Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.

Similar documents
Supplementary materials

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values

Understanding Blood Tests

Nature Neuroscience: doi: /nn Supplementary Figure 1. PICALM expression in brain capillary endothelium in human brain and in mouse brain.

SUPPLEMENTARY INFORMATION

Supplementary Figure 1 Binding of PAR1-RIP to (A) anionic liposomes consisting of phosphatidylserine and (B) zwitterionic liposomes composed of

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Delta Check Calculation Guide

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes

complemented with SipA ( SipA/pSipA) or SL1344 WT for 48 hours, after which the

Genotype analysis by Southern blots of nine independent recombinated ES cell clones by

Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions

Fig. S1. High K+ increases intracellular calcium level.

Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplementary Materials for

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected

Zhu et al, page 1. Supplementary Figures

VITROS MicroSlide Assay Summary

Supplementary Figure 1

Tables of Normal Values (As of February 2005)

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

Supplemental Table I

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs

Evaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr.

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled

Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE

Supplementary Figure 1

NORMAL LABORATORY VALUES FOR CHILDREN

EFFECT OF AN ALUMINUM SUPPLEMENT ON NUTRIENT DIGESTIBILITY AND MINERAL METABOLISM IN THOROUGHBRED HORSES

BIOCHEMICAL REPORT. Parameters Unit Finding Normal Value. Lipase U/L Amylase U/L

Nature Neuroscience: doi: /nn Supplementary Figure 1

ACCREDITATION DOCUMENT

Evaluation of new MiniCollect Z Serum (Separator) Tubes

1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University

Supplementary Figure 1

Serodos and Serodos plus

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

COMPANY OR UNIVERSITY

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Appendix

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

A. One to three months of age. Anterior Lens (Mean ± SEM) Posterior Lens (Mean ± SEM) Mid Lens (Mean ± SEM) Cornea (Mean ± SEM) Genotype

NEW RCPCH REFERENCE RANGES-

SUPPLEMENTARY INFORMATION

Supplementary Figure 1:

SUPPLEMENTARY INFORMATION

Supplementary Fig. 1: TBR2+ cells in different brain regions.

Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1

Supplementary Fig. 1

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Seeing is not Believing (13-Nov-2004)

What is PlaqueOff (PO)? A new study in Beagle dogs. Oral effects of

SUPPLEMENTARY INFORMATION

NNZ-2566 in Rett Syndrome and Autism Spectrum Disorders Role and Update

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min

LNA-mediated silencing of microrna-122 in African green monkeys

perk/erk STAT5B

Supplementary Materials for

Supplementary Figure 1 P53 is degraded following Chlamydia infection independent of the cell lysis and protein sample preparation procedure applied.

Analyte Specimen Demographic Reference Range Units

Learning Objectives. Disclosures. Self Assessment Questions. Background

Clinician Blood Panel Results

Excretion. Consumption = Growth + (Metabolism + SDA) + F(egestion) + U (excretion) Energetics Processes. Hormonal Control

Supplementary Figure 1

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

Color: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Rodent Behavioral Learning and Memory Models. From Mechanisms of Memory, 2 nd Edition by J. David Sweatt, Ph.D.

Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

SUPPLEMENTARY FIGURES

ROUTINE LAB STUDIES. Routine Clinic Lab Studies

1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

SUPPLEMENTARY INFORMATION

Test Result Reference Range Flag

10 Essential Blood Tests PART 1

Schwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis

Supplementary Information: Figures 1-6 and Table 1 RNAi-Mediated Gene Silencing in Non-Human Primate Zimmermann, T.S. et al.

ENROLLMENT CONFIRMATION

Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo.

