAG-3 Cpt1a 5 -CCTGGGCATGATTGCAAAG-3 5 -GGACGCCACTCACGATGTT-3 Rplp(36B4) 5 -GAAGACAGGGCGACCTGGAA -3 5 -TTGTCTGCTCCCACAATGAAGC-3 Supplementary Table S3. List of primer sets used for Q-RT PCR.

Supplementary Table S4. Antibody Company, Cat. Number Dilution Phospho-AMPKα (Thr172) Antibody Cell Signaling technology #2535 x1 AMPKα Antibody Cell Signaling technology #263 x1 Phospho-AMPKβ1 (Ser18) Antibody Cell Signaling technology #4181 x1 AMPKβ1/2 Antibody HSL Antibody Phospho-HSL (Ser563) Antibody ATGL Antibody Phospho-CREB (Ser133) Antibody Glycogen Synthase Antibody PYGB/L/M Antibody Cell Signaling technology #415 x1 Cell Signaling technology #417 x1 Cell Signaling technology #4139 x1 Cell Signaling technology #21 x1 Cell Signaling technology #9198 x25 Cell Signaling technology #93 x1 Santa Cruz technology sc-46347 x1 Supplementary Table S4. List of Antibodies used for immunoblotting

Supplementary Methods Transmission electron microscopic analyses of vagal nerves Seven days after perivagal treatment with capsaicin or vehicle, nerves were fixed in 2.5% glutaraldehyde in.1m sodium cacodylate buffer (ph 7.4), and postfixed in 1% osmium tetroxide. They were dehydrated in graded alcohols and embedded in Epon812. Ultrathin sections were stained with uranyl acetate and lead, and then examined under a transmission electron microscope (H-, Hitachi, Tokyo, Japan). Metabolic measurements Epinephrine, norepinephrine and dopamine were measured in plasma using a LaChrom Elite HPLC system (Hitachi, Tokyo, Japan) according to the manufacturer's instructions. Isolation and culture of primary hepatocytes and glycogen synthesis We prepared primary cultures of mouse hepatocytes and subjected them to adenovirus infection as previously described 5. Briefly, primary hepatocytes were isolated from 7-week-old male ICR mouse (CLEA, Tokyo, Japan). Cells were resuspended in William s E medium containing 1 nm insulin and 1 nm dexamethasone on 1-mm collagen-coated dishes at a final density of 8 x 1 6 cells. After incubation for 2 hr to allow attachment, the medium was replaced with high glucose DMEM with 1 nm insulin containing each 5 MOI adenovirus. Using mouse hepatocytes, studies of glycogen synthesis, gene expression and immunoblotting were performed as described previously 5. Briefly, Glycogen storage in hepatocytes were determined after washing the cells twice with ice-cold saline and by using amyloglucosidase digestion and subsequent glucose measurement. For RNA analysis, we incubated cells at 37 C for 8 hr after adenovirus infection at 1 MOI. For protein analysis, we stimulated adenovirus-infected cells with 5 nm insulin for 1 min after a 8-hr incubation. Assessment of sympathetic activity by measurement of catecholamine content after blockade of the sympathetic nervous system Measurement of catecholamine content in tissues was according to previously published methods 17. Briefly, epididymal white adipose tissue (WAT) was removed and frozen. Free catecholamines were extracted from WAT as follows: 1 mg WAT was homogenized on ice in 3 ml of.4 N perchloric acid with.2% EDTA-2Na and.2% L- ascorbic acid. Homogenized samples were centrifuged at 35 r.p.m. for 2 min on ice, and the supernatant was used. The concentration of catecholamines was determined using a

LaChrom Elite HPLC system (Hitachi, Tokyo, Japan) with electrochemical detection.

Supplementary References 5. Nakagawa, Y. et al. TFE3 transcriptionally activates hepatic IRS-2, participates in insulin signaling and ameliorates diabetes. Nat Med 12, 17-13 (26). 17. King, V. L. et al. Cold exposure regulates the norepinephrine uptake transporter in rat brown adipose tissue. Am J Physiol 2, R143-R151 (1999).