Epigenetics and Chromatin Remodeling
|
|
- Lee Patrick
- 5 years ago
- Views:
Transcription
1 Epigenetics and Chromatin Remodeling Bradford Coffee, PhD, FACMG Emory University Atlanta, GA
2 Speaker Disclosure Information Grant/Research Support: none Salary/Consultant Fees: none Board/Committee/Advisory Board: none Membership: none Stocks/Bonds: none Honorarium/Expenses: none Intellectual Property/Royalty Income: none
3 1. Define epigenetics Learning objectives 2. Describe the relationship between chromatin structure, histone modifications, DNA methylation and gene expression. 3. Explain imprinting and the importance of uniparental disomy on the expression of imprinted regions. 4. Describe the many different molecular mechanisms can lead to loss of imprinted gene expression. 5. Compare the different methodologies available to test for DNA methylation as a marker of epigenetic disease.
4 Definition Epigenetics stable and heritable (mitotic and/or meiotic) changes in gene expression that do not entail a change in DNA sequence
5 Nucleosomes Felsenfeld and Groudine Controlling the double helix Nature 421:
6 Histone Modifications Bhaumik et al. Nat. Struct and Mol. Biol. 14:
7 DNA Methylation NH 2 CH 3 N N O occurs at the 5 th position in cytosine ~50 million 5-methylcytosines/genome (4-8% of the cytosines) In somatic cells 99.98% of cytosine methlyaion in CpGs In ES cells only ~75% of cytosine methylation in CpGs. The remaining ~25% is in mchg and mchh contexts (H=A,C or T) CpG islands encompass the 5 end of genes 50-60% of all genes in the human genome contain a CpG island
8 Modifications of the DNA and histones (and other chromatin proteins) act together to direct specific chromatin structures that control access to regulatory elements of genes. Two general states of chromatin- Euchromatin-open trancriptionally active genes Chromatin Structure Heterochromatin-closed transcriptionally repressed genes Constitutive-repetitive sequences Facultative-gene repression in specific cell types
9 Imprinting Definition-Exclusive or preferential expression of a gene from one of the two parental alleles ~ known imprinted genes in humans Found in clusters (imprinted regions). Maternally and paternally imprinted genes are clustered Imprinting is an epigenetic process. There is a change in gene expression without a change in the DNA sequence. These changes in gene expression are stable during meiosis.
10 Clusters of Imprinted Genes
11 Prader-Willi and Angelman Syndromes Sahoo et al Nat. Genet. 40: Prader-Willi syndrome (PWS) severe hypotonia in early infancy excessive eating later in childhood morbid obesity delayed motor milestones and delayed language development cognitive impairment Caused by loss of paternal gene expression. Angelman syndrome (AS) severe developmental delay mental retardation severe speech impairment gait ataxia tremulousness of the limbs inappropriate happy demeanor Caused by loss of maternal gene expression.
12 15q11-q13 Imprinted Gene Cluster
13 Molecular Mechanisms of PWS and AS 1. ~5 Mb deletions (mediated by flanking low copy repeats) ~70% of cases of PWS and AS on the paternal chromosome PWS on the maternal chromosome AS 2. Uniparental disomy (UPD) ~25-30% of cases of PWS maternal UPD ~5% of cases of AS paternal UPD 3. Single gene mutation N/A for PWS ~10% of AS due to mutation of UBE3A gene 4. Imprinting center mutation ~1% of PWS ~5% of AS 5. Unknown <1% of PWS 10%-15% of AS
14 Uniparental Disomy Trisomy Rescue genetests.org
15 Beckwith-Wiedemann and Russell Silver Syndromes Beckwith-Wiedemann (BWS) Russell Silver (RSS) macrosomia -prenatal and postnatal macroglossia abdominal wall defects (omphalocele, umbilical hernia) hemihyperplasia embryonal tumors growth retardation -prenatal and postnatal triangular shaped face normal head circumference (pseudohydrocephalus) fifth-finger clinodactyly limb-length asymmetry (hemihypotrophy) Both BWS and RSS caused by defects in imprinted gene expression at 11p15.5
16 11p15.5 Imprinted Gene Cluster RSS (Lit1) BWS Smith et al Pediatr. Res. 61: 43R-47R Beckwith Wiedemann Syndrome Russell Silver Syndrome matupd7 DMR1 hypomethylation unknown
17 Mechanisms Leading to Epigenetic Diseases 1. conventional sequence changes deletions removing imprinted gene(s) PWS, AS mutations that disrupt resetting imprint PWS, AS, RSS chromosome rearrangements BWS 2. uniparental disomy PWS, AS, UPD6, UPD7 (RSS) and UPD14 3. epimutations BWS, RSS, UPD14 DNA methylation is a marker for detecting if one of these mechanisms has occurred.
