Supplemental Figure 1

Similar documents
Supplementary Table 1. List of primers used in this study

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY FIGURES

SUPPLEMENTARY INFORMATION

Supplementary Figures

Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.

Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Supplementary Figures

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Material

List of Available TMAs in the PRN

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells

Contents 1 The Windows of Susceptibility to Breast Cancer 2 The So Called Pre-Neoplastic Lesions and Carcinoma In Situ

SUPPLEMENTARY FIGURES AND TABLE

Supplementary Figures

In vitro DNase I foot printing. In vitro DNase I footprinting was performed as described

Supplemental Table S1

The antiparasitic drug ivermectin is a novel FXR ligand that regulates metabolism

Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation

HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment.

T H E J O U R N A L O F C E L L B I O L O G Y

Expanded View Figures

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Table. File Name: Peer Review File Description:

SFMC Breast Cancer Site Study: 2011

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

mock! A3AC106S! A3BE255Q! 86.7! 90.1! 88.0! 89.8! 89.0!

Supplementary Figure 1 IL-27 IL

Supplementary Figures

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

SUPPLEMENTARY INFORMATION

Supplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-

supplementary information

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

/06/$15.00/0 Molecular Endocrinology 20(9): Copyright 2006 by The Endocrine Society doi: /me

Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death

Right breast cancer with axillary node metastasis icd10

(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Supplementary Appendix

Influenza A virus hemagglutinin and neuraminidase act as novel motile machinery. Tatsuya Sakai, Shin I. Nishimura, Tadasuke Naito, and Mineki Saito

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11

Supplemental Material for. Figure S1. Identification of TetR responsive promoters in F. novicida and E. coli.

effects on organ development. a-f, Eye and wing discs with clones of ε j2b10 show no

Additional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript.

Supplementary Fig. S1. Schematic diagram of minigenome segments.

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

Supplementary Figure S1 Supplementary Figure S2

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the

Maram Abdaljaleel, MD Dermatopathologist and Neuropathologist University of Jordan, School of Medicine

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting

A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain

MBC Connect v0.9 (150) - Sat Sep :38:56 GMT+0000 (UTC)

Basement membrane in lobule.

Doctor of Philosophy

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

SUPPLEMENTARY INFORMATION

Expanded View Figures

BREAST CANCER d an BREAST SELF EXAM

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.

Health Disparities Advances in Breast Cancer Treatment. Jo Anne Zujewski April 27, 2009

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.

Supplemental Figure 1

Supplementary Figure 1

ACRIN 6666 Therapeutic Surgery Form

TITLE: The Role of hcdc4 as a Tumor Suppressor Gene in Genomic Instability Underlying Prostate Cancer

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

SUPPLEMENTARY FIGURES

2.5. AMPK activity

T H E J O U R N A L O F C E L L B I O L O G Y

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1

/05/$15.00/0 Molecular Endocrinology 19(5): Copyright 2005 by The Endocrine Society doi: /me

Probe. Hind III Q,!&#12?R'!! /0!!!!D1"?R'! vector. Homologous recombination

Supplementary Figure 1

Triple Negative Breast Cancer

Luciferase (Firefly and Renilla) Expression Stable Cell Lines

A712(18)- Test slide, Breast cancer tissues with corresponding normal tissues

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical

Supplementary Figures

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

WHI Extension Section 8 Outcomes Page 8-85

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Overview of AJCC 8 th Staging in Pathologic Aspects

Supplementary Information for. Inhibitors of Hedgehog Acyltransferase Block Sonic Hedgehog Signaling. Marilyn D. Resh 1,2,6*

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.

Transcription:

1 Supplemental Figure 1 Effects of DATE shortening on HGF promoter activity. The HGF promoter region (-1037 to +56) containing wild-type (30As) or truncated DATE (26As, 27As, 28A, 29As) from breast cancer cases was inserted into the upstream of the luciferase report gene in pgl2-basic vector (namely, phgf30a-luc, phgf26a-luc, phgf27a-luc, phgf28a-luc and phgf29a-luc). PGL2-basic (Basic-Luc) was used as a negative control vector. The above plasmids were verified by DNA sequencing of the entire insert and transiently transfected into HeLa cells. Luciferase activity in phgf30a-luc is significantly lower than those constructs with truncated DATE (30As vs. 26As, P1 < 0.01; 30As vs. 27As, P2 < 0.01; 30As vs. 28As, P3 < 0.05; 30As vs. 29As, P4 < 0.01, two tail paired t-test).

