ab FirePlex mirna Panel Kidney Toxicity

Similar documents
ab Oil Red O (Lipid Stain)

ab Hemoglobin Assay Kit (Colorimetric)

ab Luxol Fast Blue Stain (Myelin Stain)

ab Tonsillitis tissue array 114 cases 228 samples (1.1mm)

ab Amyloid beta peptide (1-42) (human)

ab Lung cancer tissue array paired with normal tissues, 16 cases, 48 samples (2mm), set 2

ab Cervical cancer tissue array paired with normal tissue, 16 cases, 48 samples, (2mm).

ab Endometrial cancer tissue array of 102 cases (1.5mm)

Nasopharyngeal primary and metastatic carcinoma tissue array, 96 samples (1.5mm), set 1

Gastrointestinal stromal tumor (GIST) tissue array, 24 cases, 48 samples (2mm)

ab Ovary cancer tissue array of 102 cases (1.5mm)

ab Lung cancer tissue array, 75 cases, 150 samples (1.1mm), set 1

ab Endometrial cancer tissue array, 75 cases, 150 samples (1.1mm), set 1

ab Pancreatic cancer tissue array, 24 cases, 48 samples (2mm)

ab Thyroid cancer tissue array, 75 cases, 150 samples (1.1mm), set 1

ab Cervical cancer tissue array with progressive changes, 48 cases, 96 samples (1.5mm), set 2

ab Nervous system glioma tissue array, 48 cases, 96 samples (1.5mm)

ab Exosome Isolation and Analysis Kit - Flow Cytometry, Cell culture

ab Colon cancer tissue array with progressive changes, 48 cases, 96 samples (1.5mm), set 1

ab Prostate cancer tissue array, 24 cases, 48 samples (1.5mm)

ab Mammalian Cell Lysis Buffer 5X

ab Kidney cancer tissue array of 102 cases (1.5mm)

ab Exosome Isolation and Analysis Kit - Flow Cytometry, Plasma

ab Exosome Isolation and Analysis Kit - Flow Cytometry, Cell Culture (CD63 / CD81)

Testis/ovary germ cell tumor tissue array, 48 cases, 96 samples

ab Colon cancer tissue array of 228 cases (1.1mm)

ab Stomach cancer tissue array of 228 cases (1.1mm)

ab Breast cancer tissue array with progressive changes, 48 cases, 96 samples (1.5mm), set 2

PEG Virus Precipitation Kit

ab Homocysteine Assay Kit (Fluorometric) 1

ab Cell Invasion Assay (Basement Membrane), 24-well, 8 µm

ab Red Blood Cell (RBC) Lysis Buffer

ab Melanoma (primary and metastatic) tissue array, 48 cases, 96 samples (1.5mm)

ab Lung cancer tissue array with progressive changes, 48 cases, 96 samples (1.5mm), set 2

ab Head and neck tumor tissue array, 102 cases (1.5mm)

ab Nuclear Extract Kit

Breast cancer tissue array with progressive changes, 48 cases, 96 samples (1.5mm), set 1

ab ORAC Assay Kit

ab Nervous system tumor tissue array, 48 cases, 96 samples (1.5mm)

ab Lymphoma tissue array of 102 cases (1.5mm) set 2

ab HRV 3C Protease Inhibitor Screening Kit (Colorimetric)

Ab T cell lymphoma tissue array, 75 cases, 150 samples (1.1mm), set 3

ab HIV-1 Protease Inhibitor Screening Kit (Fluorometric)

ab Lipid Peroxidation (MDA) Assay kit (Colorimetric/ Fluorometric)

ab Nervous system tumor tissue array, 102 cases (1.5mm)

Multi-normal human tissues, FDA, 96 samples, 35 organs/sites from three individuals (1.5mm)

ab Lymphoma tissue array of 102 cases (1.5mm) set 1

Annexin V-FITC Apoptosis Detection Kit

ab Lipid Extraction Kit (Chloroform-Free)

ab65336 Triglyceride Quantification Assay Kit (Colorimetric/ Fluorometric)

ab Glucose Uptake Assay Kit (colorimetric) 1

Plant tissue extraction kit. For extraction of soluble protein and other biomolecules and metabolites from plant tissues.

ab Head and neck tumor tissue array, 48 cases, 96 samples (1.5mm), set 1

L-Amino Acid Assay Kit

ab Soft tissue tumor tissue array, 48 cases, 96 samples (1.5mm), set 1

Glucose Detection Kit

CytoPainter LysoGreen Indicator Reagent

ab Pyruvate dehydrogenase (PDH) Enzyme Activity Dipstick Assay Kit

For the accurate measurement of glucose in cells and tissues, plasma, serum and other body fluids, growth media and food.