18 Methods to Detect Aberrant Methylation Clinical laboratories (locus specific) methylation restriction enzymes Southern blot Methylation Specific-MLPA bisulfite based methods Methylation Sensitive PCR (MSP) COBRA Quantitative-MSP (Q-MSP, Methyl-Light) Research laboratories (whole genome) MeDIP Illumina Infinium methylation assay Methylome sequencing
19 Southern Blot Using Methylation Senstive Enzymes CpG island XbaI ~1.1 kb KspI ~2.9 kb XbaI NEG PWS AS 4kb methylated (maternal) 1.1kb unmethylated (paternal)
20 Methylation Specific MLPA
21 Sodium Bisulfite Treatment of DNA
22 Methylation Specific PCR GCCGCGCGGCGGCAG methylated sodium bisulfite unmethylated GUCGCGCGGCGGUAG GUUGUGUGGUGGUAG PCR amplification GUCGCGCGGCGGUAG GCGCGCCGCCATC methylated DNA specific primer GUUGUGUGGUGGUAG ACACACCACCATC unmethylated DNA specific primer
23 Chr15 Methylation Analysis CpG island XbaI ~1.1 kb KspI ~2.9 kb XbaI 174bp methyl 100bp unmethyl 1 2 NEG PWS AS H2O 174bp methyl 100bp unmethyl Askree et al 2011 J. Mol. Diag. 23
24 Chr15 Methylation Analysis by MSP NEG PWS AS H2O Original primer set 174bp-methylated 100bp-unmethylated Alternate primer set 152bp-methylated 100bp-unmethylated Askree et al 2011 J. Mol. Diag. 24
25 UPD7 Methylation Analysis Chr7 GRB10 (7p11.2-7p12) patient samples Neg Pos H2O PEG1/MEST (7q32) GRB10 methylated (maternal) unmethylated (paternal) PEG1/MEST methylated (maternal) unmethylated (paternal)
26 Quantitative Methylation Specific PCR methylated CG CG CG CG CG CG CG CG unmethylated UG UG UG UG UG UG UG UG Amplification primers Taqman probe unmethylated DNA Taqman probe methylated DNA
27 Q-MSP Amplification Plots 1ng (~151 copies) B 8ng (~1208 copies) FAM methylated 64ng (~9664 copies) R 2 = 0.987, E = 96.4%, slope = ng (~151 copies) 8ng (~1208 copies) VIC unmethylated R 2 = 0.996, E = 92.6%, slope = ng (~9664 copies) Coffee et al. J. Mol. Diag. in press
28 Qualitative vs. Quantitative Assays If the disease is caused by underlying DNA sequence change (e.g. a deletion in PWS) or caused by UPD, a qualitative methylation assay will detect the disorder. If the disease is caused by epimutation (e.g. loss of methylation DMR2 in BWS), a quantitative assay is needed to detect changes in methylation. Mean methylation of unaffected population Mean methylation of disease population
29 1. Define epigenetics? Self-Assessment Questions 2. How do epigenetic modifications control gene expression? 3. List the molecular mechanisms of PWS and AS? 4. How does the mechanism of epigenetic disease determine if you use quantitative vs. qualitative methylation analysis in testing? 5. What are some of the molecular techniques used in clinical laboratories to test for aberrant DNA methylation?
