T H E J O U R N A L O F C E L L B I O L O G Y

Similar documents
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

SUPPLEMENTARY INFORMATION

Supplementary Figures

Supplementary Table 1. List of primers used in this study

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)

SUPPLEMENTARY INFORMATION

Figure S1. (A) Schematic diagram of dnrar transgene allele. (B) X-Gal staining of testis from

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons

SUPPLEMENTARY LEGENDS...

Expanded View Figures

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Loss of RhoA promotes skin tumor formation. Supplementary Figure 1. Loss of RhoA does not impair F-actin organization.

Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

SUPPLEMENTARY INFORMATION

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2

SUPPLEMENTARY FIGURES

SUPPLEMENTARY INFORMATION

Multiple Roles of Notch Signaling in the Regulation of Epidermal Development

Supplementary Figures

Supplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)

Supplementary Information Titles Journal: Nature Medicine

Supplementary Materials for

SUPPLEMENTARY INFORMATION

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

F-actin VWF Vinculin. F-actin. Vinculin VWF

Supplementary Figure 1:

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Materials for

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

Supplemental Table S1

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier

Supplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated

Supplementary Figures for

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

SUPPLEMENTARY INFORMATION

Zhu et al, page 1. Supplementary Figures

Supplementary Figures

mtorc1 loss impairs epidermal adhesion via TGF-β/Rho kinase activation

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

Supplementary Materials for

Supplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration

SUPPLEMENTARY FIGURES AND TABLE

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Genesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1.

Supplementary Figure 1

Supplementary Information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.

Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure S1. RANK expression on human lung cancer cells.

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

Supplementary Information and Figure legends

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.

Supplementary Figures

Genotype analysis by Southern blots of nine independent recombinated ES cell clones by

Supplementary Information

SUPPLEMENTARY INFORMATION

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

Supplementary Information

A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain

Supplementary Information

Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous

Supplementary Figure 1

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Infect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SAM library or vector. Introduce AKT reporter

(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,

SUPPLEMENTARY INFORMATION

Stem cells in endometriosis: pathogenetic factors and target for new medical treatments? Alberto Revelli MD PhD

Supplemental Figures:

Supplementary methods:

T H E J O U R N A L O F C E L L B I O L O G Y

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM.

Figure SⅠ: Expression of mir-155, mir-122 and mir-196a in allografts compared with

Transcription:

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Amelio et al., http://www.jcb.org/cgi/content/full/jcb.201203134/dc1 Figure S1. mir-24 regulates proliferation and by itself induces differentiation of primary keratinocytes. (A) In situ hybridization shows mir-24 in mouse and human epidermis. Dotted lines delineate the basal layer of the epidermis. Bars: (top and middle) 50 µm; (bottom) 20 µm. HE, hematoxylin and eosin; NG, negative control. (B) Dot plots show the reduction of BrdU-positive cell populations in mir-24 overexpressing keratinocytes. Boxes delineate the BrdUpositive cell population. Percentages indicate the value of BrdU-positive population in the related dot plot. (C) Pre-G1 peak quantification showed no effect on cell death after 48 and 72 h of transfection of pre mir-24. (D) Real-time qpcr shows mir-24 up-regulation during calcium-induced differentiation (diff) of human keratinocytes. (E) Real-time qpcr shows mir-24 overexpression in human keratinocytes after transfection of pre mir-24. (F) The adhesion assay reports no alteration in plating efficiency of mir-24 or anti mir-24 transfected keratinocytes. Micrographs of the adhesion assay are representative of three independent experiments. Bar, 500 µm. (G) Western blot analysis of epidermal differentiation markers K10 and involucrin in proliferating (Prolif.) or differentiation (Differ.) keratinocytes. MM, molecular mass; Scr, scramble; R.Q., relative quantification. Error bars show means ± SD. #, P > 0.05. mir-24 in epidermal differentiation Amelio et al. S1

Figure S2. mir-24 regulates proliferation and by itself induces differentiation in vivo. (A) Hematoxylin-eosin staining of skin sections of scramble- and antagomir-24 injected mice. (B) Dorsal skins of treated mice, from experiment shown in Fig. 2, do not present any abnormalities in epidermal granular layer markers loricrin or filaggrin (Filag.). (C) Ki67 immunofluorescence staining in dorsal skin of antagomir-24 treated mice. (D) Construct of Tg:K5::miR-24. Mouse pre mir-24 sequence was cloned under the control of bovine K5 promoter. (E) Genotyping PCR results in a 608-bp fragment in Tg-positive mice. Founders were generated and determined by genotyping PCR. (F and G) P3 mir-24 transgenic mice showed a significant reduction of body weight and subcutaneous (Sub-cut.) adipose tissue compared with the wt littermates; *, P < 0.0001. (H and I) TUNEL assay, performed on skin sections from P10 Tg mice, showed no differences in apoptotic cell populations. #, P > 0.05. (J) Hematoxylin-eosin staining of skin sections of P10 mir-24 transgenic mice. (K) K14 immunostaining and K14\K10 coimmunostaining of skin sections marks basal layer of mir-24 transgenic mice. Dotted lines in C and H delineate the basal layer of the epidermis. Scr, scramble. Error bars show means ± SD. Bars: (A and D) 50 µm; (B, C, and J [top]) 100 µm; (J [bottom] and K) 30 µm. S2

Figure S3. mrna down-regulation after mir-24 overexpression. (A) Venn diagram of genes down-regulated by mir-24 in human keratinocytes. mir-24 conserved and not conserved binding sites were predicted by TargetScan 5.1 software. (B) mir-24 microarray validation. To validate microarrays analysis, expression of seven genes, within the down-regulated gene list, were analyzed by real time qpcr. Error bars show means ± SD. (C) Predicted mir-24 target site on PAK4, Tks5, and ArhGAP19 3 UTRs were identified by TargetScan 5.1 software. Red letters indicate the seed sequence for mir-24 in 3 UTR of target mrnas. (D F) HEKn from the same condition of the experiment in Fig. 5 showed loss of planar polarity as highlighted by paxillin, vinculin, or actinin antibody staining. Bars, 10 µm. (G and H) Histograms show the relative percentage of distance (Dist.) covered by migration 24 h after scratch. Results are shown as means ± SD of four different measures from three independent experiments; *, P < 0.001. Scr, scramble; R.Q., relative quantification. mir-24 in epidermal differentiation Amelio et al. S3

Figure S4. Silencing of mir-24 and its targets (PAK4, Tsk5, and ArhGAP19) modulates actincytoskeleton. (A and B) Silencing of PAK4, Tsk5, and Arh- GAP19 results in loss of cell planar polarity as highlighted by actinin or vinculin antibody staining. Bars, 10 µm. (C) Silencing of PAK4, Tsk5, and Arh- GAP19 rescues the effect of mir-24 silencing, inducing formation of AJ in both low and high calcium condition. Bars, 20 µm. (D) Histograms show quantification of AJs from the experiment in C. *, P < 0.01. Error bars show means ± SD. Scr, scramble. S4

Figure S5. Silencing of Myc and E2F2 does not affect actin cytoskeleton. (A) Western blot analysis showed down-regulation of Myc and E2F2 by mir-24 overexpression (top) and confirm silencing of Myc and E2F2 (bottom) after 48 h of transfection. (B D) Silencing of Myc and E2F2 does not produce any alteration on actin filaments, planar polarization, and localization of E-cadherin (E-Cadh). Dotted boxes indicate the insets magnified on the right. Bars, 10 µm. (E and F) Specific silencing of Myc and E2F2 reduces human primary keratinocyte BrdU incorporation but does not produce any significant effect on epidermal differentiation markers (K10, K1, and involucrin [Invol.]). Results are shown as mean ± SD from three independent experiments. Scr, scramble; MM, molecular mass. mir-24 in epidermal differentiation Amelio et al. S5

Table S1 includes the list of genes down-regulated in mir-24 overexpressing keratinocytes that present mir-24 binding sites and is provided as an Excel file. Table S2 includes the results of Ingenuity Pathway Analysis analysis performed on genes down-regulated in mir-24 overexpressing keratinocytes to identify the most significant categories of biological functions and is provided as an Excel file. Table S3 shows the list of primers used for real-time qpcr and is provided as an Excel file. S6

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback