Northern Ireland Poultry Conference Graeme Dear General Manager Aviagen UK Ltd
The Broiler Industry A Strategy for Survival Pick the breed the market needs Grow them Keep them alive Produce the size the market wants Produce them at the lowest cost Sell them at the highest price
Thanks for listening
The Broiler Industry A Strategy for Survival But it does depend. Where you are, who you grow for, what you grow for, how you manage your birds and the birds you have to play with Survival in the context of the Broiler Industry and for a Primary Breeder can mean many things
This is what we do 2013 Genetic Improvement Aviagen Pedigree Selection 1 x 10 2014 2015 2016 2017 GGP Grandparent Stock Parent Stock Broilers Processing Retailers / Consumers 150 GGPs 7500 GPs 375,000 PS 50,000,000 Broilers 70,000 Tons of Meat
Your Survival is Our Survival We strive to make chickens grow faster To eat less feed To live well with fewer losses To deliver better meat yields In short we aim to produce more for less
A shared Strategy / a shared Survival Pick the breed the market needs Grow them Keep them alive Produce the size the market wants Produce them at the lowest cost Sell them at the highest price We strive to make things grow faster Eat less feed Live well Better yield In short we aim to produce more for less
Litter Quality Immune Challenge Housing Brooding Broiler Production is done in a wide range of Production Environments Gut Challenge Feed Quality Incubation
And Socio - Economic Environments
Successful business Feeding the world Food for the family A life s work (together) Kids education
Our job is to produce products that work in all of these situations and meet all of these needs Your job is to make it happen And if we both do our jobs we will both survive
Global Poultry 4-5% growth per annum Huge numbers of people want to eat chicken 9-10bn people by 2050 Rapid increase in wealth And there s no let up it s the cheapest meat protein
It s here 7 The growth is not here
Total: 457m PS World PS Market Volumes North America Europe 457,000,000*130= 78 mil PS Latin America 96 mil PS 68 mil PS broilers Middle East & Africa 82 mil PS 59,410,000,000 133 mil PS Asia, Australia & New Zealand
kg/person million people 14 13 Global Human Population vs Chicken Meat Consumption 522m PS (65m extra) 8,000 12 50,000,000*130= 95mt 7,000 83mt 6,000 11 6,510,000,000 5,000 10 9 8 7 1995 1996 1997 1998 1999 2000 2001 2002 Consumption 2003 2004 2005 2006 2007 11.7 kg/person broilers 457m PS Human Population 2008 2009 2010 2011 2012 2013 2014 2015 489 PS (32m more) 88.9mt 2016 2017 2018 2019 2020 4,000 3,000 2,000 1,000
So what???? And for sure, with 60m in UK, 4.5m in Eire, 740m in Europe and a bit of growth here and there your market is secure
Global Growth in Chicken Meat 120,000,000 100,000,000 80,000,000 60,000,000 Actual Global Chicken Meat Production Tonnes per annum Projection 30% in 10 Years 40,000,000 20,000,000 0 1990 1995 2000 2005 2010 2015 2020 2025 FAOSTAT FAO Statistics Division 2011
The label said: Product of Brazil or EU
All good so far no need for a Survival Strategy as yet But chicken doesn t just come from Ireland, or indeed Europe so we need to compete 33-65m more PS means another 6.5bn broilers per year in 5 years time 6.5bn broilers at 2 kg means 13m tonnes more broiler meat per annum 13m tonnes more broiler meat at 1.65 FCR means 21.5m tonnes more feed needed
16 M tons of grains used for Ethanol in 2000. By 2010, this rose to 126 M or 35% of the total grain production Source: Philip Wilkinson
Food is the new oil: The ability to grow food is fast becoming a new form of geological leverage and countries are scrambling to secure their own parochial interests at the expense of the common good Source: Philip Wilkinson
Compete to Survive Where does all that chicken food come from? How can it compete for food against oil? How can we compete in Ireland, the UK and Europe as a net importer of food when others are acquiring land for themselves? How can we survive?
Sustainability Sustainability criteria: Meet current needs without compromising future Triple Bottom Line (3 BL) principle People Planet Profit Consumer trust shared values principle Ethically Scientifically Economically viability
We re Doomed, aye we re a Doomed
A Strategy for Survival Produce more tonnes per sqm Faster throughput without compromising on health and welfare Better FCR Better survival Lower cost And that s where we come in.
Direction of Aviagen Breeding BREEDER LIVE BROILER PROCESSING Chicks Growth FCR Yield RAPID BALANCED PROGRESS Metabolic Fitness Skeletal Strength Welfare Traits SUPPORT Disease Resistance Liveability Pathogen Freedom
Progress Produce more tonnes per sqm 1972 1996 2012
Carcase and meat Better yield less days to weight 1972 1996 2012 2042
HHP INDEX Getting the Balance Right Eggs 20 15 Birds of interest 10 5 0-30 -20-10 0 10 20 30-5 -10 Weight -15-20 We select simultaneously for over 20 traits! -25-30 BWT INDEX
Genomics the Concept Information at the Phenotypic Level Predicting Genetic Merit Selection Candidate Pedigree Good Env Challenge Env Processing Good Accuracy Combining all sources of information Best Accuracy DNA GATGGCTCTTTGGAAGACGATGACTATCATGCC GATGGCTCTTTGGAAGATGATGACTATCATGC Information at the Gene Level
How does the process work Standard Pedigree pens 1 male and 10-12 females Pedigree group pens reconstructed pedigree The Lab
Weekly Contribution % Male contribution over time 40 35 30 25 Randy Rooster Progeny per Sire Patience is a virtue Sire 1 Sire 2 Sire 3 Sire 4 20 Sire 5 Sire 6 15 Sire 7 10 Sire 8 Sire 9 5 Sire 10 0 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 Hatch Note: Sires 5 and 10 dominated at the beginning of contribution, sire 5 died in week 17 While sire 10 lost in the hierarchy after becoming lame and losing condition Second half of the period shows more even contributions due to less dominant sires
No of Chicks 80 70 60 50 40 30 20 10 0 Wall Flower Female Mating Behaviour Looking for Mr Right y = 4.3165x Slappers + 4.0648 0 1 2 3 4 5 6 7 8 9 10 11 No of Males Mated Females which mate with more sires are more fertile & produce more chicks
Typical Selection Balance One Third : Broiler Performance Growth FCR FPD Uniformity Broiler Mortality Robustness One Third : Welfare Leg strength Yield Fertility Hatchability Liveability Egg production One Third : Breeder Fitness
But if I had to focus on one to Survive FCR Linked to growth Highest cost Greatest global competition Volatile cost Greatest sustainability impact Food is the new oil:
Life-Time FCR Group FCR using Transponder Technology Feed stations Maximise recording Incorporate aspects of feeding behaviour Covering 2 to 5 weeks - Early Growth efficiency - Detailed feeding behaviour - Group feeding behaviour
2800 2600 2400 2200 2000 1800 1600 Ross 308 : 35 day Weight & FCR 58 g per annum 2.800 2.600 2.400 2.200 2.000 1.800 1.600 1400 1.400 0.014 per annum 1200 1.200 Jan-06 Jan-07 Jan-08 Jan-09 Jan-10 Jan-11 Jan-12 Jan-13
The current/next generation Part of your Survival is how you use the genetic potential Biological Performance of Meat Type Chickens 1982 2012 2042 35 Day weight 1407 2472 3537 Growth per day (g) 40.2 70.6 101.1 Age at 2Kg 50 28 20 35 day FCR 2.348 1.475 1.038 35 day mortality 6.7 6.1 5.5
UK Market : Impact of FCR Effect of one years genetic progress UK tonnes 1,400,000 kilos meat 1,400,000,000 1000 kilos birds 2,000,000,000 0.70 yield % Broilers 909,090,909 2.2 weight Kg GPS 155,400 45 chicks PS 6,993,007 130 chicks Broilers / week 17,482,517 52 progress feed 3,560,000,000 1.780 fcr 0.025 cost 979,000,000 0.275 feed 3,510,000,000 1.755 fcr cost 965,250,000 0.275 Saving to UK 13,750,000 Assume Feed is all wheat Yield 8 Tonnes per hectare Save almost 6300 hectares We cannot afford not to improve FCR
Broilers Predicted Annual Progress Live weight (g) 40 to 50g FCR -0.02 to -0.03 Carcase Yield (%) 0.20 to 0.25 Breast Yield (%) 0.25 to 0.30 Our Joint Survival Pack
Greenhouse Gas Emissions Livestock EU cow milk 35 SR milk 79 hen eggs 23 beef 111 kg CO 2 per kg protein mutton 103 pork 36 chick en 26 OECD-FAO Agricultural Outlook 2011-2020. p143 http://dx.doi.org/10.1787/888932427132
Environmental Impact Life Cycle Assessment Impacts & resources used / t of carcass, / 20,000 eggs (~ 1 t) / 10m 3 milk GWP=Global Warming Potential; ARU = Scale related to scarcety of resources Williams et al, 2006. p4 Determining the environmental burdens and resouce use in the production of agricultural and horticultural commodities. DEFRA project report ISO 205
Together we can Survive Thanks for Listening