Epigenetic contribution to birth defects. David Amor 20 th June 2011
Epigenetic contribution to birth defects David Amor 20 th June 2011 Genomic imprinting Genomic imprinting is the biological process whereby a gene or genomic domain is biochemically marked with information
More informationGenetics and Genomics in Medicine Chapter 6 Questions
Genetics and Genomics in Medicine Chapter 6 Questions Multiple Choice Questions Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the directions
More informationImprinting. Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821
Imprinting Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821 Learning Objectives 1. To understand the basic concepts of genomic imprinting Genomic imprinting is an epigenetic phenomenon that causes
More informationEpigenetic mutations in 11p15 in Silver-Russell syndrome are restricted to the telomeric imprinting domain
JMG Online First, published on October 19, 2005 as 10.1136/jmg.2005.038687 1 Epigenetic mutations in 11p15 in Silver-Russell syndrome are restricted to the telomeric imprinting domain Thomas Eggermann
More informationPRADER WILLI/ANGELMAN
SALSA MS-MLPA probemix ME028-B2 PRADER WILLI/ANGELMAN Lot B2-0811: As compared to version B1 (lot B1-0609, B1-1108), the 88 and 96 nt control fragments have been replaced (QDX2). PRADER-WILLI SYNDROME
More informationMRC-Holland MLPA. Description version 52; 22 July 2015
SALSA MS-MLPA probemix ME028-B2 Prader-Willi/Angelman Lot B2-0413, lot B2-0811. As compared to version B1 (lot B1-0609), the control fragments have been replaced (QDX2). PRADER-WILLI SYNDROME (PWS) and
More informationHigh resolution melting for methylation analysis
High resolution melting for methylation analysis Helen White, PhD Senior Scientist National Genetics Reference Lab (Wessex) Why analyse methylation? Genomic imprinting In diploid organisms somatic cells
More informationAn Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice
An Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice Mei-Yi Wu 1 *, Ming Jiang 1, Xiaodong Zhai 2, Arthur L. Beaudet 2, Ray-Chang Wu 1 * 1 Department of
More informationEpigenetics: Basic Principals and role in health and disease
Epigenetics: Basic Principals and role in health and disease Cambridge Masterclass Workshop on Epigenetics in GI Health and Disease 3 rd September 2013 Matt Zilbauer Overview Basic principals of Epigenetics
More informationRussell-Silver syndrome (RSS)
GENETIC DIAGNOSTIC LABORATORY Russell-Silver syndrome (RSS) Background: Russell-Silver syndrome (RSS, OMIM 103280, 180860) is a growth disorder characterized by intrauterine and postnatal growth retardation,
More informationNot IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
More information4/8/2016. Objectives. Epigenetic Definitions. Gene Expression. More Questions. Epigentics. Questions to Consider
Objectives Epigentics Lynda Britton, Ph.D., MLS(ASCP) CM Professor LSU Health Shreveport Discuss epigenetics and its role in cancer, imprinting and X chromosome inactivation. Describe the modifications/mechanisms
More informationEpigenetics 101. Kevin Sweet, MS, CGC Division of Human Genetics
Epigenetics 101 Kevin Sweet, MS, CGC Division of Human Genetics Learning Objectives 1. Evaluate the genetic code and the role epigenetic modification plays in common complex disease 2. Evaluate the effects
More informationProduct Description SALSA MS-MLPA Probemix ME028-C1 Prader-Willi/Angelman To be used with the MS-MLPA General Protocol.
Product Description SALSA MS- Probemix ME028-C1 Prader-Willi/Angelman To be used with the MS-MLPA General Protocol. Version C1. For complete product history see page 9. Catalogue numbers: ME028-025R: SALSA
More informationFragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype
Fragile X Syndrome Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype A loss of function of the FMR-1 gene results in severe learning problems, intellectual disability
More informationEpigenetics. Lyle Armstrong. UJ Taylor & Francis Group. f'ci Garland Science NEW YORK AND LONDON
... Epigenetics Lyle Armstrong f'ci Garland Science UJ Taylor & Francis Group NEW YORK AND LONDON Contents CHAPTER 1 INTRODUCTION TO 3.2 CHROMATIN ARCHITECTURE 21 THE STUDY OF EPIGENETICS 1.1 THE CORE
More informationLecture 27. Epigenetic regulation of gene expression during development
Lecture 27 Epigenetic regulation of gene expression during development Development of a multicellular organism is not only determined by the DNA sequence but also epigenetically through DNA methylation
More informationEpigenetics and diseases. Genetical analysis Irma takács
Epigenetics and diseases Genetical analysis Irma takács 30.11.2010. Epigenetic diseases Introduction Mechanism Diseases Miracle: Identical DNA different cells EPIGENETICS Epigenetics C.H. Waddington in
More informationPatterns of Single-Gene Inheritance Cont.
Genetic Basis of Disease Patterns of Single-Gene Inheritance Cont. Traditional Mechanisms Chromosomal disorders Single-gene gene disorders Polygenic/multifactorial disorders Novel mechanisms Imprinting
More informationEpigenetics and Human Disease
Epigenetics and Human Disease May 28, 2014 1 Angelman Syndrome & Prader-Willi Syndrome Sister Syndromes Angelman Syndrome ~1/20,000 births happy disposition smile often bouts of laughter minimal verbal
More informationFACT SHEET 15. Epigenetics. What is imprinting of genes? Produced by the Centre for Genetics Education. Internet:
Important points It is increasingly clear that translation of the genetic code into proteins is not the only way that our genes influence our growth, development and health and that changes in the genetic
More information4/20/2016. Objectives. Epigenetic Definitions. Gene Expression. More Questions. Questions to Consider
Objectives Epigentics: You Might Be What Your Grandmother Ate Lynda Britton, Ph.D., MLS(ASCP) CM Professor LSU Health Shreveport Discuss epigenetics and its role in cancer, imprinting and X chromosome
More informationInformation leaflet for patients and families. Uniparental Disomy (UPD)
Information leaflet for patients and families Uniparental Disomy (UPD) What are genes and chromosomes? Our genes are the unique set of instructions inside every cell of our body which make each of us an
More informationImprinting diseases and IVF. Øjvind Lidegaard Dept. Obstetrics & Gynaecology Herlev University Hospital Copenhagen, Denmark
Imprinting diseases and IVF Øjvind Lidegaard Dept. Obstetrics & Gynaecology Herlev University Hospital Copenhagen, Denmark Li/03 What is the difference between a mule and a hinny? Stallion Hingst Horse
More informationGenetics and Genomics in Medicine Chapter 6. Questions & Answers
Genetics and Genomics in Medicine Chapter 6 Multiple Choice Questions Questions & Answers Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the
More informationMethylation reprogramming dynamics and defects in gametogenesis and embryogenesis: implications for reproductive medicine
Univ.-Prof. Dr. Thomas Haaf Methylation reprogramming dynamics and defects in gametogenesis and embryogenesis: implications for reproductive medicine Epigenetics and DNA methylation Heritable change of
More informationMS-MLPA is a specific and sensitive technique for detecting all chromosome 11p15.5 imprinting defects of BWS and SRS in a single-tube experiment
(2008) 16, 565 571 & 2008 Nature Publishing Group All rights reserved 1018-4813/08 $30.00 www.nature.com/ejhg ARTICLE MS-MLPA is a specific and sensitive technique for detecting all chromosome 11p15.5
More informationR.C.P.U. NEWSLETTER. Beckwith Wiedemann Syndrome Carrie Crain, B.S.
R.C.P.U. NEWSLETTER Editor: Heather J. Stalker, M.Sc. Director: Roberto T. Zori, M.D. R.C. Philips Research and Education Unit Vol. XIX No. 1 A statewide commitment to the problems of mental retardation
More informationEpigenetics Armstrong_Prelims.indd 1 04/11/2013 3:28 pm
Epigenetics Epigenetics Lyle Armstrong vi Online resources Accessible from www.garlandscience.com, the Student and Instructor Resource Websites provide learning and teaching tools created for Epigenetics.
More informationToday. Genomic Imprinting & X-Inactivation
Today 1. Quiz (~12 min) 2. Genomic imprinting in mammals 3. X-chromosome inactivation in mammals Note that readings on Dosage Compensation and Genomic Imprinting in Mammals are on our web site. Genomic
More informationJayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3
Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3 1 Department of Biotechnology, JMIT, Radaur, Haryana, India 2 KITM, Kurukshetra, Haryana, India 3 NIDDK, National Institute of Health,
More informationJoanna Hillman Michael Higgins Lab Oncology for Scientists I 10/29/2015
Joanna Hillman Michael Higgins Lab Oncology for Scientists I 10/29/2015 ! Define Epigenetics & Genomic Imprinting! Discovery! What is the imprint! Lifecycle of an Imprint DMRs and ICEs! 2 main mechanisms
More informationClinical Genomics. Ina E. Amarillo, PhD FACMGG
Clinical Genomics Ina E. Amarillo, PhD FACMGG Associate Medical Director, Cytogenetics Lab (CaTG), Lab and Genomic Medicine Assistant Professor, Pathology and Immunology Outline Clinical Genomics Testing
More informationProposal form for the evaluation of a genetic test for NHS Service Gene Dossier
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name and description (please provide any alternative names you wish listed) (A)-Testing
More informationEpigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation
Epigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation Robert FEIL Director of Research CNRS & University of Montpellier, Montpellier, France. E-mail:
More informationFormal Genetics of Humans: Modes of Inheritance. Dr. S Hosseini-Asl
Formal Genetics of Humans: Modes of Inheritance Dr. S Hosseini-Asl 1 Autosomal dominant (AD) a: Wild type (Wt) allele A: Mutant allele aa: Normal phenotype Aa: Affected (heterozygous) AA: Affected (homozygous)
More informationGCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG
Lecture 6 GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG CGTACTGCAACCGGCGGGCCACGCCCCCGTGAAAAGAAGGTTGTT TTCTCCACATTTCGGGGTTCTGGACGTTTCCCGGCTGCGGGGCGG
More information2001 Oxford University Press Human Molecular Genetics, 2001, Vol. 10, No
2001 Oxford University Press Human Molecular Genetics, 2001, Vol. 10, No. 26 2989 3000 Tumor development in the Beckwith Wiedemann syndrome is associated with a variety of constitutional molecular 11p15
More informationGenetics Review. Alleles. The Punnett Square. Genotype and Phenotype. Codominance. Incomplete Dominance
Genetics Review Alleles These two different versions of gene A create a condition known as heterozygous. Only the dominant allele (A) will be expressed. When both chromosomes have identical copies of the
More informationFinal Project Genomic Imprinting: Relevance to human disease and theories of origin
Biochem 158/258 Siina Bruce Final Project Genomic Imprinting: Relevance to human disease and theories of origin Introduction Genomic imprinting is an epigenetic phenomenon in which the expression of a
More informationOVERVIEW OF EPIGENETICS
OVERVIEW OF EIENETICS Date: * Time: 9:00 am - 9:50 am * Room: Berryhill 103 Lecturer: Terry Magnuson 4312 MBRB trm4@med.unc.edu 843-6475 *lease consult the online schedule for this course for the definitive
More informationFacts About AS. What is Angelman Syndrome
What is Angelman Syndrome In 1965, Dr. Harry Angelman, an English physician, first described three children with characteristics now known as the Angelman syndrome (AS). He noted that all had a stiff,
More informationEpigenetics and Genomic Imprinting. IOM Workshop Arthur L. Beaudet JUNE 16, 2005
Epigenetics and Genomic Imprinting IOM Workshop Arthur L. Beaudet abeaudet@bcm.tmc.edu JUNE 16, 2005 EPIGENETICS ONE DEFINITION The study of changes in gene function that are stable and heritable (or potentially
More informationR. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS
R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS EPIGENETICS THE STUDY OF CHANGES IN GENE EXPRESSION THAT ARE POTENTIALLY HERITABLE AND THAT DO NOT ENTAIL A
More informationWhen to suspect Prader Willi Syndrome and how to diagnose it?
When to suspect Prader Willi Syndrome and how to diagnose it? Dr Chirita-Emandi Adela Dr Dobrescu Andreea Victor Babes University of Medicine and Pahrmacy Timisoara Emergency Hospital for Children Louis
More informationBeckwith-Wiedemann syndrome: imprinting in clusters revisited. Perspective. Eamonn R. Maher 1 and Wolf Reik 2 1
Beckwith-Wiedemann syndrome: imprinting in clusters revisited Perspective SERIES on epigenetic regulation Eamonn R. Maher 1 and Wolf Reik 2 1 Section of Medical and Molecular Genetics, Department of Paediatrics
More informationAnalysis of shotgun bisulfite sequencing of cancer samples
Analysis of shotgun bisulfite sequencing of cancer samples Kasper Daniel Hansen Postdoc with Rafael Irizarry Johns Hopkins Bloomberg School of Public Health Brixen, July 1st, 2011 The
More informationWhat is epigenetics?
Chapter 7 What is epigenetics? Learning points for this chapter After working through this chapter you should be able to: Define epigenetic, imprinting, uniparental disomy, CpG island Explain how DA is
More informationEPIGENOMICS PROFILING SERVICES
EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation
More informationThe significance of genomic imprinting in assisted reproduction
Gynaecological Clinic Rigshospitalet Copenhagen University The significance of genomic imprinting in assisted reproduction Øjvind Lidegaard Øjvind Gynaecological Lidegaard Clinic Rigshospitalet Copenhagen,
More informationDNA methylation & demethylation
DNA methylation & demethylation Lars Schomacher (Group Christof Niehrs) What is Epigenetics? Epigenetics is the study of heritable changes in gene expression (active versus inactive genes) that do not
More informationMost severely affected will be the probe for exon 15. Please keep an eye on the D-fragments (especially the 96 nt fragment).