ab Skin tumor tissue array, 75 cases, 150 samples (1.1mm)

For the isolation of mitochondria from P. pastoris and other species of yeast

For the accurate measurement of glycogen levels in various biological samples.

ab HRV 3C Protease Activity Assay Kit (Colorimetric)

For the rapid, sensitive and accurate measurement of Aspartate aminotransferase activity in various samples

ab HIV-1 Protease Activity Assay Kit

ab Glycated Protein Detection Kit

Glucose 6 Phosphate Dehydrogenase Assay Kit (Fluorometric)

ab HMG-CoA Reductase Activity Assay Kit (Colorimetric)

Ascorbic Acid Assay Kit

ab Cathepsin K Inhibitor Screening Kit (Fluorometric)

Lipase Detection Kit III (Fluorometric)

ab Tryptophan Assay Kit (Fluorometric)

Free Fatty Acid Uptake Assay Kit (Fluorometric)

ab Hemoglobin Human ELISA Kit

ab Dipeptidyl peptidase IV (DPP4) Inhibitor Screening Assay Kit

D-Mannitol Colorimetric Assay Kit

Phenylalanine Assay Kit

For the rapid, sensitive and accurate measurement of Glycerol in cell cultures.

ab Factor Xa Activity Assay Kit (Fluorometric)

Glucose 6 Phosphate Assay Kit (Colorimetric)

Aconitase Enzyme Activity Microplate Assay Kit

6-Phosphofructokinase Activity Assay Kit (Colorimetric)

Acetoacetate Assay Kit (Colorimetric)

ab Insulin Human ELISA Kit

ab Ascorbic Acid Assay Kit (Fluorometric)

Glucose-6-phosphate Isomerase Activity Assay Kit (Colorimetric)

ab Membrane fluidity kit Instructions for Use For the detection of membrane fluidity in cells

ab Histone Deacetylase (HDAC) Activity Assay Kit (Fluorometric)

ab Fatty Acid Oxidation Assay

ab E3 Ligase Auto- Ubiquitilylation Assay Kit

ab Lipase Activity Assay Kit (Colorimetric)

Transcription:

Version 1 Last updated 30 May 2017 ab219508 FirePlex mirna Panel Kidney Toxicity This product is for research use only and is not intended for diagnostic use. Copyright 2017 Abcam. All rights reserved. FirePlex

Table of Contents 1. Overview 2 2. FirePlex mirna Panel Kidney Toxicity 3 3. Notes 7 ab219508 mirna Panel Kidney Toxicity 1

1. Overview The FirePlex Kidney toxicity panel has been designed to profile expression of 65 mirnas () that have been demonstrated in multiple peer-reviewed studies to be differentially regulated as a part of kidney toxicity or acute kidney injury. Our multiplex mirna assays use our FirePlex particle technology to profile up to 65 mirnas per well. With the same sensitivity as PCR, they can be used either directly with 10 µl of biofluids such as serum or plasma with no need for RNA purification; or with 100 pg of purified RNA. For a full list of validated sample types, and to learn more about the performance and requirements of these assays, visit http://www.abcam.com/nav/multiplex-mirna-assays. These mirnas have been chosen based on a detailed study of data in peer-reviewed journals and exhibit differential regulation in plasma, serum, urine, isolated exosomes or total RNA from kidney or kidney-derived cell lines. Included in the panel are general markers for multiple kidneyrelated diseases, markers specific to specific kidney states or treatment responses, markers that may indicate hemolysis contamination in isolated plasma/serum/exosomes and internal controls are included to validate assay performance. It is important to use the normalization procedure in the FirePlex Analysis Workbench Software to identify the mirnas that can optimally be used for normalization with your samples. Three mirnas that are likely to be stably expressed in biofluid samples and may be suitable have been included in this panel. ab219508 mirna Panel Kidney Toxicity 2