Supplementary Materials for

Provided by MedicalStudentExams.com NORMAL LABORATORY VALUES

Supplementary Materials for

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC

Figures S1-S5, Figure Legends, Table S1 List of primers used in the study

SUPPLEMENTARY INFORMATION

Transcription:

ADCY1 13 kda β-actin 45 kda Supplementary Figure 1. Western blot of hippocampal lysates from and mice demonstrates the specificity of the ADCY1 antibody. a DHPG perk1/2 ERK1/2 Relative level min 1.6 * 1.2.8.4 neuron 5 min 1 min * 3 min b DHPG perk1/2 ERK1/2 Relative level 1.2 * *.8.4 neuron min 5 min 1 min 3 min Supplementary Figure 2. The mglur1/5-mediated intracellular signaling is intact in neurons. The level of phosphorylated ERK1/2 (perk1/2) and total ERK1/2 in hippocampal neurons (a) and hippocampal neurons (b) following the treatment with mglur1/5 agonist DHPG (1 µm) was determined by Western blot. Quantifications show the relative level of perk1/2 normalized to total ERK1/2 (n=6 per group). One-way ANOVA and LSD test was used to determine p-value, * indicates p<.5 between the min group and the indicated group, one-way ANOVA followed by LSD post hoc analysis. Data are presented as mean ± SEM. 1

a DKO b spines/ µm dendrite 1.5 * # DKO Supplementary Figure 3. Genetic deletion of Adcy1 in mice rescues higher spine density in visual cortex. (a) Golgi staining of dendritic spines on the apical dendrites of pyramidal neurons in the visual cortex of,,, and Fmr1/Adcy1 DKO mice (n = 4 for each genotype; length of the scale bar = 1 µm). (b) Quantification of total spine number. *: p <.5 between and indicated group, one-way ANOVA followed by LSD post hoc analysis. #: p <.5 between and the indicated group, one-way ANOVA followed by LSD post hoc analysis. Data are presented as mean ± SEM. 15 P<.5 Vmax 1 5 n=16 Fmr 1 n=17 Adcy1 n=15 DKO n=18 Supplementary Figure 4. Acoustic startle response in mice. Startle responses to 12 db auditory stimulation were determined in four different mouse strains as indicated. Comparing to the mice,,, and Fmr1/Adcy1 DKO animals showed higher responses. Data are presented as mean ± SEM. 2

% remaining 16 12 8 4 3 5 1 15 3 6 Time (min) Supplementary Figure 5. The level of NB1 at different time points during incubation with liver microsomes. a plasma concentration(ng/ml) 16 12 8 4.5 1 2 4 7 Time (hour) b brain concentration (ng/g) 4 3 2 1.5 1 2 4 7 Time (hour) Supplementary Figure 6. Absorption and distribution of NB1 in plasma and brain. Samples prepared from plasma or brain were subjected to LC/MS/MS with Turbo-Ionspray TM Interface in the positive ion-mode (Pharmacokinetics Core, University of Michigan). The concentration of NB1 in plasma (a) and brain (b) was determined at different time points following intraperitoneal injection. 3

Time in light chamber (s) 16 12 8 4 vehicle vehicle NB1 NB1 Supplementary Figure 7. Effect of NB1 on behavior in light/dark test. Time spent in the lit chamber during the light/dark test was recorded for and mice injected with vehicle (, n = 11;, n = 13) or 1 mg per kg NB1 (, n = 1;, n = 15). : not significant. Data are presented as mean ± SEM. 4

a Number of entries 1 5 vehicle rolipram 9 8 9 7 b Time in! light chamber (sec) 15 1 5 vehicle rolipram 9 8 9 7 Supplementary Figure 8. Effects of acute low dose rolipram on behavior in the light/dark test. and mice received i.p. injection of rolipram (.3 mg per kg) or vehicle. Thirty minutes after injection, mice were examined by light/dark test as described in Figure 4. Regardless of treatment, mice showed more transition between the lit and dark chamber than mice (genotype effect: F (1,29) = 8., p=.8) (a), and normal time in either lit or dark chamber (b). Rolipram does not cause significant behavioral changes in either or mice (treatment effect: F (1,29) =, p=1). : not significant. Data are presented as mean ± SEM. 5

3 Vehicle NB1 b Weight relative to brain Body weight (g) a 2 1 c Vehicle 4 7 Day NB1 1 15 Vehicle 4 NB1 3 2 1 Heart & lung Liver Kidney d NB1 Vehicle Supplementary Figure 9. There is no significant toxicity following two weeks of NB1 administration at high dose. NB1 (5 mg/kg) (n=5) or vehicle (n=3) was repeatedly administered twice per day for 14 days. (a) Body weight of mice at different days during the 2week NB1 administration. (b) Weight of heart and lung, liver, and kidney normalized to brain weight was recorded at the end of 2-week NB1 administration. (c, d) H&E staining and histology of liver (c) and kidney (d) tissues after 14 days of NB1 administration. : not significant. Data are presented as mean ± SEM. 6

Supplementary Figure 1. blots. blots for Fig. 1a blots for Fig. 1e DHPG neuron min 5 min 1 min 3 min blots for Fig. 1f DHPG neuron min 5 min 1 min 3 min ADCY1 13 kda ADCY1 13 kda ADCY1 13 kda β-actin 45 kda β-actin 45 kda β-actin 45 kda 7

blots for Fig. 2a DKO blots for Fig. 2b DKO blots for Fig. 2c DKO S6K 7 kda perk1/2 pakt 6 kda ERK1/2 ps6k 421 7 kda Akt 6 kda ps6k 389 7 kda blots for Fig. 3a DKO β-actin 45 kda 8

blots for Fig. 5b blots for Fig. 5b and 5d blots for Fig. 5d Akt 6 kda pakt 6 kda perk1/2 ERK1/2 Anti Akt and anti ERK1/2 added at the same time blots for Fig. 5c blots for Fig. 5c blots for Fig. 5c ps6k421 7 kda ps6k389 7 kda S6K 7 kda 9

blots for Supplementary Fig. 1 ADCY1 13 kda β-actin 45 kda blots for Supplementary Fig. 2a blots for Supplementary Fig. 2b DHPG neuron min 5 min 1 min 3 min DHPG neuron min 5 min 1 min 3 min perk1/2 perk1/2 ERK1/2 ERK1/2 1

Supplementary Table 1. Effects of acute low dose rolipram on audiogenic seizures Genotype and treatment N number % wild running % clonic/tonic seizure % death + vehicle 15 13.3 + vehicle 13 46.2 3.8 15.4 + rolipram 15 13.3 + rolipram 14 5 35.7 14.3 Audiogenic seizures were induced by 12 db auditory stimulation 3 min after rolipram (.3 mg per kg) or vehicle (1% kolliphore) injection. The percentage of different seizure-related phenotypes including wild running, clonic/tonic seizures, and death is shown. Chi-square test reveals significant genotype effect (p=.4 for wild running; p=.1 for clonic/tonic seizure; p=.3 for death) but no rolipram effect (p=.842 for wild running; p=.745 for clonic/tonic seizure; p=.936 for death). 11

Supplementary Table 2. Long-term effects of NB1 Control NB1 Urea Nitrogen (mg/dl) 21.67 ±1.33 24.5 ±.87 Sodium (mmol/l) 151.33 ±.33 15.5 ±1.5 Potassium (mmol/l) 4.77 ±.3 4.73 ±.22 Chloride (mmol/l) 18.33 ±.67 112.25 ±.85 Total CO2 (mmol/l) 13. ±.58 13.5 ±1.4 Anion Gap (mmol/l) 35. ±.58 29.5 ±2.36 Na/K Ratio 31.67 ±.33 32. ±1.47 Osmolarity (mos/l) 321. ±1. 321. ±4. Glucose (mg/dl) 183.5 ±15.5 216.5 ±8.5 Calcium (mg/dl) 8.6 ±. 8.83 ±.2 Phosphorus (mg/dl) 7.37 ±.18 6.5 ±.24 Magnesium (mg/dl) 3.33 ±.12 2.6 ±.11 Iron (ug/dl) 17. ±44. 115.5 ±4.5 Albumin (g/dl) 2.8 ±. 2.65 ±.13 ALT (U/L) 22.67 ±1.45 18.5 ±.96 AST (U/L) 4.33 ±1.86 32.5 ±1.55 ALP (U/L) 72. ±2.89 62.75 ±4.48 Amylase (U/L) 576.67 ±12.25 586.5 ±29.2 Chol (mg/dl) 95.67 ±4.81 1. ±5.96 Hemolysis Chem Normal Normal Lipemia Chem Normal Normal Icterus Chem Normal Normal Blood test results following 14 days of NB1 administration. Vehicle or NB1 at 5 mg per kg (n=5) was given twice per day for 14 days, after which blood samples were collected. ALT: alanine aminotransferase, AST: aspartate aminotransferase, ALP: alkaline phosphatase. Data are presented as mean ± SEM. 12