Journal of Genetics, Vol. 96, No. 4, September 2017, pp. 695 700 DOI 10.1007/s12041-017-0809-4 Indian Academy of Sciences RESEARCH NOTE Clinical and genetic characterization of six cases with complete androgen insensitivity syndrome in China JING HE 1, SHUWU QI 2, HUIJUN ZHANG 1, JINGJING GUO 1, SHU CHEN 1, QI ZHANG 3 and BAOSHENG ZHU 1 1 Genetic Diagnosis Center, Yunnan Provincial Key Laboratory for Birth Defects and Genetic Diseases, The First People s Hospital of Yunnan Province, Kunming 650032, Yunnan, People s Republic of China 2 Urologic Surgery, The First People s Hospital of Yunnan Province, Kunming 650032, Yunnan, People s Republic of China 3 Faculty of Life Science and Technology, Kunming University of Science and Technology, Kunming 650500, People s Republic of China *For correspondence. E-mail: Qi Zhang, qzhang37@gmail.com; Baosheng Zhu, bszhu@aliyun.com. Received 25 September 2016; revised 9 December 2016; accepted 13 December 2016; published online 31 August 2017 Abstract. The mutations of androgen receptor (AR) gene are the most common cause for complete androgen insensitivitysyndrome (CAIS). We aimed to characterize the six cases enrolled in our hospital (the First People s Hospital of Yunnan, China) and explore the molecular mechanism of CAIS. Between 2010 and 2013, six female cases were enrolled in our hospital for the agenesis of secondary sexual characteristics. The clinical examinations such as sex hormone test and B ultrasound were performed and the genetic characterization of patients were evaluated by karyotype analysis, polymerase chain reaction and DNA sequencing. The six cases with 46, XY karyotype were diagnosed with CAIS and four novel AR mutations were discovered, which were responsible for Chinese CAIS. The molecular study of the AR gene facilitated the understanding of the mechanism of CAIS and provided the genetic counselling clinically. Keywords. androgen receptor; complete androgen insensitivity syndrome; mutation; karyotype analysis; DNA sequencing. Introduction Androgen insensitivity syndrome (AIS) is an X-linked recessive genetic disease, which is characterized by partial or complete cell resistance to androgens (Galani et al. 2008). Patients with AIS are male with 46, XY karyotypes and exhibit different phenotypes ranging from a normal male habitus, with the defect of male secondary sex characters (partial AIS), to a complete AIS (CAIS) (Ferlin et al. 2006; Zuccarello et al. 2008). The AR gene mutation is the most common cause of AIS and currently more than 400 mutations of AR gene have been reported, such as point mutations, nucleotide insertions, deletions, and complete or partial gene deletion (Gottlieb et al. 2012). It is reported that the AR gene mutation of Arg840Cys substitution is found in a Chinese family with AIS, which may be associated with infertility of Jing He and Shuwu Qi contributed equally to this work. male with hypospadias (Chu et al. 2002). In another report, two missense mutations of AR gene (such as GAC732ACC and GCC765ACC) have been first detected in two Chinese cases with CAIS (Ko et al. 1997). However, the AR mutations in Chinese CAIS patients have not been fully characterized. In this study, we report six Chinese CAIS patients with different AR mutations and expect that our findings could be adapted for genetic counselling in the clinic. Methods Patients Six of eight patients aged between 12 and 22 years were diagnosed with CAIS in our hospital (the First People s Hospital of Yunnan, China) between 2010 and 2013. All patients were raised as girls and there are no family records for these cases. Blood samples were collected for karyotype 695
