CYLD Negatively Regulates Transforming Growth Factor-β Signaling via Deubiquitinating Akt

Similar documents
RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-

Supplementary Figures

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min

Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity

Nature Medicine: doi: /nm.3922

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein

SUPPLEMENTAL FIGURE LEGENDS

Supplementary Information

Supplemental Information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

European Respiratory Society Annual Congress. Presented at: of new drugs for respiratory diseases. Barcelona, Spain, September 7-11, 2013 Page 1

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A)

E3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

Supplementary Figure 1

Atg5 flox/flox ; CAG-Cre, 19M brain heart lung. spleen stomach colon. Takamura_Fig. S1

Plasma exposure levels from individual mice 4 hours post IP administration at the

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death

Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)

Supplementary Information File

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Amniotic fluid stem cells provide considerable advantages in epidermal. regeneration: B7H4 creates a moderate inflammation

Supplementary Materials for

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation

Supplemental Material:

SUPPLEMENTARY FIGURES AND TABLE

TRPM8 in the negative regulation of TNFα expression during cold stress

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed

Peli1 negatively regulates T-cell activation and prevents autoimmunity

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

Supplementary Materials for

Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

Supplementary Figure 1: Co-localization of reconstituted L-PTC and dendritic cells

supplementary information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:

SUPPLEMENTARY INFORMATION

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Supplementary Material

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated

Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).

Research article. Department of Pharmacology and Toxicology, Medical College of Georgia, Georgia Health Sciences University, Augusta, Georgia, USA.

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1

Excessive fatty acid oxidation induces muscle atrophy in cancer cachexia

Supplementary data and figures Thyroid hormone inhibits murine lung fibrosis through improved epithelial mitochondrial function

SUPPLEMENTARY MATERIAL

Nature Immunology doi: /ni.3268

Supplementary Figures

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis

Supplementary Figures

Supplementary Information Titles Journal: Nature Medicine

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

Supplementary Figure 1.

Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

Foxm1 Transcription Factor is Required for Lung Fibrosis and Epithelial to Mesenchymal Transition.

Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.

Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.

Supplementary Figure 1. Procedures for p38 activity imaging in living cells. (a) Schematic model of the p38 activity reporter. The reporter consists

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas;

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle

supplementary information

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments:

Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION

293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected

SUPPLEMENTARY INFORMATION

Transcription:

Supplementary Information CYLD Negatively Regulates Transforming Growth Factor-β Signaling via Deubiquitinating Akt Jae Hyang Lim, Hirofumi Jono, Kensei Komatsu, Chang-Hoon Woo, Jiyun Lee, Masanori Miyata, Takashi Matsuno, Xiangbin Xu, Yuxian Huang, Wenhong Zhang, Soo Hyun Park, Yu-Il Kim, Yoo-Duk Choi, Huahao Shen, Kyung-Sun Heo, Haodong Xu, Patricia Bourne, Tomoaki Koga, Haidong Xu, Chen Yan, Binghe Wang, Lin-Feng Chen, Xin-Hua Feng and Jian-Dong Li 1

Supplementary Figure S1. CYLD prevents development of lung fibrosis independent of p38 MAPK following S. pneumoniae infection. (a) Relative quantity of mrna expression of connective tissue growth factor (CTGF), type I collagen (COL1A2), and type 1 plasminogen activator inhibitor (PAI-1) compared to Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was measured in the lung tissues of Cyld+/+ and Cyld-/- mice 2 weeks post S. pneumoniae infection (5 106 CFU/mouse). *p<0.05. Values are the means ± s.d. (n = 3). Un-paired Student s t-test was used for comparison with S. pneumoniae in Cyld+/+. (b) Cyld-/- mice were first i.t. inoculated with S. pneumoniae with vehicle control or p38 MAPK inhibitor (SB203580, 20 mg/kg body weight) for 2 weeks, and lung tissues were then collected from mice survived from lung injury and histopathological analysis was performed (n=5 for CON, 5 for SB203580, 20 for S. pneumoniae infection with vehicle control, and 15 for S. pneumoniae with SB203580). Scale bars correspond to 200 µm. (c) Wild-type (WT) mice were inoculated with S. pneumoniae for various times as indicated in the figure. Total- and phospho-p38 MAPK in the lung tissue protein was 2

measured using total and phospho-p38 ELISA kit (Invitrogen), and TGF-β concentration was measured in blood using mouse TGF-β ELISA kit (R&D Systems). *p<0.05 compared to control, **p<0.001 compared to control. Values are the means ± s.d. (n = 5). Un-paired Student s t-test was used for comparison with 0 hour Control. 3

Supplementary Figure S2. Expression of CYLD is lower in fibrotic lung tissue. (a) Lung fibrosis tissues were obtained from the patients with pulmonary fibrosis during pneumonectomy, and control tissues were obtained from the patient with pneumothorax during the surgery. Lung tissue sections were stained with H&E, Masson s trichrome (Trichrome), anti-cyld, and anti-smad3. Slides are representative of 5 (CON) and 10 (Fibrotic Lung) human lung tissues. Scale bars correspond to 200 µm. (b) WT mice were i.t. inoculated with TGF-β (50 ng or 100ng), and relative quantity CYLD mrna expression was measured in the lung tissues of mice. Values are the means ± s.d. (n=3). 4

Supplementary Figure S3. CYLD-deficiency enhances Bleomycin-induced lung fibrosis. Cyld+/+ and Cyld-/- mice were i.t. inoculated with bleomycin (3 Units/kg body weight) for 2 weeks, and lung tissues were collected from mice survived from lung injury and subjected to histopathological analysis (H&E stain and Trichrome stain) (n=5 for CON in Cyld+/+ and Cyld-/- mice, 40 in bleomycin in Cyld+/+ mice, and 35 in bleomycin in Cyld-/- mice). Scale bars correspond to 200 µm. 5

Supplementary Figure S4. sichip reduces CHIP mrna expression. Relative quantity of mrna expression of CHIP compared to GAPDH was measured in A549 cells transfected with sicon or sichip. Values are the means ± s.d. (n = 3). 6

Supplementary Figure S5. CYLD interacts with Akt but not with CHIP or GSK3β. Cells were co-transfected with Flag-CYLD, Myc-CHIP, HA-GSK3β, or Flag-Akt, and CYLD was pulled down with anti-cyld antibody. Interacting proteins were analyzed by immunoblotting with the indicated antibodies. 7

Supplementary Figure S6. Akt mediates CYLD-mediated negative regulation of TGFβ signaling. (a) MEF cell extracts from Cyld +/+ and Cyld -/- mice were analyzed by immunoblotting with the indicated antibodies. (b) CYLD was reduced with sicyld in MEF cells from Akt1 +/+ and Akt1 -/- mice, and relative quantity of mrna expressions of PAI-1 compared to GAPDH was measured following TGF-β treatment. Values are the means ± s.d. (n = 3). 8

Supplementary Figure S7. Akt induces fibrotic responses via Smad3. MEF cells from Smad3 +/+ and Smad3 -/- mice were transfected with C/A-Akt, and relative quantity of PAI- 1 and CTGF mrna expression compared to GAPDH was measured by real-time Q-PCR analysis. Values are the means ± s.d. (n = 3). 9

Supplementary Figure S8. S. pneumoniae induces endogenous Akt ubiquitination, and CYLD deubiquitinates it. MEF cells from Cyld +/+ and Cyld -/- mice were treated with S. pneumoniae, and Akt in cell lysate was pulled down with anti-akt antibody, and immunoblotted against Ub, CYLD, and Akt. 10

Supplementary Figure S9. CYLD inhibits TGF-β signaling independent of TRAF6. TGF-β-induced SBE-Luc activity was measured in TRAF6-depleted using sitraf6 with or without sicyld. Human sirna for TRAF6 was from Dharmacon, and knockdown of TRAF6 using sitraf6 was performed with Lipofectamine 2000 (Invitrogen). ON- TARGETplus SMARTpool of sirna targeting human TRAF6 consists of four sirnas and sequences for the sirnas are as follows: 5 -GGAGACAGGUUUCUUGUGA-3, 5 - GAUAUGAUGUAGAGUUUGA-3, 5 -GGCCAUAGGUUCUGCAAAG-3, 5 - GCGCUUGCACCUUCAGUUA-3. *p<0.001. Values are the means ± s.d. (n = 3). Statistical data analysis was performed using Student s t-test. 11