Synergy of radiotherapy and PD-1 blockade in Kras-mutant lung cancer

Similar documents
Supplementary Figure 1. Immune profiles of untreated and PD-1 blockade resistant EGFR and Kras mouse lung tumors (a) Total lung weight of untreated

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-

SUPPLEMENTARY METHODS

Nature Immunology: doi: /ni Supplementary Figure 1. Examples of staining for each antibody used for the mass cytometry analysis.

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr

To compare the relative amount of of selected gene expression between sham and

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT

Nature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol.

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x

Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs

Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018

SUPPLEMENTARY FIGURES

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supporting Information

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL).

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

Supplementary Information

SUPPORTING INFORMATIONS

Supplementary Figure 1. Flow cytometry panels used for BD Canto (A) and BD Fortessa (B).

Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast

Supplementary Figures

Interferon-dependent IL-10 production by Tregs limits tumor Th17 inflammation

Supplementary Table 1

Fluorochrome Panel 1 Panel 2 Panel 3 Panel 4 Panel 5 CTLA-4 CTLA-4 CD15 CD3 FITC. Bio) PD-1 (MIH4, BD) ICOS (C398.4A, Biolegend) PD-L1 (MIH1, BD)

Reviewers' comments: Reviewer #1 (Remarks to the Author):

An interleukin-17-mediated paracrine network promotes tumor resistance to anti-angiogenic therapy

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

Eosinophils! 40! 30! 20! 10! 0! NS!

Nature Immunology: doi: /ni Supplementary Figure 1. RNA-Seq analysis of CD8 + TILs and N-TILs.

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver,

PHENOTYPIC DYNAMICS OF MICROGLIAL AND MONOCYTE-DERIVED CELLS IN GLIOBLASTOMA-BEARING MICE.

Supplemental Table I.

Supplemental Table 1. Primer sequences for transcript analysis

Chitin Activates Parallel Immune Modules that Direct Distinct Inflammatory Responses via Innate Lymphoid Type 2 and T Cells

Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell?

A fresh approach to Immuno-oncology: Ex vivo analysis of drug efficacy in fresh patient tumortissue

SUPPLEMENTAL INFORMATIONS

Supplementary Materials for

Welcome. Nanostring Immuno-Oncology Summit. September 21st, FOR RESEARCH USE ONLY. Not for use in diagnostic procedures.

CB-1158 Inhibits the Immuno-oncology Target Arginase and Causes an Immune Mediated Anti-Tumor Response

Human Immune System (HIS) mouse models for translational research. Barbara Joyce-Shaikh

Immune reprogramming via PD-1 inhibition enhances early-stage lung cancer survival

Supporting Information

Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation

Manipulating the Tumor Environment

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

Immunology. Antibodies for immunology research

Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in

sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5

L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow

Supplementary Table 1. Antibodies and dilutions used in the immunohistochemical study

Tumor Microenvironment and Immune Suppression

CD44

Categorical analysis of human T cell heterogeneity with One-SENSE

Figure S1. IRF5 mrna expression is not expressed modulated by steatosis grade in

DISCOVER MORE WITH LESS SAMPLE. nanostring.com/3d

Nature Immunology: doi: /ni Supplementary Figure 1. Id2 and Id3 define polyclonal T H 1 and T FH cell subsets.

SUPPLEMENTARY INFORMATION

B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN

1,000 in silico simulated alpha, beta, gamma and delta TCR repertoires were created.

Regulation of anti-tumor immunity through migration of immune cell subsets within the tumor microenvironment Thomas F. Gajewski, M.D., Ph.D.

Eosinophils are required. for the maintenance of plasma cells in the bone marrow

SUPPLEMENTARY INFORMATION

Expanded View Figures

Supplementary Appendix

Darwinian selection and Newtonian physics wrapped up in systems biology

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Supporting Information

SUPPLEMENTARY FIG. S2. b-galactosidase staining of

Cancer Research. Abstract. Introduction

Table S1. Viral load and CD4 count of HIV-infected patient population

Online supplement. Phenotypic, functional and plasticity features of classical and alternatively activated

Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel

Innate Immunity. Chapter 3. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples. Antimicrobial peptide psoriasin

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.

Interferon-dependent IL-10 production by Tregs limits tumor Th17 inflammation

Human Immunodeficiency Virus Type-1 Myeloid Derived Suppressor Cells Inhibit Cytomegalovirus Inflammation through Interleukin-27 and B7-H4

* Kyoto Encyclopedia of Genes and Genomes.

Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.

Supplementary appendix

Gene expression profiling in pediatric septic shock: biomarker and therapeutic target discovery

Reviewers' comments: Reviewer #1 (Remarks to the Author):

4. Th1-related gene expression in infected versus mock-infected controls from Fig. 2 with gene annotation.

Tim-3 as a target for tumor immunotherapy

Nature Immunology: doi: /ni.3836

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained

January 25, 2017 Scientific Research Process Name of Journal: ESPS Manuscript NO: Manuscript Type: Title: Authors: Correspondence to

NKTR-255: Accessing IL-15 Therapeutic Potential through Robust and Sustained Engagement of Innate and Adaptive Immunity

Supplementary Figures

HD1 (FLU) HD2 (EBV) HD2 (FLU)

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8

Title. CitationCancer science, 109(4): Issue Date Doc URL. Rights(URL)

Radiation Therapy as an Immunomodulator

CLINICAL USE OF CELLULAR SUBPOPULATION ANALYSIS IN BM

Effector T Cells and

FOCiS. Lecture outline. The immunological equilibrium: balancing lymphocyte activation and control. Immunological tolerance and immune regulation -- 1

Asian Zika virus strains target CD14 + blood monocytes and induce M2-skewed immunosuppression during pregnancy

Transcription:

Supplementary Information Synergy of radiotherapy and PD-1 blockade in Kras-mutant lung cancer Grit S. Herter-Sprie, Shohei Koyama, Houari Korideck, Josephine Hai, Jiehui Deng, Yvonne Y. Li, Kevin A. Buczkowski, Aaron K. Grant, Soumya Ullas, Kevin Rhee, Jillian D. Cavanaugh, Neermala Poudel Neupane, Camilla L. Christensen, Jan M. Herter, G. Mike Makrigiorgos, F. Stephen Hodi, Gordon J. Freeman, Glenn Dranoff, Peter S. Hammerman, Alec C. Kimmelman, and Kwok-Kin Wong Supplementary Figure 1 5 Supplementary ables 1

Supplementary Figure 1 A H Pre-treatment 8 weeks post 14 weeks post B Pre-treatment H 8 weeks post 2 weeks post L Supplementary Figure 1 umor growth kinetics in response to R and αpd-1 treatment in Kras-mutant murine NSCLC. (A) Representative MR images of a responsive (left lung) Kras-driven tumor at different time points (baseline, 8, and 14 weeks post treatment initiation). Contralateral tumor growth in the right lung (n=7). (B) Representative MR images of a resistant (left lung) Kras-driven tumor at different time points (baseline, 8, and 2 weeks post treatment initiation) (n=3). H (heart) circled in red. L (liver) circled in green. (tumor) circled with white/blue dotted line. 2

Supplementary Figure 2 A R refractory + αpd-1 R refractory B R refractory + αpd-1 R refractory cell exhaustion/inhibition cell recruitment/ activation Btla Eomes Ctla4 Lag3 Pd-1 Il1b Ccl5 Ifng Gzmb 2 4 6 log2 M1-associated genes M2-associated genes Lrp1 Irf4 Mrc1 Socs1 Cd36 Arg1 gfb1 Il13 Il1 Il4 Ifnb1 Ifna4 Ifna2 Ifna1 Vegfc Vegfa Il6 nf Il23a Il12b Il12a Nos2 5 1 15 log2 Supplementary Figure 2 reatment of R-refractory K tumors with αpd-1 induces marker of cell inhibition. (A) Expression of selected cell-associated genes in Rrelapsed and R-relapsed αpd-1-treated tumors. (B) Expression of selected macrophage-associated genes in R-relapsed and R-relapsed αpd-1-treated tumors. Representative data are shown from mouse ncounter PanCancer Immune Profiling Panel conducted with RNA from 4 R-treated and 4 R-refractory αpd-1-treated mice (A, and B). Data are represented as mean ± SEM. Btla, B- and -lymphocyte attenuator; Eomes, Eomesodermin; Il1b, Interleukin 1 beta; Ccl5, Chemokine (C-C motif) ligand 5; Ifng, Interferon gamma; Gzmb, granzyme B; Lrp1, Low density lipoprotein receptor-related protein 1; Irf4, Interferon regulatory factor 4; Mrc1, Mannose receptor, C ype 1; Socs1, Suppressor of cytokine signaling 1; CD36, CD36 Molecule/hrombospondin receptor; Arg1, Arginase 1; gfb1, transforming growth factor beta-1; Il13, Interleukin 13; Il1, Interleukin 1; Il4, Interleukin 4; Ifnb1, Interferon beta 1; Ifna4, Interferon alpha 4; Ifna2, Interferon alpha 2; Ifna1, Interferon alpha 1; Vegfc, Vascular endothelial growth factor C; Vegfa, Vascular endothelial growth factor A; Il6, Interleukin 6; nf, umor necrosis factor; Il23a, Interleukin 23 alpha; Il12b, Interleukin 12 beta; Il12a, Interleukin 12 alpha; Nos2, Nitric oxide synthase 2. 3