696 Jing He et al. Table 1. Clinical information of six cases with CAIS. Case Age (year) Height (cm) Clinical features Sex hormone B-ultrasound 1 19 162 Normal female external genitalia, normal breast development, absence of pubic hair and blind-ending vagina 2 22 160 Normal female external genitalia, normal breast development, absence of pubic hair and blind-ending vagina 3 17 161 Normal breast development, male breast development, normal female external genitalia 4 18 163 Normal female external genitalia, poor breast development, sparse pubic hair 5 20 165 Normal female external genitalia, poor breast development 6 12 160 Normal female external genitalia, blind-ending vagina hfsh: 8.5 (1.5 11.5 mu/ml); LH: 22.29 (1.1 8.2 mu/ml); Prol: 11.15 (2.7 17 ng/ml); E: 21.58 (0 60 pg/ml); Testo: 6.41 (2.5 10.51 ng/ml) hfsh: 22.47 (1.5 12.4 mu/ml); LH: 32.89 (1.7 8.6 mu/ml); Prol: 20.4 (4.1 18.4 ng/ml); E: 18.4 (28 156 pmol/l); Testo: 11.2 (6.68 25.7 nmol/l) hfsh: 46.9 (0.95 11.95 mu/ml); LH: 19.13 (1.14 8.75 mu/ml); Prol: 40.53 (3.69 19.4 ng/ml); E: <10 (11 44 pg/ml); Testo: 0.6 (1.66 8.77 ng/ml) hfsh: 119.44 (1.27 19.26 mu/ml); LH: 65.2 (1.24 8.64 mu/ml); Prol: 13.94 (2.64 13.13 ng/ml); E: 39 (20 70 pg/ml); Testo: 2.58 (1.75 7.81 ng/ml) hfsh: 3.68 (1.27 19.26 mu/ml); LH: 36.4 (1.24 8.64 mu/ml); Prol: 25.48 (2.64 13.13 ng/ml); E: 66 (20 70 pg/ml); Testo: 8.08 (1.75 7.81 ng/ml) hfsh: 3.72 (0.95 11.95 mu/ml); LH: 0.64 (1.14 8.75 mu/ml); Prol: 15.41 (3.69 19.4 ng/ml); E: <10 (11 44 pg/ml); Testo: 0.47 (1.66 8.77 ng/ml) Uterus and bilateral ovaries Primordial uterus and left side of ovary Infantile uterus without bilateral ovaries Without obvious uterus, ovary or testis Without obvious uterus, ovary or testis Bilateral inguinal hernia without obvious uterus and bilateral ovaries hfsh, human pituitary follicle stimulating hormone; LH, luteinizing hormone; Prol, proligestone; E, estradiol; Testo, testosterone. analysis and Y chromosome SRY gene detection. The physical examination and the basic information of the six patients are listed in table 1. Polymerase chain reaction (PCR) amplification of AR gene The primers of AR gene were designed by Primer 5 and synthesized by Shanghai Invitrogen Corporation (table 2). PCR reaction system (50 µl), contained genomic DNA 30 ng, deoxyonucleoside triphosphates (dntp) 200 µmol/ L, 10 PCR buffer 5 µl, MgCl 2 15 mmol/l and thermostable DNA polymerase (Taq enzyme) 1 U. PCR was performed as follows: initial denaturation at 94 C for 5 min followed by 35 cycles of 94 C for 30 s, annealing (according to table 1) for 30 s, 72 C for 1 min, and a final elongation step at 94 C for 10 min. The PCR amplification reagents were purchased from the treasure Biotechnology (Dalian, China). After amplification, the PCR products were evaluated by using 1% agarose gel electrophoresis and sequenced by Beijing Genomics Institute (Beijing, China). Histopathologic examination The gonadal tissues were isolated during surgery for pathological examination. The tissues were fixed in 10% formalin and embedded by paraffin. The serial sections (3 µm thickness) were cut and stained with hematoxylin eosin. This study was approved by the Ethics Committee of the First People s Hospital of Yunnan Province and the study procedures were performed in accordance with the ethical standards. The patients or their parents provided informed consents before the clinical research. Results A peripheral chromosome analysis showed 46, XY karyotype for all the six patients, which was determined by SRY gene amplification. The PCR amplification and sequencing of AR gene exons showed that case 1 had a single nucleotide T-to-C transition in exon 7, which resulted in an amino acid substitution from arginine to cysteine at 856 site (figure 1a). In case 2, 1666C nucleotide deletion was detectedin exon 2 of AR gene, leading to frameshift mutation and termination of 560th amino acid (figure 1b). In addition, there was a missense mutation of C2076A in exon 4 of case 3, resulting in 692th amino acid residue substitution from asparaginate to lysine (N692K) (figure 1c). In case 4, the nonsense mutation of C1477T was detected in exon 1 of AR gene, which eventually led to