2. FirePlex mirna Panel Kidney Toxicity To use this product researchers must also purchase the appropriate Core Reagent Kit, either ab218365 for use with purified RNA or ab218342 for use with biofluids (see these kits for the full assay protocol). FirePlex is a registered trade mark in the United States and is an unregistered trade mark elsewhere. This product is currently only supported for customers in North America and Europe, if you are outside these areas please contact us. ** Hsa = Homo sapiens (human), Mmu = Mus musculus (mouse), Rno = Rattus norvegicus (rat), Ath = Arabidopsis thaliana (arabidposis), Oan = Ornithorhynchus anatinus (platypus), Cel = Caenorhabditis elegans (worm). # mirna 21 name mirna Sequence (mirbase V21) 1 hsa-let-7c-5p UGAGGUAGUAGGGUAUGG 2 hsa-let-7e-5p UGAGGUAGGAGGGUAUAG 3 hsa-let-7g-5p UGAGGUAGUAGUGUACAG 4 hsa-mir-100-5p AACCCGUAGAUCCGAACG UG 5 hsa-mir-10a-5p UACCCUGUAGAUCCGAAU GUG 6 hsa-mir-122-5p UGGAGUGUGACAAUGGUG UG 7 hsa-mir-125b-5p UCCCUGAGACCCUAACGU GA 8 hsa-mir-126-3p UCGUACCGUGAGUAAUAAUG CG 9 hsa-mir-130a-3p CAGUGCAAUGAAAAGGGC AU 10 hsa-mir-130b-3p CAGUGCAAUGAUGAAAGGG CAU 11 hsa-mir-132-3p UAACAGUCUACAGCCAUGGU CG Sequence homology ** MIMAT ID MIMAT0000064 MIMAT0000066 MIMAT0000414 MIMAT0000098 MIMAT0000253 MIMAT0000421 MIMAT0000423 MIMAT0000445 MIMAT0000425 MIMAT0000691 MIMAT0000426 12 hsa-mir-134-5p UGUGACUGGGACCAGAG MIMAT0000447 ab219508 mirna Panel Kidney Toxicity 3

GGG 13 hsa-mir-138-5p 14 hsa-mir-140-3p 15 hsa-mir-142-3p 16 hsa-mir-143-3p 17 hsa-mir-145-5p 18 hsa-mir-146a-5p 19 hsa-mir-146b-5p 20 mmu-mir-155-5p 21 hsa-mir-15a-5p 22 hsa-mir-15b-5p 23 hsa-mir-16-5p 24 hsa-mir-17-5p 25 hsa-mir-181a-5p 26 mmu-mir-182-5p 27 rno-mir-183-5p 28 hsa-mir-186-5p 29 hsa-mir-18a-5p 30 hsa-mir-191-5p 31 hsa-mir-192-5p 32 hsa-mir-194-5p 33 hsa-mir-19a-3p 34 hsa-mir-200a-3p 35 hsa-mir-200c-3p 36 hsa-mir-203a-3p 37 hsa-mir-206 AGCUGGUGGUGAAUCAG GCCG UACCACAGGGUAGAACCAC GG UGUAGUGUCCUACUAUG GA UGAGAUGAAGCACUGUAGCU C GUCCAGCCCAGGAAUC CCU UGAGAACUGAACCAUGGG UGAGAACUGAACCAUAGG CU AAUGCUAAGUGAUAGG GGU UAGCAGCACAUAAUGGUG UG UAGCAGCACAUCAUGGUA CA UAGCAGCACGUAAAUAGG CG CAAAGUGCACAGUGCAG GUAG AACACAACGCUGUCGGUG AGU UGGCAAUGGUAGAACUCA CACCG UAUGGCACUGGUAGAACA CU CAAAGAACUCCGGG CU UAAGGUGCAUCUAGUGCAGA UAG CAACGGAAUCCCAAAAGCA GCUG CUGACCUAUGAAGACAGC C UGUAACAGCAACUCCAUGUG GA UGUGCAAAUCUAUGCAAAAC UGA UAACACUGUCUGGUAACGAU GU UAAUACUGCCGGGUAAUGAU GGA GUGAAAUGUAGGACCACU AG UGGAAUGUAAGGAAGUGUGU GG MIMAT0000430 MIMAT0004597 MIMAT0000434 MIMAT0000435 MIMAT0000437 MIMAT0000449 MIMAT0002809 MIMAT0000165 MIMAT0000068 MIMAT0000417 MIMAT0000069 MIMAT0000070 MIMAT0000256 MIMAT0000211 MIMAT0000860 MIMAT0000456 MIMAT0000072 MIMAT0000440 MIMAT0000222 MIMAT0000460 MIMAT0000073 MIMAT0000682 MIMAT0000617 MIMAT0000264 MIMAT0000462 ab219508 mirna Panel Kidney Toxicity 4

