Activation of Nrf2 by the dengue virus causes an increase in CLEC5A, which enhances TNF-α production by mononuclear phagocytes

Similar documents
human epithelial cells were pretreated with control sirna (50 nm) or GSK-3β sirna (50 nm)

Doctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

SUPPLEMENTARY INFORMATION

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

VOICES OF THE HIDDEN

Downregulation of angiotensin type 1 receptor and nuclear factor-κb. by sirtuin 1 contributes to renoprotection in unilateral ureteral

Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene. Fig. S1. STING ligands-mediated signaling response in MEFs. (A) Primary MEFs (1

NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin

microrna-200b and microrna-200c promote colorectal cancer cell proliferation via

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Additional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript.

Supplementary Figure 1

nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering

Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplemental Information

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation

SD-1 SD-1: Cathepsin B levels in TNF treated hch

Dynamic Interaction of Stress Granule, DDX3X and IKK-α Mediates Multiple Functions in

Nature Medicine: doi: /nm.4078

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle

Tel: ; Fax: ;

SUPPLEMENTARY FIGURES AND TABLE

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS

SUPPLEMENTARY LEGENDS...

T H E J O U R N A L O F C E L L B I O L O G Y

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Supplementary figure legends

Supplementary information

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected

Supporting Information

Supplementary Figure 1

Supplementary Materials for

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

F-actin VWF Vinculin. F-actin. Vinculin VWF

Human recombinat MIF protein (hrmif), MW: Da. m/z. hrmif ( Da) + 4-IPP (282 Da) MWtot ~ Da. m/z.

33VASTVNGATSANNHGEPPS51PADARPR58

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

Supplementary Figure 1

Supplementary Information

Phosphoinositides Regulate Ciliary Protein Trafficking to Modulate Hedgehog Signaling

Supplementary Materials for

Supplementary Materials for

Prolonged mitotic arrest induces a caspase-dependent DNA damage

A. Generation and characterization of Ras-expressing autophagycompetent

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a

A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain

SUPPLEMENTAL FIGURE LEGENDS

FIG S1 Examination of eif4b expression after virus infection. (A) A549 cells

Nature Immunology: doi: /ni.3866

Supplemental Material:

Nature Immunology doi: /ni.3268

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

Influenza virus exploits tunneling nanotubes for cell-to-cell spread

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY FIGURES AND TABLES

Relative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC

Nature Medicine: doi: /nm.4322

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer

Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury

P-Akt Thr308. T-Akt *** *** Anti-α3 IgG Ctrl

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Involvement of FKBP6 in hepatitis C virus replication

SUPPLEMENTARY INFORMATION

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.

Supplementary Methods: IGFBP7 Drives Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibition in Lung Cancer

ph and Reduction Dual Responsive Polyurethane Triblock Copolymers for Efficient Intracellular Drug Delivery

Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108

Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis

The antibodies against 5-bromo-2 -deoxyuridine specifically recognize

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-

Supplementary Information. Table of contents

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were

Protein tyrosine phosphatase 1B targets PITX1/p120RasGAP. thus showing therapeutic potential in colorectal carcinoma

Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the

Nature Immunology: doi: /ni Supplementary Figure 1. IC261 inhibits a virus-induced type I interferon response.

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the

Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or

Supplemental Figures:

Supplemental Information

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplementary Material

Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times.

Supplementary Materials

SUPPLEMENTARY INFORMATION

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION

Transcription:

Nrf2 mediates induced CLEC5A and TNFα Activation of Nrf2 by the dengue virus causes an increase in CLEC5A, which enhances TNFα production by mononuclear phagocytes YiLin Cheng 1,2, YeeShin Lin 1,2,3, ChiaLing Chen 4, TsungTing Tsai 5, ChengChieh Tsai 6, YanWei Wu 1,2, YiDan Ou 3, YuYi Chu 7, JuMing Wang 1,2,7, ChiaYi Yu 3, and ChiouFeng Lin 2,5,8 * 1 Institute of Basic Medical Sciences, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan; 2 Center of Infectious Diseases and Signaling Research, National Cheng Kung University, Tainan 701, Taiwan; 3 Department of Microbiology and Immunology, College of Medicine, National Cheng Kung University, Tainan 701, Taiwan; 4 Translational Research Center, Taipei Medical University, Taipei 110, Taiwan; 5 Department of Microbiology and Immunology, College of Medicine, Taipei Medical University, Taipei 110, Taiwan; 6 Department of Nursing, Chung Hwa University of Medical Technology, Tainan 717, Taiwan; 7 Institute of Bioinformatics and Biosignal Transduction, National Cheng Kung University, Tainan 701, Taiwan; 8 Graduate Institute of Medical Sciences, College of Medicine, Taipei Medical University, Taipei 110, Taiwan Supplemental figure legends Figure S1 Protein assay for Figure 1. Figure S2 Protein assay for Figure 2. Figure S3 Protein assay for Figure 3. Figure S4 Protein assay for Figure 4. Figure S5 Protein assay for Figure 5. 1

Nrf2 mediates induced CLEC5A and TNFα Figure S6 Impact of NS2B3, NS3 or GFPFlag on ER stress, Nrf2 activation and CLEC5A expression. RAW264.7 cells were transfected with pcr3.1 vector (vector), pcr3.1ns2b3flag (NS2B3), or pcr3.1ns3flag (NS3). (A) Western blot analysis showed the expression of Flag. (B) ARE activity assay was performed to illustrate Nrf2 activation. (C) Confocal immunostaining was used to detect nuclear translocation of Nrf2 (green) in transfected cells. DAPI was used as a nuclear stain (blue). RAW264.7 cells were transfected with GFPFlag or NS2B3Flag. Western blot analysis showed the expression of Flag (D), phosphorylated PERK Thr981, PERK, and CLEC5A (E). The relative protein expression was determined by the ratio of the detected proteins to an internal βactin control. (F) Flow cytometric analysis of the surface expression of CLEC5A in NS2B3transfected RAW264.7 cells. The data are shown as the mean fluorescent intensity. (G) Confocal immunostaining was used to detect nuclear translocation of Nrf2 (green) in transfected cells. DAPI was used for nuclear staining (blue). For all quantified data, values are presented as the mean ± SD of three independent experiments. *P < 0.05 and **P < 0.01, compared with vector or GFPFlag. ns, not significant. Figure S7 Protein assay for Figure 6. 2

Cheng et al. Supplemental Figure 1 For Figure 1A For Figure 1B 55 130 43 34 NS1 95 26 72 55 43 34 βactin 72 55 43 Nrf2 βactin (MOI) 50 34 shluc shnrf2

Cheng et al. Supplemental Figure 2 For Figure 2B pperk PERK IRE1 α ATF6 (Proform) ATF6 (Cleaved form) 34 55 CHOP 72 170 130 95 95 170 130 72 95 130 72 170 95 55 43 43 34 55 43 0 1 3 6 (h)

Cheng et al. Supplemental Figure 3 26 For Figure 3A 26 For Figure 3C 26 For Figure 3D 17 130 17 72 55 43 34 43 34 26 NS3 NS1 55 95 72 Scremble sirna Nrf2 sirna Nrf2 55 43 34 26 17 55 43 34 ATRA DMSO 34 26 For Figure 3E 72 55 43 34 26 34 26 34 43 26 17 4PBA GSK 17 26 55 43 34 0 1 3 6 12 24 48 (h) 55 43 34 4PBA GSK 26 4PBA GSK

Cheng et al. Supplemental Figure 4 For Figure 4B 72 26 17 55 43 Scramble sirna CLEC5A sirna

Cheng et al. Supplemental Figure 5 For Figure 5A For Figure 5B 95 72 55 43 34 Flag 170 130 95 170 130 pperk PERK 26 Flag 95 72 17 72 26 55 43 17 Vector NS2B3 55 43 34 26 Vector NS2B3

Cheng et al. Supplemental Figure 6 A B C Flag 130 95 72 55 43 34 26 17 Vector NS2B3 NS3 Relative ARE Activity (Fold increase) 4 3 2 1 0 Vector D E F G Flag 95 72 55 43 34 26 pperk PERK CLEC5A βactin βactin βactin * NS2B3 0.6 1.7 0.3 0.6 ns NS3 Vector NS2B3 NS3 Nrf2/DAPI 100 80 60 40 20 0 ** GFPFlag NS2B3Flag 10 μm 10 μm 10 μm GFPFlag NS2B3Flag GFPFlag NS2B3Flag GFPFlag NS2B3Flag CLEC5A surface expression(gm)

Cheng et al. Supplemental Figure 7 95 72 130 For Figure 6B NS3 For Figure 6C 26 55 55 43 34 NS1 43 Mock 26 3 Day 5 Day 8 Day 43 34 34 For Figure 6E 26 Mock 26 17 55 43 Mock ATRA n4 n5 n4 n4 n5 n5