SALSA MLPA probemix P343-C3 Autism-1 Lot C3-1016. As compared to version C2 (lot C2-0312) five reference probes have been replaced, one reference probe added and several lengths have been adjusted. Warning:
More informationDifferentially methylated regions in maternal and paternal uniparental disomy for chromosome 7
Research Paper Epigenetics 9:3, 351 365; March 2014; 2014 Landes Bioscience Research Paper Differentially methylated regions in maternal and paternal uniparental disomy for chromosome 7 Katariina Hannula-Jouppi
More informationEpigenetic events in medulloblastoma development
Neurosurg Focus 19 (5):E10, 2005 Epigenetic events in medulloblastoma development JANET C. LINDSEY, PH.D., JENNIFER A. ANDERTON, B.SC., MERYL E. LUSHER, PH.D., AND STEVEN C. CLIFFORD, PH.D. Northern Institute
More informationQuantitative Analysis of SRNPN Gene Methylation by Pyrosequencing as a Diagnostic Test for Prader Willi Syndrome and Angelman Syndrome
Papers in Press. First published March 30, 2006 as doi:10.1373/clinchem.2005.065086 Clinical Chemistry 52:6 000 000 (2006) Molecular Diagnostics and Genetics Quantitative Analysis of SRNPN Gene Methylation
More informationEpigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017
Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of
More informationMMB (MGPG) Non traditional Inheritance Epigenetics. A.Turco
MMB (MGPG) 2017 Non traditional Inheritance Epigenetics A.Turco NON TRADITIONAL INHERITANCE EXCEPTIONS TO MENDELISM - Genetic linkage (2 loci close to each other) - Complex or Multifactorial Disease (MFD)
More informationBisphenol A Exposure Disrupts Genomic Imprinting in the Mouse
Bisphenol A Exposure Disrupts Genomic Imprinting in the Mouse Martha Susiarjo 1,2, Isaac Sasson 3, Clementina Mesaros 4, Marisa S. Bartolomei 1,2 * 1 Department of Cell and Developmental Biology, University
More informationSAC review DNA methylation: a form of epigenetic control of gene expression
The Obstetrician & Gynaecologist 10.1576/toag.12.1.037.27556 http://onlinetog.org 2010;12:37 42 SAC review SAC review DNA methylation: a form of epigenetic control of gene expression Authors Derek H K
More informationStructural Chromosome Aberrations
Structural Chromosome Aberrations 2 Structural chromosome aberrations or chromosome mutations represent apart from aneuploidies the most frequent pathologic findings in applied chromosome diagnostics.
More informationMultiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016
Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016 Marwan Tayeh, PhD, FACMG Director, MMGL Molecular Genetics Assistant Professor of Pediatrics Department of Pediatrics
More informationStem Cell Epigenetics
Stem Cell Epigenetics Philippe Collas University of Oslo Institute of Basic Medical Sciences Norwegian Center for Stem Cell Research www.collaslab.com Source of stem cells in the body Somatic ( adult )
More informationEPIGENETICS AND HUMAN DISEASE
Annu. Rev. Genomics Hum. Genet. 2004. 5:479 510 doi: 10.1146/annurev.genom.5.061903.180014 Copyright c 2004 by Annual Reviews. All rights reserved First published online as a Review in Advance on June
More informationH19 Chromatin Insulator in Development and DiseaseEpigenetic Regulation of the
Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology 825 H19 Chromatin Insulator in Development and DiseaseEpigenetic Regulation of the BY CLAES HOLMGREN ACTA UNIVERSITATIS
More informationPredictive Blood DNA Markers for Breast Cancer Xiang Zhang, Ph.D.
Predictive Blood DNA Markers for Breast Cancer Xiang Zhang, Ph.D. Department of Environmental Health University of Cincinnati Background Breast cancer (BCa) The second most common cancer among women in
More informationChromatin-Based Regulation of Gene Expression
Chromatin-Based Regulation of Gene Expression.George J. Quellhorst, Jr., PhD.Associate Director, R&D.Biological Content Development Topics to be Discussed Importance of Chromatin-Based Regulation Mechanism
More informationI) Development: tissue differentiation and timing II) Whole Chromosome Regulation
Epigenesis: Gene Regulation Epigenesis : Gene Regulation I) Development: tissue differentiation and timing II) Whole Chromosome Regulation (X chromosome inactivation or Lyonization) III) Regulation during
More informationChapter 14 Beckwith Wiedemann Syndrome
Chapter 14 Beckwith Wiedemann Syndrome Michael DeBaun and Jennifer Horst Beckwith-Wiedemann syndrome (BWS) (OMIM 130650) is a disease of prenatal overgrowth, congenital malformations, and predisposition
More informationSupplemental Data: Detailed Characteristics of Patients with MKRN3. Patient 1 was born after an uneventful pregnancy. She presented in our
1 2 Supplemental Data: Detailed Characteristics of Patients with MKRN3 Mutations 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Patient 1 was born after an uneventful pregnancy. She presented
More informationGENDER James Bier
GENDER 2005-2008 James Bier Objectives 1. State the method of determining gender in several genetic systems. 2. List the three regions of the Y chromosome. 3. Describe the events that promote sexual development
More informationEpigenetics in evolution and disease
Epigenetics in evolution and disease Manel Esteller We are not our genes. Genes are just part of the story. We cannot fully blame our genome for our behaviour and susceptibility to disease. In Lehninger
More informationMeasuring DNA Methylation with the MinION
Measuring DNA Methylation with the MinION Winston Timp Department of Biomedical Engineering Johns Hopkins University Epigenetics: Modern Modern Definition of epigenetics involves heritable changes other
More informationNontraditional Inheritance
2 Nontraditional Inheritance SHAWN E. MCCANDLESS AND SUZANNE B. CASSIDY SUMMARY The rules of segregation of alleles originally defined by Gregor Mendel explained much of the phenomena associated with inheritance
More informationMRC-Holland MLPA. Description version 14; 28 September 2016
SALSA MLPA probemix P279-B3 CACNA1A Lot B3-0816. As compared to version B2 (lot B2-1012), one reference probe has been replaced and the length of several probes has been adjusted. Voltage-dependent calcium
More informationDNA Methylation and Cancer
DNA Methylation and Cancer October 25, 2016 Dominic Smiraglia, Ph.D. Department of Cancer Genetics From Alan Wolffe, Science and Medicine, 1999 Vital Statistics Human genome contains 3 billion bp ~ 50,000
More informationEpigenetics of discordant monozygotic twins: implications for disease
Castillo-Fernandez et al. Genome Medicine 2014, 6:60 REVIEW Epigenetics of discordant monozygotic twins: implications for disease Juan E Castillo-Fernandez, Tim D Spector and Jordana T Bell * Abstract
More informationEpigenetics: The Future of Psychology & Neuroscience. Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1
Epigenetics: The Future of Psychology & Neuroscience Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1 Nature versus Nurture Despite the belief that the Nature vs. Nurture
More informationMosaic UPD(7q)mat in a patient with silver Russell syndrome
Su et al. Molecular Cytogenetics (2017) 10:36 DOI 10.1186/s13039-017-0337-1 CASE REPORT Open Access Mosaic UPD(7q)mat in a patient with silver Russell syndrome Jiasun Su 1*, Jin Wang 1, Xin Fan 1, Chunyun
More informationHST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007
MIT OpenCourseWare http://ocw.mit.edu HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.
More informationMolecular Mechanisms Leading to the Phenotypic Development in Paternal and Maternal Uniparental Disomy for Chromosome 14
Clin Pediatr Endocrinol 2008; 17(4), 103-111 Copyright 2008 by The Japanese Society for Pediatric Endocrinology Review Article Molecular Mechanisms Leading to the Phenotypic Development in Paternal and
More informationThe silence of the genes: clinical applications of (colorectal) cancer epigenetics
The silence of the genes: clinical applications of (colorectal) cancer epigenetics Manon van Engeland, PhD Dept. of Pathology GROW - School for Oncology & Developmental Biology Maastricht University Medical
More informationGene Expression DNA RNA. Protein. Metabolites, stress, environment
Gene Expression DNA RNA Protein Metabolites, stress, environment 1 EPIGENETICS The study of alterations in gene function that cannot be explained by changes in DNA sequence. Epigenetic gene regulatory
More informationCHROMOSOMAL MICROARRAY (CGH+SNP)
Chromosome imbalances are a significant cause of developmental delay, mental retardation, autism spectrum disorders, dysmorphic features and/or birth defects. The imbalance of genetic material may be due
More informationSession 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology
Session 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology Bhaskar Gollapudi, Ph.D The Dow Chemical Company Workshop: Genetic Toxicology: Opportunities to Integrate New Approaches
More informationSharan Goobie, MD, MSc, FRCPC
Sharan Goobie, MD, MSc, FRCPC Chromosome testing in 2014 Presenter Disclosure: Sharan Goobie has no potential for conflict of interest with this presentation Objectives Review of standard genetic investigations
More informationLow frequency of imprinting defects in ICSI children born small for gestational age
(29) 17, 22 29 & 29 Macmillan Publishers Limited All rights reserved 118-4813/9 $32. ARTICLE www.nature.com/ejhg Low frequency of imprinting defects in ICSI children born small for gestational age Deniz
More informationR.C.P.U. NEWSLETTER. Hunting for Genes - It isn=t as easy as it looks! Angelman syndrome:
R.C.P.U. NEWSLETTER Editor: Heather J. Stalker, M.Sc. Director: Roberto T. Zori, M.D. R.C. Philips Research and Education Unit Vol. XII No. 1 A statewide commitment to the problems of mental retardation
More informationSNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY.
SAMPLE REPORT SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. RESULTS SNP Array Copy Number Variations Result: LOSS,
More informationI. Multiple Alleles. Chapter 5. Summary points. What pattern of inheritance is demonstrated in the following cross?
Chapter 5 Extensions and Modifications of Basic Principles I. Multiple Alleles The ABO blood group has multiple alleles codominance and complete dominance. In codominance, both alleles are expressed simultaneously.
More informationWhat#are#the#different#types#of#mutations#&#phenotypic#effects?#Give#an#example#of#a#disease#for#each.#
Mutation#Classifications:# a. Location# #understand#the#differences#and#consequences.# # o Germinal* *gametes,*inherited* o Somatic* *other*cells,*not*generally*inherited* o Autosomal* *within*genes*on*autosomes*
More informationEpigenetics DNA methylation. Biosciences 741: Genomics Fall, 2013 Week 13. DNA Methylation
Epigenetics DNA methylation Biosciences 741: Genomics Fall, 2013 Week 13 DNA Methylation Most methylated cytosines are found in the dinucleotide sequence CG, denoted mcpg. The restriction enzyme HpaII
More informationGenetic Assessment and Counseling
Genetic Assessment and Counseling Genetic counseling is the communication of information and advice about inherited conditions and a person seeking such advice is called a consultand. This process includes
More informationHistones modifications and variants
Histones modifications and variants Dr. Institute of Molecular Biology, Johannes Gutenberg University, Mainz www.imb.de Lecture Objectives 1. Chromatin structure and function Chromatin and cell state Nucleosome
More informationAddressing the challenges of genomic characterization of hematologic malignancies using microarrays
Addressing the challenges of genomic characterization of hematologic malignancies using microarrays Sarah South, PhD, FACMG Medical Director, ARUP Laboratories Department of Pediatrics and Pathology University
More informationEpimutations of the IG-DMR and the MEG3-DMR at the 14q32.2 imprinted region in two patients with Silver-Russell syndrome-compatible phenotype
Supplemental Items (Supplemental Tables 1-4 and Supplemental Figure 1) Epimutations of the IG-DMR and the MEG3-DMR at the 14q32.2 imprinted region in two patients with Silver-Russell syndrome-compatible
More informationAlthough DNA methylation has been considered the primary
Colloquium The insulation of genes from external enhancers and silencing chromatin Bonnie Burgess-Beusse, Catherine Farrell, Miklos Gaszner, Michael Litt, Vesco Mutskov, Felix Recillas-Targa, Melanie Simpson,
More informationcontact info. Course coordinator can be reached at
Course Outline BGEN3020 Introduction to Human Genetics Course Coordinator: Dr. David Merz Department of Biochemistry and Medical Genetics Faculty of Health Sciences Rm 324 Basic Medical Sciences Building
More informationSilver-Russell syndrome
Silver-Russell syndrome Emma Wakeling Consultant in Clinical Genetics North West Thames Regional Genetic Centre (Kennedy-Galton Centre) London, UK Silver-Russell syndrome Clinical features Genetic heterogeneity
More informationSALSA MLPA probemix P185-C2 Intersex Lot C2-1015: As compared to the previous version C1 (lot C1-0611), the lengths of four probes have been adjusted.
mix P185-C2 Intersex Lot C2-1015: As compared to the previous version C1 (lot C1-0611), the lengths of four s have been adjusted. The sex-determining region on chromosome Y (SRY) is the most important
More informationCYTOGENETICS Dr. Mary Ann Perle
CYTOGENETICS Dr. Mary Ann Perle I) Mitosis and metaphase chromosomes A) Chromosomes are most fully condensed and clearly distinguishable during mitosis. B) Mitosis (M phase) takes 1 to 2 hrs and is divided
More information