2 Supplemental Figure 2 Identification of C/EBP-β binding site in HGF promoter region. Biotin labeled synthetic oligo DNA (B-oligo) corresponding to the C/EBP-β site upstream of DATE (at -827) was used for DNA affinity purification assay to check C/EBP-β binding ability employing C/EBP-β antibody and western blot. Commercially available C/EBP-β oligos (C) were used as a positive control; 50X of unlabeled -827 oligo (C 827) and C/EBP-β oligo (CC) were used as competitors to show specific binding. N: no oligo added in the pull down reaction; MC: mutant C/EBP-β oligo; U: unrelated oligos; Arrows point to C/EBP-β (C/EBP-β1 and C/EBP-β2) bands binding to the site present at -827 in the HGF promoter and to C/EBP-β oligo.

3 Supplemental Figure 3 Representative Profile of Met protein expression in eight different breast cancer cases having various DATE length (genotype). Met expression was noted in all breast cancer tissues. A pattern of high Met expression (+++) was apparent in breast cancer tissues having the truncated DATE genotype (i.e. 30A:24A, 21A:21A and 29A:19A also see Supplemental Table 2) as opposed to those with wild type DATE which exhibited weak (+) to moderate (++) Met expression. Bar indicates 40 µm.

4 Supplemental Figure 4 Truncated DATEs are present in normal human breast tissues. Genotyping was done by PCR and the resulting 70 bp PCR products were analyzed on 15% denaturing polyacrylamide gel containing 8M urea. The arrows show truncated DATE. Cloned and sequenced 70 bp PCR products containing 14As, 26As, and 29As and were used as markers as indicated.

5 Supplemental Table 1 Patient demographics and genotype analysis of DATE in breast cancer and its corresponding adjacent normal tissues Length of DATE (As) Case# Type of tumor ER PR Size of tumors Age (yr) A Race Breast tumor Normal adjacent Lymph node invasion 1 Ductal carcinoma - - 2.5x2.5x2.5cm 43 AA 17 17-2 / / / / / / 26:17 26 / 3 Ductal carcinoma / / 3.0x2.8x2.6 cm 59 AA 30:18 30 + 4 Ductal carcinoma / / 3.5x3.5x2.8 cm 46 AA 19 19 + 5 Ductal carcinoma + + 1.5X0.8X0.5 cm 53 AA 22:19 22:19-6 Ductal carcinoma - - 8.0x5.5x4.7 cm 67 AA 29:19 29 + 7 Ductal carcinoma + + 1.5X1.5X1.0cm 42 AA 27:20 27:20 + 8 Ductal carcinoma / / 9.5x5.3x3.0 cm 55 CC 30:20 30:20-9 Ductal carcinoma / / 2.6X2.0X2.4 cm 38 AA 30:20 30:20 + 10 Ductal carcinoma + + 2.0x2.0x1.8 cm 51 AA 21 21 - Metaplastic 11 Ductal carcinoma - - 2.5X2.0X1.9cm 44 AA 30:22 30:22-12 Lobular carcinoma / / 2.2x3.5x1.8 cm 62 AA 23 23 + 13 Ductal carcinoma / / 2.0x1.7x1.5 cm 63 CC 30:23 30 + 14 Ductal carcinoma / / 28x24x6.5 cm 46 AA 30:23 30:23 / 15 Ductal carcinoma / / 2.8x2.0x2.0 cm 58 AA 24 24-16 Ductal carcinoma / / 4.0x2.0x3.0 cm 71 CC 24 24 + 17 / / / / 36 CC 24 24 / 18 Ductal carcinoma / / 6.0x5.0x4.0 cm 33 AA 24 24-19 Ductal carcinoma + + 1.7x1.7x1.7 cm 53 CC 30:24 30-20 Ductal carcinoma + + 1.9x1.8x1.6 cm 51 CC 30:24 30-21 Ductal carcinoma / / / 47 AA 30:24 30:24 / 22 Ductal carcinoma - - 1.7X1.7X1.5 cm 53 AA 30:24 30:24-23 Ductal carcinoma / / 2.5x2.2x2.0 cm 62 CC 25 25 + 24 Ductal carcinoma / / 3.5x2.5x4.0 cm 73 AA 25 25 + 25 Ductal carcinoma / / 10.5x6.5x3.5 cm 48 CC 25 25 + 26 Ductal carcinoma + - 9.5X6.5X2.5 cm 52 AA 25 25 + 27 Ductal carcinoma - - 5.0X5.0X3.0 cm / AA 25 25-28 Ductal carcinoma / / 2.0X1.0X1.0 cm 34 AA 25 25 + 29 Lobular carcinoma / / 3.0x2.4x1.5 cm 80 CC 26 26-30 Ductal carcinoma / / 1.8x1.5x1.0 cm 47 CC 26 26 - Poorly differentiated 31 Ductal carcinoma / / 2.5x2.3x2.0 cm 61 CC 26 26 -

6 Length of DATE (As) Case# Type of tumor ER PR Size of tumors Age (yr) A Race Breast tumor Normal adjacent Lymph node invasion 32 Ductal carcinoma / / 2.1X1.6X1.6 cm 46 AA 26 26 + 33 Ductal carcinoma + + 2.5x2.0x1.0 cm 90 CC 28:26 28 + 34 Ductal carcinoma / / 3.0x2.4x1.5 cm 50 AA 30:26 30:26 + 35 Ductal carcinoma + + 1.3X1.2X1.0cm 62 AA 30:26 30:26-36 Ductal carcinoma / / 2.5x2.0x1.8 cm 58 CC 27 27 + 37 Ductal carcinoma / / 2.5x2.5x2.2 cm 67 CC 27 27 - Metastatic 38 Ductal carcinoma - - 8.0x3.0x1.5 cm 55 CC 27 27 + 39 Ductal carcinoma / / 4.5x2.0x1.5 cm 59 CC 27 27 + 40 Ductal carcinoma + + 3.0x3.0x2.5 cm 50 CC 27 27 + 41 Ductal carcinoma / / 9.6x8.0x8.0 cm 54 CC 27 27 + 42 Ductal carcinoma / / 2.9x2.5x1.7 cm 42 CC 27 27 + 43 Ductal carcinoma / / 2.5X2.0X1.5 cm 47 AA 27 27 + 44 Ductal carcinoma / / 2.8x2.5x2.4 cm 40 CC 28 28 + 45 Ductal carcinoma / / 16.0x14.0 x3 cm 53 AA 28 28 / 46 Adenocarcinoma + + 2.3x1.5x0.8 cm 69 CC 28 28 + 47 Ductal carcinoma / / 1.5x1.0x1.0 cm 43 CC 28 28 + 48 Ductal carcinoma / / 3.0x2.8x1.4 cm 52 CC 28 28 + 49 Ductal carcinoma / / 4.7x2.5x2.0 cm 55 CC 28 28 + 50 Ductal carcinoma / / 10.0x6.5x4.5 cm 40 CC 28 28 + 51 Ductal carcinoma + + 2.0x2.0x2.0 cm 80 / 28 28 + 52 Ductal carcinoma / / 32.5x25x3.4 cm 37 CC 28 28 + 53 Ductal carcinoma - - 3.0x 3.0x2.5 cm 71 CC 28 29 + 54 Ductal/Lobular / / 3.1x3.8x2.2 cm 63 CC 28 28 + 55 Ductal carcinoma - - 3.5x3.2x3.0 cm 54 CC 28 29 + 56 Ductal carcinoma / / 4.7x4.0x3.2 cm 50 CC 28 29 + 57 Ductal carcinoma / / 4.0x3.0x3.5 cm 66 CC 29 29-58 Ductal carcinoma / / 2.5x1.8x1.4 cm 54 / 29 29 +