38 hsa-mir-20b-5p 39 hsa-mir-210-3p 40 mmu-mir-212-3p 41 hsa-mir-214-3p 42 hsa-mir-21-5p 43 hsa-mir-218-5p 44 hsa-mir-223-3p 45 hsa-mir-23b-3p 46 hsa-mir-26b-5p 47 hsa-mir-27a-3p 48 hsa-mir-29a-3p 49 hsa-mir-30a-5p 50 hsa-mir-30c-5p 51 hsa-mir-30e-3p 52 hsa-mir-320a 53 hsa-mir-342-3p 54 hsa-mir-34a-5p 55 hsa-mir-34c-5p 56 mmu-mir-378a- 3p 57 hsa-mir-409-3p 58 hsa-mir-455-5p 59 hsa-mir-484 60 hsa-mir-486-5p 61 mmu-mir-489-3p 62 hsa-mir-494-3p 63 hsa-mir-532-3p CAAAGUGCUCAUAGUGCAG GUAG CUGUGCGUGUGACAGCGGC UGA UAACAGUCUCCAGUCACGG CCA ACAGCAGGCACAGACAGGC AGU UAGCAUCAGACUGAUG GA GUGCGAUCUAACCAUG U UGUCAGUGUCAAAUACCC CA AUCACAGCCAGGGAAC C CAAGUAACAGGAUAGG U CACAGUGGCUAAGCCG C UAGCACCAUCUGAAAUCGGU UA UGUAAACAUCCUCGACUGGA AG UGUAAACAUCCUACACUCUC AGC CUCAGUCGGAUGUACA GC AAAAGCUGGGGAGAGGG CGA UCUCACACAGAAAUCGCACC CGU UGGCAGUGUCAGCUGG GU AGGCAGUGUAGAGCUGAU UGC ACUGGACGGAGUCAGAA GG GAAUGGCUCGGUGAACC CCU UAUGUGCCUGGACUACAU CG UCAGGCUCAGUCCCCUCCC GAU UCCUGUACUGAGCUGCCCC GAG AAUGACACCACAUAUAUGGC AGC UGAAACAUACACGGGAAAC CUC CCUCCCACACCCAAGGC GCA MIMAT0001413 MIMAT0000267 MIMAT0000659 MIMAT0000271 MIMAT0000076 MIMAT0000275 MIMAT0000280 MIMAT0000418 MIMAT0000083 MIMAT0000084 MIMAT0000086 MIMAT0000087 MIMAT0000244 MIMAT0000693 MIMAT0000510 MIMAT0000753 MIMAT0000255 MIMAT0000686 MIMAT0003151 MIMAT0001639 MIMAT0003150 MIMAT0002174 MIMAT0002177 MIMAT0003112 MIMAT0002816 MIMAT0004780 ab219508 mirna Panel Kidney Toxicity 5

64 hsa-mir-93-5p 65 hsa-mir-98-5p 66 ath-mir167d 67 cel-mir-70-3p 68 oan-mir-7417-5p CAAAGUGCUGCGUGCAG GUAG UGAGGUAGUAAGGUAG UGAAGCUGCCAGCAUGAUCU GG UAAUACGUCGGGUGUC CAU CCCCACUCUGAGCACACA GC Ath Cel Oan 69 x-control x-control N/A 70 blank blank N/A MIMAT0000093 MIMAT0000096 MIMAT0000905 MIMAT0000042 MIMAT0028982 ab219508 mirna Panel Kidney Toxicity 6

3. Notes ab219508 mirna Panel Kidney Toxicity 7

Technical Support Copyright 2017 Abcam, All Rights Reserved. The Abcam logo is a registered trademark. All information / detail is correct at time of going to print. Austria wissenschaftlicherdienst@abcam.com 019-288-259 France supportscientifique@abcam.com 01.46.94.62.96 Germany wissenschaftlicherdienst@abcam.com 030-896-779-154 Spain soportecientifico@abcam.com 91-114-65-60 Switzerland technical@abcam.com Deutsch: 043-501-64-24 Français: 061-500-05-30 UK, EU and ROW technical@abcam.com +44(0)1223-696000 Canada ca.technical@abcam.com 877-749-8807 US and Latin America us.technical@abcam.com 888-772-2226 Asia Pacific hk.technical@abcam.com (852) 2603-6823 China cn.technical@abcam.com +86-21-5110-5938 400-628-6880 Japan technical@abcam.co.jp +81-(0)3-6231-0940 Singapore sg.technical@abcam.com 800 188-5244 Australia au.technical@abcam.com +61-(0)3-8652-1450 New Zealand nz.technical@abcam.com +64-(0)9-909-7829 Copyright 2017 Abcam. All rights reserved. FirePlex