Primary Cilia Can Both Mediate and Suppress Hedgehog Pathway- Dependent Tumorigenesis (Supplementary Figures and Materials) Sunny Y. Wong, Allen D. Seol, Po-Lin So, Alexandre N. Ermilov, Christopher K. Bichakjian, Ervin H. Epstein Jr., Andrzej A. Dlugosz, Jeremy F. Reiter Supplementary Fig. 1a Rootletin Rootletin Detyrosinated tubulin Detyrosinated tubulin Supplementary Fig. 1b Rootletin Supplementary Figure 1. (a) Additional images of human BCCs that either contain numerous ciliated cells (left two panels) or lack clearly ciliated cells (right two panels), as assessed by staining for acetylated tubulin or detyrosinated tubulin. Scale bars, 50 µm. (b) Magnified views of the boxed areas in (a). Note that while cells in the left panel exhibit typical ciliary extensions (green) from the ciliary rootlet (red), cells in the right panel do not display these extensions. Scale bars, 10 µm.
Supplementary Fig. 2 Hair follicle Sebaceous glands Epidermis Supplementary Fig. 3 Supplementary Figure 2. Ker14-Cre ERT recombinase activity following administration of tamoxifen was determined using the R26R reporter strain, which expresses β-galactosidase upon removal of an upstream polyadenylation sequence. Ker14-Cre ERT ; R26R mice were injected with tamoxifen similarly to the tumor experiments. Dorsal skin biopsies were collected three days after the final injection and assayed for β- galactosidase activity (blue). Ker14-Cre ERT recombinase activity is detectable in ~20% of cells in the skin, including cells in the follicular and interfollicular epithelium, as well as in sebaceous glands. All scale bars, 50 µm. Supplementary Figure 3. SmoM2-induced skin lesions exhibit histological characteristics of human BCCs, including palisades at the periphery (dotted line). Scale bar, 50 µm.
Supplementary Fig. 4 P = 0.048 Percentage of cells with cilia Total number of cells Total number of centrosomes Total number of cilia Percentage of cells Percentage of centrosomes Type counted counted counted with cilia with ciliary extension 2411 678 272 11.3 40.1 2373 646 206 8.7 31.9 Supplementary Figure 4. Deletion of Kif3a (Ker14-Cre ERT ; ) reduces the number of ciliated cells in the follicular epithelium, relative to controls (Ker14-Cre ERT ; ). Cilia (arrows) that were labeled with detyrosinated tubulin staining along the length of the axoneme and γ-tubulin staining at the base were scored as positive (top right panel; dotted line, perimeter of hair follicle cross-section). Skin biopsies were obtained five weeks after treatment with tamoxifen. In the graph, each point represents data from a single follicular crosssection, as shown in the example (right). Forty follicular cross-sections from five animals were counted for each genotype. Consistent with the recombination frequency observed for K14-Cre ERT (Supplementary Fig. 2), approximately 20% fewer ciliated cells are detected in skin sections, relative to sections from animals (P = 0.048). Scale bar, 50 µm.
Supplementary Fig. 5 Ker14-Cre ERT ; Ker14-Cre ERT ; SmoM2 cond ; Ker14-Cre ERT ; SmoM2 cond ; Ker14-Cre ERT ; Ker14-Cre ERT ; SmoM2 cond ; Ker14-Cre ERT ; SmoM2 cond ; Supplementary Figure 5. SmoM2 expression causes tail skin hyperplasia, as seen grossly and in H&E sections. Deletion of Kif3a prevents SmoM2-induced hyperplasia. The images shown are from animals 20 weeks after tamoxifen administration. Scale bars, 50 µm.
Supplementary Fig. 6 Ker14-Cre ERT ; Ker14-Cre ERT ; Ker14-Cre ERT ; SmoM2 cond ; Average ear thickness (µm) Ker14-Cre ERT ; SmoM2 cond ; 5 weeks after TAM 10 weeks after TAM 20 weeks after TAM Supplementary Figure 6. Quantitation of ear thickness for normal and tumorigenic mice, 5, 10 and 20 weeks post tamoxifen treatment (* P < 0.05, ** P < 0.001).
Supplementary Fig. 7 Overlay Ker14-Cre ERT ; CLEG2 cond ; Overlay Ker14-Cre ERT ; CLEG2 cond ; Supplementary Figure 7. + tumor lesions that arose in Ker14-Cre ERT ; CLEG2 cond ; animals lack cilia (dotted line, dermal-epidermal border). Scale bars, 50 µm.
Supplementary Fig. 8 Ker14-Cre ERT ; CLEG2 cond keratinocytes Untreated Treated with 4-OHT Supplementary Figure 8. Treatment of cultured Ker14-Cre ERT ; CLEG2 cond keratinocytes with 4-OHT induces expression of a -tagged, constitutively active GLI2 (GLI2ΔN) in ~60% of cells. Scale bars, 50 µm.
Supplementary Fig. 9 4-OHT Ker14-Cre ERT ; CLEG2 cond ; Ker14-Cre ERT ; CLEG2 cond ; + + Molecular weight (kda) 250 160 250 160 (Human GLI2ΔN) Gli2 (Endogenous) Supplementary Fig. 10 Ker14-Cre ERT ; CLEG2 cond Fold induction over uninduced control Axin2 c- Cyclin D Follistatin Supplementary Figure 9. Endogenous Gli2 can be distinguished from -tagged, N-terminal-truncated human GLI2ΔN by Western blot. 4-OHT treatment causes upregulation of GLI2ΔN in both and cells, as detected by an antibody to. An antibody against endogenous Gli2 detects a higher molecular weight band that is upregulated specifically in 4-OHT-treated Ker14-Cre ERT ; CLEG2 cond ; cells, confirming the results from Fig. 3i using an independently-derived series of primary keratinocytes. Supplementary Figure 10. Quantitation of Wnt target gene expression in Ker14-Cre ERT ; CLEG2 cond ; (dark gray) or Ker14-Cre ERT ; CLEG2 cond ; (light gray) keratinocytes following induction with 4-OHT, expressed relative to vehicle-treated control cells (normalized to a baseline value of 1, dotted line).
Primary Cilia Can Both Mediate and Suppress Hedgehog Pathway-Dependent Tumorigenesis Sunny Y. Wong, Allen D. Seol, Po-Lin So, Alexandre N. Ermilov, Christopher K. Bichakjian, Ervin H. Epstein Jr., Andrzej A. Dlugosz, Jeremy F. Reiter Supplementary Methods Quantitative RT-PCR Primers (5 to 3 ) β-actin Forward: β-actin Reverse: Gli1 Forward: Gli1 Reverse: Gli2 Forward: Gli2 Reverse: human GLI2 Forward: human GLI2 Reverse: Ptch1 Forward: Ptch1 Reverse: Bcl2 Forward: Bcl2 Reverse: N-myc Forward: N-myc Reverse: Axin2 Forward: Axin2 Reverse: c- Forward: c- Reverse: Cyclin D Forward: Cyclin D Reverse: Follistatin Forward: Follistatin Reverse: CACAGCTTCTTTGCAGCTCCTT CGTCATCCATGGCGAACTG GGTGCTGCCTATAGCCAGTGTCCTC GTGCCAATCCGGTGGAGTCAGACCC GTGCACAGCAGCCCCACACTCTC (seq. absent in human GLI2ΔN-CLEG2) GGTAATAGTCTGAAGGGTTGGTGCCTGG (seq. absent in human GLI2ΔN-CLEG2) GCAGAGCCATCACCTGGCAGC (for detection of CLEG2 allele) GGCCAAAGCCTGCTGTAGCCAC (for detection of CLEG2 allele) CTCTGGAGCAGATTTCCAAGG TGCCGCAGTTCTTTTGAATG CCACCCCTGGCATCTTCTCCTTCC CGCAGGCCCAGCGGTGGCAAC CTGCCTACCGACCTCTCCCAC CCGCAGCGCTGGTCGCCGGGG CTCCCCACCTTGAATGAAGA ACTGGGTCGCTTCTCTTGAA CAACGTCTTGGAACGTCAGA TCGTCTGCTTGAATGGACAG CCAAGTTCCCTAGCAAGCTG CTTTCATGTCACAGGGCAGA ACGTGTGAGAACGTGGACTG CATTCGTTGCGGTAGGTTTT 1