Table 2. Primers and amplified fragment length of AR gene. Six cases of Chinese CAIS 697 Exon Sequence Fragment length (bp) T m ( C) 1 1 F: GAACTCTTCTGAGCAAGAGAAGG 783 60 R: CTTCGGATACTGCTTCCTGCTG 2 1 F: CTTAAGCAGCTGCTCCGCTG 462 58 R: CAGCCTAGGCTCTCGCCTTC 3 1 F: CTCTGCTAGACGACAGCGCAG 819 56 R: TAGGAGCCGCTAGATACCCCA 4 2 F: TCACACCCTACAACCATCATC 532 56 R: CCTGTACAAACAAGGCTGCTG 5 3 F: CAAATTGTTTGGTGCCATACT 402 58 R: TATGAAAGGGTCAGCCTGTGTC 6 4 F: GAGTCTGTGACCAGGGAGAATG 533 60 R: CAGGGTTATGATGAAGACTGCCT 7 5 F: CTCCATCATCATCTCATTTGAG 532 56 R: AGCCGCCTCATACTGGATTG 8 6 F: CTGGAGCACCAGCAGGAGA 368 60 R: ATGTCCAGGAGCTGGCTTTTC 9 7 F: TGAGATCTCCCTGACAGACTG 465 60 R: GACCACACTCAAAGCCAGAG 10 8 F: GAGGAAACAAAAGGCTGAAAGA 357 60 R: CAAGGCACTGCAGAGGAGTAGT the termination of 492th amino acid (figure 1d). In case 5, a frameshift mutation of 2301delT was detected, which resulted in the termination of the 787th amino acid (figure 1e). In case 6, 2069-2071AGG nucleotide deletion was detected in exon 4 (figure 1f). Although this mutation was in two codons, the variation led to the loss of 691th amino acid (aspartic acid). Pathological examination Four of six patients (cases 3, 4, 5 and 6) received gonad removal and vulva anaplasty in our hospital. The gonadal tissues were subjected to pathological examination. As shown in figure 2, the gonadal tissues were confirmed to be the dysgenetic testicular tissues. After the surgery, the four patients maintained female sexual characteristics by the hormone replacement. Discussion AIS, also served as testicular feminization syndrome is referred to the patients with inability to response to circulating androgens (Morris 1953). Androgen plays a regulatory role in the differentiation of male sex and the reproductive function maintenance by binding to AR. The most common cause of AIS is the mutations of AR gene. Mutations in cases 1, 3 and 5 were detected in the ligandbinding domain (LBD) region. According to the AR Gene Mutations Database, most mutations of AR were located in LBD. LBD plays a key role in the interactions of AR protein with androgen hormone. Androgen mediates the activation of target genes and induced the AR migration to the cell nucleus by binding LBD (Sack et al. 2001). Loss or mutation of LBD leads to inactivation of the receptor and dysfunction of AR. In our study, the mutation in case 2 was located in the DNA-binding domain (DBD) region. DBD is a relatively small and conserved protein domain, which is composed of two zinc finger structures. Mutations located in the DBD can cause changes in the zinc finger structure and result in CAIS (Hughes et al. 1986; Quigley et al. 1992). In case 4, the mutation was detected in N-terminal domain (NTD) that was encoded by exon 1. The percentage of mutations in exon 1 for AIS is only 25%, while it is 70% for CAIS (Eisermann et al. 2013). Function activation 1 (AFl) is an important active region in NTD, which is involved in the interaction of N-terminal/C-terminal regions. The mutation in case 4 is located in AFl. The mutation in case 6 was detected in the hinge region (HR), which was associated with phosphorylation, acetylation, and degradation of AR protein (Eisermann et al. 2013). In the present study, there are different mutations of AR gene for the six cases, which induced the variation in the structure of AR and inhibited the interaction of AR protein and androgenic hormone. Among the six cases, the mutations in case 1 (C2566T) (Ahmed et al. 2000; Melo et al. 2003; Ledig et al. 2005) and case 5 (2301delT) (Hannema et al. 2004; Cheikhelard et al. 2008; Hoebeke et al. 2011) have been reported in previous studies. To our knowledge, the mutations of AR gene in the remaining four cases have been first reported in Chinese CAIS patients and fully characterized by DNA sequencing. Further, ectopic testis increases the risk for
698 Jing He et al. Figure 1. Sequencing diagram of exons of the AR gene of different patients; a, b, c, d, e and f represents the sequencing of AR gene mutations for the cases 1 to 6, respectively. The mutation site is indicated by arrow. tumour by the long-term effect of the high body temperature in the abdominal cavity (Taplin et al. 1995). The incidence of testicular cancer is low before puberty, while it increases to 8% after puberty. In addition, the testosterone secretion shows adverse effects on the height growth and development of female secondary sexual syndrome. Thus,
Six cases of Chinese CAIS 699 Figure 2. Pathological examination of the gonadal tissues. (a) Images of case 3, the tissues are tested to be the testicular tissue with less spermatogenic cells and mesenchyme proliferation. (b) Images of case 4, the tissues are considered to be poorly differentiated epididymis tissues. (c) Images of case 5, the tissues are stunted testicular tissue with no clear malignant lesions. A small number of spermatogenic cells and fibrous tissue proliferation are observed with no mature sperm. (d) Images of case 6. There is no obvious special lesions. Small spermaduct, primordial germ cell and a small number of mesenchymal cells were observed. orchiectomy surgery is recommended for patients with AIS postpuberty. In our study, case 6 (12 years old) underwent gonadal resection and genital plastic surgery after genetic counselling. The appropriate treatment was expected to adjust the state of mind and reduce the risk of psychological problems of patients. Besides, the LH levels were higher than normal level in all cases except for case 6. The level of testosterone was normal for cases 1, 2, 4 and slightly increased in case 5. In addition, the level of testosterone was lower in cases 3 and 6, compared with normal level. The age of cases 3 and 6 was 17 and 12, respectively, which was younger than the others in the present study. Thus, we speculated that the hormonal level of CAIS patients might be related to age. Although the novel mutations of AR in four cases have been discovered in Chinese patients, lack of functional analysis is a limitation in our study. Besides, the mutation frequency in an unaffected male population has not been investigated in our work. Further studies focussing on the causal mutations are warranted in the near future. In conclusion, the CAIS was diagnosed based on the clinical examination and other molecular studies and four novel AR mutations were discovered in Chinese CAIS. Our findings of AR mutations pave the way to verify the mechanism of CAIS at molecular level and enrich the data for AR Gene Mutations Database. Acknowledgements The authors acknowledge the Medical Leading Scholar of Yunnan Province (L-201201) and the project of Medical Academic Leader of Yunnan Province (D-201643). References Ahmed S. F., Cheng A., Dovey L., Hawkins J. R., Martin H., Rowland J. et al. 2000 Phenotypic features, androgen receptor binding, and mutational analysis in 278 clinical cases reported as androgen insensitivity syndrome. J. Clin. Endocrinol. Metab. 85, 658 665. Cheikhelard A., Morel Y., Thibaud E., Lortat-Jacob S., Jaubert F., Polak M. et al. 2008 Long-term followup and comparison between genotype and phenotype in 29 cases of complete androgen insensitivity syndrome. J. Urol. 180, 1496 1501. ChuJ.,ZhangR.,ZhaoZ.,ZouW.,HanY.,QiQ.et al. 2002 Male fertility is compatible with an arg840cys substitution in the ar in a large chinese family affected with divergent phenotypes of ar insensitivity syndrome. J. Clin. Endocrinol. Metabol. 87, 347 351. Eisermann K., Wang D., Jing Y., Pascal L. E. and Wang Z. 2013 Androgen receptor gene mutation, rearrangement, polymorphism. Transl. Androl. Urol. 2, 137. Ferlin A., Vinanzi C., Garolla A., Selice R., Zuccarello D., Cazzadore C. et al. 2006 Male infertility and androgen receptor gene mutations: Clinical features and identification of seven novel mutations. Clin. Endocrinol. 65, 606 610.
700 Jing He et al. Galani A., Kitsiou-Tzeli S., Sofokleous C., Kanavakis E. and Kalpini-Mavrou A. 2008 Androgen insensitivity syndrome: Clinical features and molecular defects. Hormones (Athens) 7, 217 229. Gottlieb B., Beitel L. K., Nadarajah A., Paliouras M. and Trifiro M. 2012 The androgen receptor gene mutations database: 2012 update. Hum. Mutat. 33, 887 894. Hannema S. E., Scott I. S., Hodapp J., Martin H., Coleman N., Schwabe J. W. et al. 2004 Residual activity of mutant androgen receptors explains wolffian duct development in the complete androgen insensitivity syndrome. J. Clin. Endocrinol. Metab. 89, 5815 5822. Hoebeke P., Monstrey S., Cuypere G. D., Cools M. and T Sjoen G. 2011 Male gender identity in complete androgen insensitivity syndrome. Arch. Sex. Behav. 40, 635 638. Hughes I. A., Evans B. A., Ismail R. and Matthews J. 1986 Complete androgen insensitivity syndrome characterized by increased concentration of a normal androgen receptor in genital skin fibroblasts*. J. Clin. Endocrinol. Metabol. 63, 309 315. KoT.,YangY.,WuM.,KaoC.,HsuP.,ChuangS.et al. 1997 Complete androgen insensitivity syndrome. Molecular characterization in two chinese women. J. Reprod. Med. 42, 424 428. Ledig S., Jakubiczka S., Neulen J., Aulepp U., Burck-Lehmann U., Mohnike K. et al. 2005 Novel and recurrent mutations in patients with androgen insensitivity syndromes. Horm. Res. 63, 263 269. Melo K. F., Mendonca B. B., Billerbeck A. E., Costa E. M., Inacio M., Silva F. A. et al. 2003 Clinical, hormonal, behavioral, and genetic characteristics of androgen insensitivity syndrome in a brazilian cohort: Five novel mutations in the androgen receptor gene. J. Clin. Endocrinol. Metab. 88, 3241 3250. Morris J. M. 1953 The syndrome of testicular feminization in male pseudohermaphrodites. Am. J. Obstet. Gynecol. 65, 1192 1211. Quigley C. A., Evans B., Simental J. A., Marschke K. B., Sar M., Lubahn D. B. et al. 1992 Complete androgen insensitivity due to deletion of exon c of the androgen receptor gene highlights the functional importance of the second zinc finger of the androgen receptor in vivo. Mol. Endocrinol. 6, 1103 1112. Sack J. S., Kish K. F., Wang C., Attar R. M., Kiefer S. E., An Y. et al. 2001 Crystallographic structures of the ligandbinding domains of the androgen receptor and its t877a mutant complexed with the natural agonist dihydrotestosterone. Proc. Natl. Acad. Sci. USA 98, 4904 4909. Taplin M.-E., Bubley G. J., Shuster T. D., Frantz M. E., Spooner A. E., Ogata G. K. et al. 1995 Mutation of the androgenreceptor gene in metastatic androgen-independent prostate cancer. New Eng. J. Med. 332, 1393 1398. Zuccarello D., Ferlin A., Vinanzi C., Prana E., Garolla A., Callewaert L. et al. 2008 Detailed functional studies on androgen receptor mild mutations demonstrate their association with male infertility. Clin. Endocrinol. 68, 580 588. Corresponding editor: Rajiva Raman