7 Length of DATE (As) Case# Type of tumor ER PR Size of tumors Age (yr) A Race Breast tumor Normal adjacent Lymph node invasion 59 Ductal carcinoma + + 4.5x3.5x3.0 cm 59 CC 29 29 + 60 Ductal carcinoma / / 5.0x5.5x4.0 cm 71 AS 29 29 + 61 Ductal carcinoma - - 13.0x11.0x7 cm 78 AA 29 29 + 62 Ductal carcinoma + + 2.2x2.0x1.6 cm 73 AA 29 29-63 Ductal carcinoma / / 0.8x0.8x0.7 cm 44 CC 29 30-64 Ductal carcinoma / / 3.0x2.5x1.0 cm 57 CC 29 30 + 65 Ductal carcinoma / / 2.5x1.5x1.0 cm 64 CC 29 30 + 66 Ductal carcinoma / / 2.0x1.5x1.0 cm 53 CC 30 30-67 Ductal carcinoma + - 2.2x1.5x1.3 cm 55 CC 30 30-68 Ductal carcinoma / / 2.5x2.0x1.5 cm 68 AS 30 30-69 Ductal carcinoma + + 4.5x2.5x2.0 cm 44 CC 30 30 + 70 Ductal carcinoma / / 2.7x2.3x2.5 cm 78 CC 31 30 + 71 Ductal carcinoma / / 2.2x2.0x1.5 cm 64 CC 30 30-72 Ductal carcinoma / / 1.7x1.7x1.0 cm 54 CC 30 30-73 Ductal carcinoma / / 1.8x1.8x1.5 cm 78 CC 30 30 / 74 Ductal carcinoma / / 2.5x1.7x2.0 cm 45 AA 30 30-75 Ductal carcinoma + + 2.8x1.2x1.5 cm 48 CC 30 30-76 Ductal carcinoma + + 3.0x3.0x2.7 cm 43 CC 30 30 + 77 Ductal carcinoma / / 6.0x4.0x3.0 cm 34 CC 30 30 + 78 Ductal carcinoma / / 2.7x2.3x2.5 cm 68 CC 30 30 + 79 Ductal carcinoma + + 11.0x6.0x2.0 cm 95 CC 30 30-80 Lobular carcinom / / 2.2x1.5x0.5 cm 78 CC 30 30-81 Ductal carcinoma / / 2.5x1.0x1.0 cm 70 CC 30 30 + 82 Ductal carcinoma / / 4.0x3.8x2.5 cm 78 CC 30 30 + 83 Ductal carcinoma / / 3.5x3.0x2.0 cm 42 CC 30 30 + 84 Ductal carcinoma - - 6.5x5.5x4.0 cm 81 CC 30 30-85 Ductal carcinoma / / 7.0x4.0x2.0 cm 59 CC 30 30 + 86 Ductal / Lobular - - 6.5x6.0x6.5 cm 33 AA 30 30 + 87 Ductal / Lobular + + 3.0x2.4x1.5 cm 53 AA 30 30 +

8 Length of DATE (As) Case# Type of tumor ER PR Size of tumors Age (yr) A Race Breast tumor Normal adjacent Lymph node invasion 88 Ductal carcinoma - - 18.0x15.0x11cm 53 AA 30 30-89 Ductal carcinoma + + 3.0x1.7x1.6 cm 43 AA 30 30 + 90 Ductal / Lobular + + 6.0x3.0x2.5 cm 73 AA 30 30 + 91 Ductal carcinoma - - 4.0x2.0x1.5 cm 57 AA 30 30-92 Ductal carcinoma + + 1.2x1.3x0.9 cm 53 AA 30 30-93 Ductal carcinoma + + 8x4.6x4.0 cm 68 AA 30 30-94 Ductal / Lobular + - 2.1x1.0x1.0 cm 53 AA 30 30 + 95 Ductal carcinoma / / 3.0x1.5x1.3 cm 37 AA 30 30 / A Race: CC: Caucasian; AA: African American; AS: Asia; /: Not available

9 Supplemental Table 2 Profile of HGF and Met protein expression in human breast cancer cases as determined by immunohistonchemistry Cases Type of tumors Age A Race Length of DATE (As) B HGF expression Met expression Tumor Adjacent Tumor Adjacent Tumor Adjacent 1 Ductal carcinoma 59 AA 30:18 30 +++ ++ +++ + 2 Ductal carcinoma 67 AA 29:19 29 +++ +++ +++ ++ 3 Ductal carcinoma 46 AA 19 19 +++ +++ +++ +++ 4 Ductal carcinoma 55 CC 30:20 30:20 +++ ++ ++ ++ 5 Ductal carcinoma 51 AA 21 21 +++ +++ +++ ++ 6 Ductal carcinoma 63 CC 30:23 30 +++ - ++ + 7 Ductal carcinoma 46 AA 30:23 30:23 +++ ++ + + 8 Ductal carcinoma 51 CC 30:24 30 ++ ++ +++ ++ 9 Ductal carcinoma 53 CC 30:24 30 ++ ++ + + 10 Ductal carcinoma 50 AA 30:26 30:26 +++ +++ ++ ++ 11 Ductal carcinoma 90 CC 28:26 28 + - + + 12 Lobular carcinoma 80 CC 26 26 ++ + ++ + 13 Ductal carcinoma 47 CC 26 26 + - ++ + 14 Ductal carcinoma 61 CC 26 26 + ++ + + 15 Ductal carcinoma 58 CC 27 27 - - + + 16 Ductal carcinoma 67 CC 27 27 ++ + +++ ++ 17 Ductal carcinoma 55 CC 27 27 + - ++ + 18 Ductal carcinoma 59 CC 27 27 ++ ++ ++ + 19 Ductal carcinoma 40 CC 28 28 + ++ + + 20 Ductal carcinoma 53 AA 28 28 + + + ++ 21 Adenocarcinoma 69 CC 28 28 + - ++ + 22 Ductal carcinoma 43 CC 28 28 + - + + 23 Ductal carcinoma 52 CC 28 28 + - + + 24 Ductal carcinoma 55 CC 28 28 ++ ++ ++ + 25 Ductal carcinoma 40 CC 28 28 ++ ++ + ++ 26 Ductal carcinoma 66 CC 29 29 + ++ + + 27 Ductal carcinoma 44 CC 29 30 +++ ++ ++ +++ 28 Ductal carcinoma 57 CC 29 29 + ++ ++ ++ 29 Ductal carcinoma 54 / 29 29 ++ ++ + ++ 30 Ductal carcinoma 64 CC 29 30 ++ + ++ + 31 Ductal carcinoma 59 CC 29 29 +++ +++ ++ + 32 Ductal carcinoma 53 CC 30 30 + + ++ + 33 Ductal carcinoma 55 CC 30 30 + + + + 34 Ductal carcinoma 68 AA 30 30 + - ++ + 35 Ductal carcinoma 44 CC 30 30 + + + + 36 Ductal carcinoma 78 CC 31 30 - - + ++ 37 Ductal carcinoma 64 CC 30 30 + + ++ + 38 Ductal carcinoma 54 CC 30 30 + + ++ ++ 39 Ductal carcinoma 78 CC 30 30 ++ ++ ++ + 40 Ductal carcinoma 45 AA 30 30 ++ ++ +++ ++ 41 Ductal carcinoma 43 CC 30 30 ++ ++ ++ ++ 42 Ductal carcinoma 42 CC 30 30 ++ ++ ++ ++ A Race: AA: African American; CC: Caucasian; /: Not available B HGF & Met expression: Intensity of HGF or Met immunoreactivity in tumors and adjacent tissues was assessed by employing an arbitrary score of "-" to "+++". "-" = no staining/negative. "+" = faint staining with 25% or less of cells positive. "++" = 50% of cells staining with moderate intensity. "+++" = intense staining in which at least 80% of cells positive for HGF or Met (Figure 8A; Figure 8C; Supplemental Figure 3).

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback