Targeting Kinases Critical for TMPRSS2-ERG Function in Prostate Cancer

Similar documents
Supplementary Material

microrna-200b and microrna-200c promote colorectal cancer cell proliferation via

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

Supplementary Information

Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas

Nature Neuroscience: doi: /nn Supplementary Figure 1

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

Synthesis and Biological Evaluation of Protein Kinase D Inhibitors

CANCER THERAPEUTICS: A NOVEL APPROACH

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as

Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer

Supplemental Data. Integrating omics and alternative splicing i reveals insights i into grape response to high temperature

ACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer

Supplementary Figure 1

Molecular Heterogeneity of High Gleason Prostate Cancer

Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated

BIO360 Fall 2013 Quiz 1

Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death

TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer

mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL-

CONTRACTING ORGANIZATION: Sloan Kettering Institute for Cancer Research New York, NY 10065

ISOGENIC CELL LINES. ATCC No. Designation Mutation Parental Cell Line Disease Cancer Model

MicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-

Supplementary Materials for

Figure S1. Figure S2. Figure S3.

SUPPLEMENTARY FIGURES

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Supplementary Figures

Plasma exposure levels from individual mice 4 hours post IP administration at the

Hunk is required for HER2/neu-induced mammary tumorigenesis

Megan S. Lim MD PhD. Translating Mass Spectrometry-Based Proteomics of Malignant Lymphoma into Clinical Application

Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from

Supplementary. presence of the. (c) mrna expression. Error. in naive or

Supplemental Figure S1A Notch1

Supplementary Figure 1. a. b. Relative cell viability. Nature Genetics: doi: /ng SCR shyap1-1 shyap

HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment.

Supplementary Figure 1. HeliScope CAGE revealed androgen-regulated signaling and differentially regulated promoters in hormone-refractory prostate

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.

SUPPLEMENTARY INFORMATION

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

SUPPLEMENTARY FIGURES AND TABLE

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Phospho-MED1-enhanced UBE2C locus looping drives castration-resistant prostate cancer growth

Functional genomics reveal that the serine synthesis pathway is essential in breast cancer

Protein Kinase C Modulates Wnt Signaling In Colon Tumoral Cell Lines

L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier

In Vitro Studies of the Aurora-Kinase Inhibitor MLN8237 in Prostate Cancer Cell Lines

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

ALM301: Allosteric Isoform selective Akt inhibitor

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

TITLE: Small Molecule Inhibitors of ERG and ETV1 in Prostate Cancer

Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.

TITLE: Targeting Sulfotransferase (SULT) 2B1b as a regulator of Cholesterol Metabolism in Prostate Cancer

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola

Supplementary Materials for

Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells

Clasificación Molecular del Cáncer de Próstata. JM Piulats

Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma

TITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well

SUPPLEMENTARY FIGURES AND TABLES

Supplementary Materials

Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase

SUPPLEMENTARY INFORMATION

Supplementary Materials for

ALK inhibitor resistance in ALKF1174Ldriven neuroblastoma is associated with AXL activation and induction of EMT

EFFECTORS IMPLICATED IN THE AC1 INHIBITORY EFFECT ON CELL MIGRATION IN PANCREATIC CANCER CELLS

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

Tumour growth environment modulates Chk1 signalling pathways and sensitivity to Chk1 inhibition

Lysine methyltransferase SMYD2 promotes cyst growth in autosomal dominant polycystic kidney disease

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,

Transcriptional and Epigenetic Mechanisms of Addiction

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

PSA and the Future. Axel Heidenreich, Department of Urology

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Figure S1A. Blood glucose levels in mice after glucose injection

CONTRACTING ORGANIZATION: Fred Hutchinson Cancer Research Center

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent

WNT5A enhances resistance of melanoma cells to targeted BRAF inhibitors

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

C-Phycocyanin (C-PC) is a n«sjfc&c- waefc-jduble phycobiliprotein. pigment isolated from Spirulina platensis. This water- soluble protein pigment is

BIK BIM NOXA PUMA MCL-1. p53

High Throughput Screening as a Research Tool. Robert Damoiseaux. Ph.D., Scientific Director Molecular Shared Screening Resources, UCLA

s u p p l e m e n ta ry i n f o r m at i o n

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.

Guangdong Medical University, Zhanjiang, China; 5 Guangxi Medical University, Nanning, China; 6 Department of Pathology, University of Michigan

ERG induces androgen receptor-mediated regulation of SOX9 in prostate cancer

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

TITLE: Oncogenicity and Selective Inhibition of ERG Splicing Variants in Prostate Cancer

Transcription:

Targeting Kinases Critical for TMPRSS2-ERG Function in Prostate Cancer Kyle Nakatsuka David Takeda, MD, PhD Lab of William Hahn, M.D., Ph.D. Broad Institute Summer Research Program in Genomics

TMPRSS2-ERG in Prostate Cancer TMPRSS2-ERG translocation causes ERG overexpression Expressed in 50% of prostate cancers Invasion, proliferation, survival Targets for prostate cancer therapy

Kinase Screen Identifies Potential ERG Modulators Kinase Inhibition High-throughput screen identifies 40 kinases likely to affect ERG Potential upstream modulators of ERG Mechanisms unknown Several are targets of existing kinase-inhibiting drugs

Methods Kinase Inhibition Drug treatment ERG protein expression ERG mrna expression Downstream target effects Viability phenotype

PP242 mtor Inhibition Reduces ERG Protein Expression Kinase Inhibition Control PP242 JX401 DMSO 0.1uM 1uM 10uM 1uM 10uM 50uM Reduced protein expression with mtor inhibition by PP242 No significant change in protein expression with other drugs

Downstream ERG Targets ARHGDIB mrna Expression 1.2 PLA1A mrna Expression Fold Change 1.2 1 0.8 0.6 0.4 0.2 0 kk control pp242 1uM pp242 10uM Treatment Fold Change 1 0.8 0.6 0.4 0.2 0 control pp242 1uM pp242 10uM Treatment

PP242 mtor inhibition downregulates ERG downstream target transcription Kinase Inhibition ARHGDIB mrna Expression Fold Change 1.2 1 0.8 0.6 0.4 0.2 0 control pp242 1uM pp242 10uM Treatment PLA1A mrna Expression Fold Change 1.2 1 0.8 0.6 0.4 0.2 0 control pp242 1uM pp242 10uM Treatment

PP242 mtor Inhibition Reduces ERG mrna Expression Kinase Inhibition 2.5 mtor Inhibition and ERG mrna Expression 2 Fold Change 1.5 1 0.5 0 control pp242 1uM pp242 10uM Treatment

mtor Inhibition Reduces Downstream ERG Target Expression mtor Inhibition and ERG mrna Expression Fold Change 3 2 1 0 control pp242 1 pp242 10 Treatment ARHGDIB mrna Expression Downstream ERG Targets 1.2 PLA1A mrna Expression 1.2 1 Fold Change 1 0.8 0.6 0.4 0.2 Fold Change 0.8 0.6 0.4 0.2 0 control pp242 1uM pp242 10uM Treatment 0 control pp242 1uM pp242 10uM Treatment

Viability Phenotype Kinase Inhibition Viability (% of initial) PP242 1 0.8 0.6 0.4 0.2 0 0.001 0.01 0.1 1 10 100 1.2 log(drug concentration) Viability (% of initial) Torin 1.2 1 0.8 0.6 0.4 0.2 0 0.00001 0.0001 0.001 0.01 0.1 1 log(drug concentration)

Conclusions mtor inhibition reduces ERG protein levels, increases ERG transcription Post-transcriptional ERG modification mtor is an upstream regulator of ERG Potential therapeutic target for ERG overexpressing tumors

Future Directions Determine other phenotypic effects Invasion, serum deprivation Confirm result in other mtor inhibitor drugs Mechanism Apply to other transcription factors

Acknowledgements Hahn Lab David Takeda William Kim Xiaoxing Wang Diane Shao Elizabeth Dwinell Elsa Beyer Mik Rinne Leo Yao Luo Yaara Zwang William Hahn SRPG Program Bruce Birren Eboney Smith Francie Latour SRPG Students

Questions?

Results Cell treatment by various kinase inhibitor drugs Viability by cell titer-glo ATP assay ERG protein expression by Western Blot ERG mrna expression by qrt-pcr Downstream target mrna Expression Mechanism, other mtor inhibitors, etc. Toxicity by kinase inhibition is not specific to ERG PP242 mtor inhibition downregulates ERG protein expression PP242 mtor inhibition upregulates ERG mrna expression PP242 mtor inhibition downregulates ERG downstream target transcription

Methods Kinase Inhibition Drug treatment ERG protein expression ERG mrna expression Downstream target effects Viability phenotype

Methods Kinase Inhibition Drug treatment ERG protein expression ERG mrna expression Downstream target effects Viability phenotype

Methods Kinase Inhibition Drug treatment ERG protein expression ERG mrna expression Downstream target effects Viability phenotype

Methods HT kinase screen identifies 40 ERG modulators Cell treatment by various kinase inhibitor drugs ERG protein expression by Western Blot ERG mrna expression by qrt-pcr Downstream target mrna Expression Mechanism, other mtor inhibitors, etc. Viability by cell titer-glo ATP assay

Methods Drug treatment ERG protein expression ERG mrna expression Downstream target effects Viability phenotype

Methods HT kinase screen identifies 40 ERG modulators

Methods HT kinase screen identifies 40 ERG modulators Cell treatment by various kinase inhibitor drugs

Methods HT kinase screen identifies 40 ERG modulators Cell treatment by various kinase inhibitor drugs Viability by cell titer-glo ATP assay

Methods HT kinase screen identifies 40 ERG modulators Cell treatment by various kinase inhibitor drugs Viability by cell titer-glo ATP assay ERG protein expression by Western Blot

Methods HT kinase screen identifies 40 ERG modulators Cell treatment by various kinase inhibitor drugs Viability by cell titer-glo ATP assay ERG protein expression by Western Blot ERG mrna expression by qrt-pcr

Methods HT kinase screen identifies 40 ERG modulators Cell treatment by various kinase inhibitor drugs Viability by cell titer-glo ATP assay ERG protein expression by Western Blot ERG mrna expression by qrt-pcr Downstream target mrna Expression

Methods Hypothesis: If the kinases identified by the shrna screen are involved in the ERG pathway, then their inhibition by drugs will reduce downstream signaling and phenotype

Kinase Inhibition and Viabilty IC50 Across Cell types LNCaP VCaP (ERG) PC3 BIX 12 24 36 Olaparib 9.0 - - JX401 32 34 46 SB 38 - - PP242 0.30 1.0 0.50 Torin 0.040 0.20 0.80 nilotnib 6.0 25 7.5 BX912 10-2.0

Kinase Inhibition and Viabilty IC50 Across Cell types LNCaP VCaP (ERG) PC3 BIX 12 24 36 Olaparib 9.0 - - JX401 32 34 46 SB 38 - - PP242 0.30 1.0 0.50 Torin 0.040 0.20 0.80 nilotnib 6.0 25 7.5 BX912 10-2.0 Kinase inhibition viability phenotype (toxicity) not specific to ERG

Kinase Inhibition and Viabilty Kinase inhibition viability phenotype (toxicity) not specific to ERG LNCaP VCaP PC3 BIX 12 24 36 Olaparib 9.0 - - JX401 32 34 46 SB 38 - - PP242 0.30 1.0 0.50 Torin 0.040 0.20 0.80 nilotnib 6.0 25 7.5 BX912 10-2.0

Results Cell treatment by various kinase inhibitor drugs Viability by cell titer-glo ATP assay ERG protein expression by Western Blot ERG mrna expression by qrt-pcr Downstream target mrna Expression Mechanism, other mtor inhibitors, etc. Toxicity by kinase inhibition is not specific to ERG

Results Reduced protein expression at 12, 24 hours

Results Reduced protein expression at 12, 24 hours

Results Reduced protein expression at 12, 24 hours Quantification? Incluir todo con actin?

Results Cell treatment by various kinase inhibitor drugs Viability by cell titer-glo ATP assay ERG protein expression by Western Blot ERG mrna expression by qrt-pcr Downstream target mrna Expression Mechanism, other mtor inhibitors, etc. Toxicity by kinase inhibition is not specific to ERG PP242 mtor inhibition downregulates ERG protein expression

PP242 Increases ERG Transcription 120 100 Kinase Inhibition and ERG mrna Expression Percent Change (%) 80 60 40 20 0-20 -40 bix 10 bix 50 jx401 10 jx401 50 pp242 1 pp242 10 SB 10 SB 50-60 Treatment Drug Inhibits PP242 mtor Measured Effect Increased ERG mrna levels

Results Cell treatment by various kinase inhibitor drugs Viability by cell titer-glo ATP assay ERG protein expression by Western Blot ERG mrna expression by qrt-pcr Downstream target mrna Expression Mechanism, other mtor inhibitors, etc. Toxicity by kinase inhibition is not specific to ERG PP242 mtor inhibition downregulates ERG protein expression PP242 mtor inhibition upregulates ERG mrna expression

Kinase Inhibition and ERG Target Transcription PLA1A and ARGHD1B are downstream targets of ERG Kinase Inhibition and ARGHDIB Transcription Kinase Inhibition and PLA1A Transcription Percent Change (%) 40 20 0-20 -40-60 bix 10uM bix 50uM pp242 1uM pp242 10uM jx401 10uM Treatment jx401 50uM SB 10uM SB 50uM Percent Change (%) 60 40 20 0-20 -40-60 bix 10 bix 50 jx401 10 jx401 50 pp242 1 Treatment pp242 10 SB 10 SB 50 Drug Inhibits Measured Effect PP242 mtor Reduced ERG target mrna BIX MEK Increased ERG target mrna

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback