Early Environmental Regulation of Gene Expression: How Early Experience Exerts a Sustained Influence on Neuronal Function

Early Environmental Regulation of Gene Expression: How Early Experience Exerts a Sustained Influence on Neuronal Function Michael J Meaney Douglas Mental Health University Institute McGill University and Singapore Institute for Clinical Sciences michael.meaney@mcgill.ca

Summary The experience of the child is biologically embedded and serves to influence health and capacity over the lifespan.

Summary The experience of the child is biologically embedded and serves to influence health and capacity over the lifespan. This effect is apparent even at the level of the DNA of the individual; the activity of genes implicated in brain development and function are directly regulated by the social environment. This effect is potentially stable over time; the imprint of of childhood adversity on the genome is apparent at later ages, providing a biological basis for an enduring effect on health and capacity.

The development of an individual is an active process of adaptation that occurs within a social and economic context: To resource (food, shelter, safety) availability. To social interactions (e.g., parental signals).

Developmental Origins of Adult Disease Early experience Abuse Family strife Emotional neglect Harsh discipline Health Risks Depression Drug abuse Anxiety Diabetes Heart disease Obesity

How does family life influence health over the life span? Early experience Abuse Family strife Emotional neglect Harsh discipline Health Risks Depression Drug abuse Anxiety Diabetes Heart disease Obesity Individual differences in neural and endocrine responses to stress (defensive responses

Poverty Early experience Abuse Family strife Emotional neglect Harsh discipline Health Risks Depression Drug abuse Anxiety Diabetes Heart disease Obesity Individual differences in neural and endocrine responses to stress

Evolutionary biology - Maternal effects Environmental Parental Developmental condition signal outcome Nutrient Supply Mate Quality Violence Infection Population density Parental investment Defensive Strategies Foraging/Metabolism Reproductive Strategies Robert Hinde: Evolution has shaped the young to use parental signals as a forecast of the quality of the environment into which they have been born. For most species, there is no single, optimal phenotype.

Adversity Early experience Abuse Family strife Emotional neglect Harsh discipline Health and Human Capacity Individual differences in neural and endocrine responses to stress

Environmental regulation of phenotypic variation What is the biological basis for programming effects whereby environmental signals acting over perinatal development associate with stable changes in transcription and complex phenotypes (physiology, behaviour)?

Summary Parental care affects the activity of genes in the brain that regulate stress responses, neural development and reproduction. This parental effect involves a form a plasticity at the level of the DNA. Epigenetics: Any functional change in the genome that does not involve an alteration of DNA sequence.

If they ask you anything you don t know, just say its due to epigenetics.

+ - Prevents TF binding to DNA TF binding involves alteration of chromatin structure Nucleosome core particle: ribbon traces for the 146-bp DNA phosphodiester backbones (brown and turquoise) and eight histone protein chains (Luger et al. Nature 1997).

Acetyl group B. Turner. Chromatin structure and gene regulation. 2001.

Genetic code is defined by the sequence of four nucleotides that produce proteins. C T A C G T A C T C G G A A T C T C G RNAs, proteins Epigenetic effects refer to modifications of the DNA that alter the activity of the gene, but not its function. CH 3 CH 3 CH 3 C T A C G T A C T C G G A A T C T C G

DNA Methylation can inhibit gene expression by blocking transcription factor binding CH 3 CH 3 CH 3 CH 3 MeCP2/ MBD2 Methylated DNA binding protein CH 3 CH 3 SIN3a MeCP2/ MBD2 HDAC SIN HDAC HDAC: Histone deacetylase

HDAC B. Turner. Chromatin structure and gene regulation. 2001.

Multiple phenotypes from a common genotype Every cell in your body has the same nuclear genes, but?

Maternal licking/grooming Environmental epigenetics hypothesis: Environmental events activate intracellular signals that remodel the epigenome, leading to sustained alterations in the structure and function of the genome, and thus stable effects on gene transcription.

Parental signals as a source of phenotypic plasticity? Parental care Epigenetic marks Gene Phenotype expression

Maternal licking/grooming Source of tactile stimulation/nurturance: Enhances activity of endocrine systems (e.g., GH/IGF) that promote somatic growth, suppresses those (glucocorticoids) that inhibit growth

Frequency count Variations in maternal care 200 150 100 50 0 6 11 1 6 % Licking/grooming

Broad range of parental effects Stress responses Neural development Learning & memory Metabolism Reproduction (females)

High LG Low LG

Parental signals as a source of phenotypic plasticity? Parental care Epigenetic marks Gene Phenotype expression

Broad range of parental effects Stress responses Neural development Learning & memory Metabolism Reproduction (females)

Glucocorticoid Receptor Hippocampus (-) Stress Hypothalamus CRF/AVP Pituitary ACTH Adrenals Glucocorticoids CRF: corticotropin releasing factor. ACTH: adrenocorticotropin

Individual differences in glucocorticoid receptor levels lead to altered pituitary-adrenal responses to stress High LG offspring Low LG offspring (-) (-) (-) (-) Hypothalamus Hypothalamus CRF ACTH Pituitary CRF ACTH Pituitary Adrenals Glucocorticoids Adrenals Glucocorticoids

Plasma ACTH (pg/ml) Corticosterone (µg/dl) High LG offspring show more modest HPA stress responses 1000 High LG Low LG 80 70 High LG Low LG 800 60 50 600 40 400 30 20 200 10 0 Pre S10 S20 P20 P40 P60 P120 0 Pre 10 20 40 60 80 100 Disruption of hippocampal GR signaling eliminates this maternal effect

Cross-fostering reveals evidence for direct, postnatal effects of maternal care High LG offspring Low LG offspring (-) (-) (-) (-) Hypothalamus Hypothalamus CRF Pituitary CRF Pituitary ACTH ACTH Adrenals Glucocorticoids Adrenals Glucocorticoids

Hippocampal GR(1 7 ) mrna 1 2 3 4 5 6 7 8 9 1011 12 2 3 4 5 67 8 9 5 3

Relative ODU Hippocampal GR(1 7 ) mrna 1 2 3 4 5 6 7 8 9 1011 12 2 3 4 5 67 8 9 5 3 0.15 0.10 0.05 * * * High LG Low LG * 0.00 DG CA1 CA2 CA3

DNA sites that regulate glucocorticoid receptor gene Variable exon 1 region Constant region 1 2 3 4 5 6 7 8 910 1112 2 3 4 5 6 78 9 5 3 GR Promoter 1 7 Sequence 1681 ccc 1741 ctctgctagt gtgacacact t 1 cg 2 cgcaact c 3 cgcagttgg 4 cggg 5 cg 6 cgga ccacccctg 7 c 1801 ggctctgc 8 cg gctggctgtc accct 9 cgggg gctctggctg c 10 cgaccca 11 cg ggg 12 cgggct 1861 c 13 cgag 14 cggtt ccaagcct 15 cg gagtggg 16 cg gggg 17 cgggag ggagcctggg agaa NGFI-A

NGFI-A regulates GR gene expression NGFI-A GR gene GR mrna

c-methylation NGFI-A 5 tgcgggggcgggg 3 CH 3 CH 3 1.0 0.8 Low LG High LG 0.6 0.4 0.2 * 0.0 5 3 NGFI-A site

c-methylation NGFI-A 5 tgcgggggcgggg 3 CH 3 CH 3 5' CpG region of NGFI-A/RE 0.8 0.6 0.4 0.2 0.0 Low/Low High/High Low/High High/Low

DNA Methylation can inhibit gene expression by blocking transcription factors binding CH 3 CH 3 CH 3 CH 3 MeCP2/ MBD2 Methylated DNA binding protein MeCP2/ CH 3 CH MBD2 3 SIN HDAC SIN HDAC HDAC: Histone deacetylase

HDAC B. Turner. Chromatin structure and gene regulation. 2001.

Antibody/Input GR IR (ROD-IOD) Increased methylation of the exon 1 7 GR promoter associates with decreased H3K9ac, reduced NGFI-A binding and GR expression Histone Acetylation NGFI-A Association GR Expression 1.0 1.0 0.4 0.8 0.8 0.3 0.6 0.4 * 0.6 0.4 * 0.2 * 0.2 0.2 0.1 0.0 High Low 0.0 0 High Low High Low Effects are reversed with intra-hippocampal infusion of HDAC inhibitor

Corticosterone ( µg/dl) Glucocorticoid stress response Low/Veh Low/TSA High/Veh High/TSA 50 40 30 Low/Veh 20 10 0 Basal Stress Stress + 40 Stress + 60 Stress + 90 High/TSA Low/TSA High/Veh Time (min)

Offspring of Low LG mothers CH 3 CH 3 GGAGCCTGGGAGAACCAAGCCTCGGAGTGGGCGGGGGCGGGAG Lower levels of GR in hippocampus - Increased stress response Offspring of High LG mothers CH 3 GGAGCCTGGGAGAACCAAGCCTCGGAGTGGGCGGGGGCGGGAG High levels of GR in hippocampus - Modest stress response

Summary of in vivo and in vitro studies Tactile stimulation (maternal LG) (T 4 - T 3 ) 5-HT 5-HT7 receptor camp SP1 PKA CBP SP1 NGFI-A CBP CpGme Exon 1 7 promoter NGFI-A (egr-1, zif-268, krox-24)

5-HT SP1 camp PKA 5-HT7 rec CBP SP1 NGFI-A CBP GR gene CH CH CH 3 3 3 C T A C G T A C T C G G A A T C T C G

Do comparable processes occur in humans? Post-mortem studies of hippocampus. Samples from suicide victims/controls. QSBB (Gustavo Turecki) forensic phenotyping. Human exon 1F promoter (Turner & Muller, 2005)

Human glucocorticoid receptor gene Variable exon 1 region Constant region A B CD E F G H I J 2 3 4 5 67 8 9 5 3 Exon 1 F is the human ortholog of the rat exon 1 7 GR promoter (70% homology) and contains an NGFI-A consensus sequence.

GR mrna GR 1-F variants Human glucocorticoid receptor gene Variable exon 1 region Constant region A B C DE F G H I J 2 3 4 5 67 8 9 5 3 1.5 GR total 1.2 GR1 F 1.0 * 0.9 * 0.6 0.5 0.3 0.0 Control Suicide 0.0 Control Suicide

GR mrna/gapdh (log conc.) GR-1F mrna/gapdh (log conc.) Suicide vs abuse - GR expression GR total GR1 F 1.2 1.5 0.8 * 1.0 * 0.4 0.5 0.0 Control Suicide Suicide - Abuse + Abuse 0.0 Control Suicide Suicide - Abuse + Abuse

GR 1-F CpG Methylation (%) Suicide vs abuse - CpG methylation 60 * 40 20 0 Control Suicide Suicide - Abuse + Abuse

Controls Maltreatment (-) (-) (-) (-) Hypothalamus Hypothalamus CRF ACTH Pituitary CRF ACTH Pituitary Adrenals Glucocorticoids Adrenals Glucocorticoids Childhood maltreatment associates with increased central CRF levels and greater HPA and autonomic responses to stress (DeBellis et al 1994; Heim et al 2000; Lee et al 2005)

Childhood adversity and NR3C1 promoter methylation in DNA from periperhal samples

Attachment at 18 months (Secure Vs Insecure) associates with epigenetic variation (6-8 yrs) 612 probes. 5% (p<0.05) 345 genes Secure: Insecure: Microtubule formation TBCD (23.89%: Body) ABR (21.35%: Body) LTP CEBPE (19.70%: TSS200) SHANK2 (9.4%: 1 st Exon) DRD4 (5.76%: Body) Synaptic density

Reference 1: ADHDgene Database (I) 64

Reference 1: ADHDgene Database (II) 213 Genes in the ADHDgene database (24 Genes are hot genes) 36 Probes (25 Genes) of ADHD database genes are found in the 2907 DMPs list. ADRA1A ANK3 ARRB2 ATXN1 BAIAP2 BAIAP2 BAIAP2 BAIAP2 BAIAP2 BDNF CACNA1C CDH13 CHRNA4 CHRNA4 COMT DBH DRD4 EMP2 FGF10 GNAO1 HK1 HLA-DRB1 ITGA11 MEIS2 MEIS2 NCKAP5 PTPRG PTPRG SH3BP5 SH3BP5 SLC6A3 UNC5B UNC5B ZNF423 ZNF423 ZNF423

Child attention problems and co-methylation Child attention problems (SDQ) associated with differential methylation of 1747 probes (957 genes). 30 probes (22 genes) associated with child attention problems (-0.3 < r >0.3) show comethylation (-0.6 < r >0.6). r s = -0.36, p=0.02 r s = 0.36, p=0.02 r s = -0.64, p<0.001

DMPs 7 Genes(GO) + 94 Genes(Pathway) --123 Probes-- Hierarchical clustering of pair-wise correlation Pair-wise Correlation 1 20 0.8 0.6 40 60 80 100 0.4 0.2 0-0.2-0.4-0.6 The Most highly correlated cluster (30 probes, Avg Corr=0.8) 120 20 40 60 80 100 120 DMPs -0.8 Co-methylation Clusters 67

The partial mediating role of maternal psychopathology p = 0.001 Maternal depression (36 months) p = 0.008 Maternal emotional neglect p = 0.01 Child Maternal negative emotionality depression (36 (36 moths) months)

The partial mediating role of maternal psychopathology p = 0.001 Maternal depression (36 months) p = 0.008 Maternal emotional neglect p = 0.01 (Parenting) Child Maternal negative emotionality depression (36 (36 moths) months)

Do effective treatment programs that target mothers affect DNA methylation profiles in the children?

90 Unique Samples Infinium 450K Array Blood Samples 27 years old Variables: methy_grp (0= control/no treatment ;1=intervention) ETXGROUP: 1 and 2 = different forms of no treatment versus 3 and 4 which represent prenatal intervention and combined pre and postnatal intervention, respectively CHILDGENDER 1=male 2=female Child Abuse at age 4 and age 15 Child abuse is physical, sexual or emotional mistreatment or neglect

Principal Component Analysis Component Fstat p Gender (3.0%) 7.32.003 x 10-8 Abuse/4 yrs (3%) 5.80.002 x 10-2 Abuse/15yrs 1.67 ns

Principal Component Analysis Component Fstat p Gender (3%) 7.32.003 x 10-8 Abuse/4 yrs (3%) 5.80.002 x 10-2 Abuse/15yrs 1.67 ns Treatment (8%) 3.07.002 x 10-4

Conclusions The function of the genome is regulated by epigenetic signals that are subject to environmental regulation. These epigenetic signals reflect the quality of the dearly environment, and guide the development and function of the brain. These effects are potentially stable, but are subject to modification, potentially over the lifespan.

Family Parentchild Family Parentchild Transgenerational influences

Tongue-Flick Response to snake odours 4 3 2 1 Offspring are significantly larger and with longer tails 0 Control Perfume Snake

Defense to snake predation in skink lizards Most frequent prey smaller shorter tails less reactive to snake cues If mother has been exposed to the scent of a predatory snake then offspring are larger, with longer tails and.