www.sciencesignaling.org/cgi/content/full/8/366/ra25/dc1 Supplementary Materials for Viral entry route determines how human plasmacytoid dendritic cells produce type I interferons Daniela Bruni, Maxime Chazal, Laura Sinigaglia, Lise Chauveau, Olivier Schwartz, Philippe Desprès, Nolwenn Jouvenet* The PDF file includes: *Corresponding author. E-mail: jouvenet@pasteur.fr Published 3 March 2015, Sci. Signal. 8, ra25 (2015) DOI: 10.1126/scisignal.aaa1552 Fig. S1. Analysis of the depletion or isolation of pdcs from human PBMCs. Fig. S2. TLR7 agonist induced type I IFN production by pdcs is efficiently blocked by the specific TLR7 inhibitor IRS661. Fig. S3. YF-17D replicates in Gen2.2 cells and stimulates the RIG-I signaling pathway. Fig. S4. YF-17D induces nuclear translocation of IRF3 but not IRF7 in Gen2.2 cells. Fig. S5. SeV stimulates RIG-I signaling in Gen2.2 cells. Fig. S6. YF-17D infected Huh7 cells stimulate IFNA expression in Gen2.2 cells. Fig. S7. Sensing of YF-17D infected cells stimulates nuclear translocation of IRF7 but not IRF3 in Gen2.2 cells. Fig. S8. Infection with YF-17D stimulates nuclear translocation of IRF3 in Vero cells. Fig. S9. Schematic representation of the proposed YF-17D mediated signaling pathways in human pdcs. Table S1. Primers used for semiquantitative and real-time PCR analysis. Table S2. Reagents. Table S3. Antibodies. Table S4. Viruses. Table S5. Primary cells and cell lines. Table S6. shrna sequences for knockdown experiments.
Intact PBMCs pdc-depleted PBMCs isolated pdcs Fig. S1. Analysis of the depletion or isolation of pdcs from human PBMCs. pdcs were depleted from intact PBMCs with CD304 (BDCA-4/Neuropilin-1) beads. The negative fraction was designated as containing pdc-depleted PBMCs. Alternatively, pdcs were isolated by the depletion of non-pdcs with pdc isolation kits. pdcs were defined as cells stained with antibodies specific for CD303 and CD123. The purity of isolated preparations of pdcs was always >94% as assessed by flow cytometric staining.
Fig. S2. TLR7 agonist induced type I IFN production by pdcs is efficiently blocked by the specific TLR7 inhibitor IRS661. (A and B) Freshly isolated pdcs were left untreated (Mock) or were treated with the TLR7 agonist CL264 in the presence or absence of the TLR7 inhibitor IRS661. (A) The relative abundances of IFNA and IFNB mrnas were determined by qpcr analysis. (B) Culture medium of the indicated cells was analyzed by ELISA to determine the amounts of secreted IFN-α. Data are means ± SD of at least three independent experiments.
Fig. S3. YF-17D replicates in Gen2.2 cells and stimulates the RIG-I signaling pathway. (A and B) Gen 2.2 cells or Vero cells were left uninfected (Mock) or were infected for 24 hours with live or UV-inactivated YF-17D (both at an MOI of 1). (A) Cells were analyzed by flow cytometry with an antibody specific for dsrna. Flow cytometry plots are representative of three independent experiments. (B) Quantitative analysis of the percentages of the indicated Vero cells that were positive for dsrna as determined by flow cytometric analysis. Data are means ± SD of three independent experiments. (C) Gen2.2 cells, human pdcs, and Huh7 cells were analyzed by RT-PCR to detect mrnas encoding RIG-I, Mda-5, TLR7, and GAPDH. (D to G) Gen2.2-sh-Scrambled and Gen2.2-sh-RIG-I cells were left uninfected or were infected with YF-17D at an MOI of 50 for 24 hours. Densitometric analysis of Western blots from two independent experiments shows the relative abundances of (D) ptbk1 to total TBK1, (E) pirf3 to total IRF3, (F) pstat1 to total STAT1, and (G) RIG-I to β-actin. Data are expressed as a percentage of the values of Gen2.2-sh-Scrambled cells, and are means ± SD.
Fig. S4. YF-17D induces the nuclear translocation of IRF3 but not IRF7 in Gen2.2 cells. (A to C) Gen2.2 cells were left uninfected (Mock) or were infected with YF-17D for 24 hours. The cells were then stained with antibodies specific for dsrna (green), DAPI (blue) and either (A) anti-irf3 antibody (red) or (B) anti-irf7 antibody (red) and analyzed by confocal microscopy. (C) The percentages of infected cells displaying nuclear or cytosolic localization of IRF3 or IRF7 are shown. At least 100 cells were counted for each sample. Data are representative of three independent experiments. Scale bar: 2 µm.
Fig. S5. SeV stimulates RIG-I signaling in Gen2.2 cells. (A to E) Gen2.2-sh-Scrambled and Gen2.2-sh-RIG-I cells were left uninfected (Mock), infected with SeV (50 HAU/ml), or treated with CL264 (10 μg/ml) for 8 hours. Whole-cell lysates were then analyzed by Western blotting as displayed in Fig. 3. Densitometric analysis of Western blots from two independent experiments shows the relative abundances of (A) RIG-I to β-actin, (B) ptbk1 to total TBK1, (C) pirf3 to total IRF3, (D) total STAT1 to β-actin, and (E) pstat1 to total STAT1. Data are means ± SD and are expressed as a percentage of the values of Gen2.2-sh-Scrambled cells.
Fig. S6. YF-17D infected Huh7 cells stimulate IFNA expression in Gen2.2 cells. (A and B) Huh7 cells or Gen2.2 cells were infected for 24 hours with YF-17D at an MOI of 1. The relative abundances of (A) viral RNA and (B) IFNA mrna were determined by qpcr analysis. (C and D) Huh7 cells were infected for 16 hours with YF-17D at an MOI of 1 and then were co-cultured with Gen2.2 cells for a further 24 hours. The co-cultures either were or were not separated by transwell chambers. Suspension cells (predominantly Gen2.2 cells) were collected with the cell culture medium after gentle shaking, whereas adherent cells (predominantly Huh7 cells) were collected separately. The indicated groups of cells were then subjected to qpcr analysis to determine the relative amounts of (C) viral RNA and (D) IFN-A mrna. Data in all bar graphs are means ± SD of at least three independent experiments. *P < 0.05; **P < 0.01 by two-tailed Student's t-test.
Fig. S7. The sensing of YF-17D infected cells stimulates nuclear translocation of IRF7 but not IRF3 in Gen2.2 cells. (A to C) CFSE-labeled Vero cells (green) were left uninfected (Mock) or were infected for 16 hours with YF-17D and then were co-cultured with Gen2.2 cells for 24 hours. The cells were stained with DAPI (blue) to visualize nuclei, together with (A) anti-irf3 antibody (red) or (B) anti-irf7 antibody (red). (C) The percentages of infected cells displaying nuclear or cytosolic localization of IRF3 or IRF7 are shown. At least 100 cells were counted for each sample. Data are representative of three independent experiments. Scale bar: 2 μm. (C).
Fig. S8. Infection with YF-17D stimulates nuclear translocation of IRF3 in Vero cells. (A to C) CFSE-labeled Vero cells (green) were left uninfected (green) or were infected with YF- 17D for 40 hours. Cells were stained with DAPI (blue) to visualize nuclei, together with (A and B) anti-irf3 antibody (red) or (C) anti-irf7 antibody (red). (B) The percentages of infected cells displaying nuclear or cytosolic localization of IRF3 are shown. At least 100 cells were counted for each sample. Data are representative of three independent experiments. Scale bar: 5 μm.
Fig. S9. Schematic representation of the proposed YF-17D mediated signaling pathways in human pdcs. The live attenuated vaccine YF-17D replicates in human pdcs and pdc-like cells and stimulates RIG-I mediated responses. Replication of YF-17D leads to the phosphorylation of TBK1 and IRF3, which suggests that the RIG-I IRF3 axis is activated in pdcs. Note that the virus-mediated activation of IRF3 appears to be restricted to the RIG-I pathway, because the TLR7 agonist did not stimulate IRF3 phosphorylation. Stimulation of pdcs and Gen2.2 cells by YF-17D infected cells is TLR7-dependent. The production of viral particles by infected cells is required for the induction of a type I IFN response, because the expression of YF-17D RNA in infected cells was not sufficient. The mechanism through which the cell-to-cell transfer of virions occurs is not well-characterized. We suggest that newly-assembled viruses are transferred from donor cells to pdcs through physical connections. The virions might eventually fuse with TLR7-containing lysosomal compartments, in which their degradation would render the viral RNA accessible to TLR7. In contrast, the RNA of penetrating cell-free YF-17D virions would be protected by its capsid during its transit through endosomal compartments and would therefore not be accessible to TLR7.
Table S1. Primers used for semiquantitative and real-time PCR analysis. GAPDH Forward Reverse ggtcggagtcaacggatttg actccacgacgtactcagcg a Forward gcaagcccagaagtatctgc Reverse actggttgccatcaaactcc IFNB RIG-I MDA5 TLR7 YF-NS3 Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse tgcattacctgaaggccaag aagcaattgtccagtccca agagcacttgtggacgcttt tgcaatgtcaatgccttcat acacgttctttgcgatttcc accaaatacaggagccatgc ccttgaggccaacaacatct gtagggacggctgtgacatt aggtccagttgatcgcggc gagcgacagccccgatttct a Of note, the primers for IFNA detect subtypes 1 and 13.
Table S2. Reagents. Reagent a Source Final concentration used (references) MRT67307 (TBK1/IKKε kinase Sigma-Aldrich 1 μm (33 35) inhibitor) IRAK1/4 kinase inhibitor Sigma-Aldrich 1 μm (35) IRS661 (TLR7-specific ODN antagonists) IRS1040 (non-specific ODN) Dynavax Technologies Dynavax Technologies 5.6 μm (36) 5.6 μm (36) CL264 (TLR7 agonist) InvivoGen 10 µg/ml CFSE (5(6)-Carboxyfluorescein-Nhydroxysuccinimidyl ester) Abcam 1 μm a None of the reagents caused any evident toxicity or cell death, nor did they cause any variation in the GAPDH Ct values (compared to the GAPDH Ct values of untreated samples) as determined by qpcr analysis.
Table S3. Antibodies. WB: Western blotting; IF: immunofluorescence; F: flow cytometry. Antibody target Source Application IRF3 (ps386) clone EPR2346 Abcam WB NAK/TBK1 (ps172) antibody [EPR2867(2)] Abcam WB TLR7 Abcam WB RIG-I (clone Alme-1) Adipogen WB IRF3 (FL-425) Santa Cruz WB, IF IRF7 Abcam IF TBK1 (M-375) Santa Cruz WB STAT1 (py701, 58D6) Cell Signalling WB STAT1 (42H3) Cell Signalling WB β-actin (AC-15) Sigma-Aldrich WB NS1 Gift from M. IF dsrna J2 Flamand a English & Scientific Consulting Kft IF, F Capsid Agro-Bio WB (56) 4G2 (Env) (57) IF, F Alexa Fluor 488 Goat Anti-Mouse IgG (H+L) Life Technologies IF, F Alexa Fluor 647 Goat Anti-Mouse IgG (H+L) Life Technologies IF, F Cy3 Goat Anti-Mouse IgG (H+L) Life Technologies IF, F DyLight 800 conjugated IgG (H+L) Fisher Scientific WB CD303 (BDCA-2)-APC Miltenyi F Mouse IgG1-APC Miltenyi F
CD123-FITC Miltenyi F Mouse IgG2A-FITC Miltenyi F a Institut Pasteur, Paris, France.
Table S4.Viruses. Virus Source (citation) Concentrati on YF-17D-204 (STAMARIL vaccine) Sanofi Pasteur (57) MOI of 1 a SeV defective interfering RNA Dominique Garcin (44) 50 HAU/ml. a Unless otherwise stated.
Table S5. Primary cells and cell lines. Cells Media/Information Species (source) Vero DMEM + 10% FCS +1% PS Monkey (ATCC) Huh7 DMEM + 10% FCS +1% PS Human (46) Gen2.2 PBMC/pDC RPMI 1640 + 10% FCS +1% PS + 1% nonessential amino acids + 1% sodium pyruvate RPMI 1640 + 10% FCS +1% PS + 1% nonessential amino acids + 1% sodium pyruvate Human (39) Human (healthy donors) YFRP DMEM + 10% FCS +1% PS Monkey HCVRP DMEM + 10% FCS +1% PS Human (46) a Dulbecco's modified eagle's medium (DMEM) containing GlutaMAX I and sodium pyruvate (Invitrogen), heat-inactivated fetal calf serum (FCS, Sigma-Aldrich), penicillin (100 IU/ml) and streptomycin (100 μg/ml) (1% PS, InvivoGen). b RPMI was obtained from Life Technologies; non-essential amino acids and sodium pyruvate were obtained from InvivoGen.
Table S6. shrna sequences for knockdown experiments. Name TLR7 (NM_016562; Clone ID: TRCN0000056974) shrna Control shrna RIG-I shrna Source OpenBiosystem OpenBiosystem Rick Randall a a University of St. Andrews, Scotland, UK.