Supplementary Figure 3 reatment response to R of Kras tumors 3 umour volume change (%) 2 1 2-3 -1 2 4 6 8 1 12 14 16 18 2 Weeks Supplementary Figure 3 umor growth kinetics in response to R in Kras-mutant murine NSCLC. umor volume kinetics of R-treated tumors. Each line represents one mouse (n=5). Data of this cohort was previously published (Herter-Sprie et al., 214). 4

Supplementary Figure 4 A CD45+ /EpCAM+ ratio [per mg tumor] 25 2 15 1 5 unirradiated αpd-1 R+αPD-1 R B H Pre-treatment 4 weeks post R + αpd-1 6 weeks post R + αpd-1 D count/mg 3 Kras Kras/Lkb1 ** * 2 1 AM AN 8 % on CD8+ cells 4 Markers on tumor infiltrating CD8+ cells 6 * ** ** 4 2 Pd-1 Lag3 im3 6 % on CD4+ cells C Ctla4 Markers on tumor infiltrating CD4+ cells 4 2 Pd-1 Lag3 im3 Ctla4 Supplementary Figure 4 umor growth kinetics in response to R and αpd-1 treatment in Kras/Lkb1-mutant murine NSCLC and differences in tumor-associated immune cell populations compared to Kras-mutant murine NSCLC. (A) CD45+/EpCAM+ ratio calculated from Figure 5B (3 unirradiated, 3 R-treated, 3 αpd-1-treated, and 4 R+αPD-1-treated mice). (B) MR images of a progressive Kras/Lkb1 tumor at different time points (baseline, 4, and 6 weeks post treatment initiation) (n=2). H (heart) circled in red. (tumor) circled with white/blue dotted line. (C) Representative flow cytometry data (live/single/total CD45+ cells). otal numbers of tumor-infiltrating myeloid cells of unirradiated Kras and Kras/Lkb1 tumors (taken from Figure 2B and Figure 5B). (D) Expression of inhibitory cell markers on CD8+ and CD4+ cells of unirradiated Kras and Kras/Lkb1 tumors (taken from Figure 2E and Figure 5D). Representative data are shown conducted with 5 unirradiated Kras, and 3 unirradiated Kras/Lkb1 mice (C and D). Data are represented as mean ± SEM. P values were calculated using two-tailed Student s t-test. ***P<.1, **P<.1, *P<.5. 5

Supplementary Figure 5 adapted from Koyama et al., Cancer Res., 216 Alveolar macrophages (umor-associated macrophages: AM) umor cells CD13 + DC CD45 CD11c Live/Single cell gating Neutrophils (umor-associated neutrophils: AN) CD13 EpCAM or SSC-A CD45 CD11c Ly-6G CD19 FSC-A FSC-A CD11b CD11b CXCR2 NKp46 CD3 SSC-A SSC-A CD8a DX5 FSC-A Ly-6C Siglec-F CCR3 CD4 CD3 Eosinophils Ly-6C hi monocytes CD8 + cells NK cells Other myeloid cells (CD11b + DC, tissue macrophages, Ly-6C lo monocytes, etc.) 6 B cells CD4 + cells

Supplementary able 1 Antigen Clone Source Antigen Clone Source CD45 3-F11 BioLegend Siglec F E5-244 BD Biosciences CD3ε 145-2C11 BioLegend PD-1 29F.1A12 BioLegend CD4 RM4-5 BioLegend IM-3 RM3-23 BioLegend CD8a 53-6.7 BioLegend LAG-3 C9B7W BioLegend CD19 6D5 BioLegend CD13 2E7 BioLegend DX5 DX5 BioLegend PD-L1 1F.9G2 BioLegend NKp46 29A1.4 BioLegend EpCAM G8.8 BioLegend CD11c N418 BioLegend CD16/32 2.4G2 BioLegend CD11b M1/7 BioLegend Ly-6G 1A8 BioLegend FOXP3 FJK-16s ebioscience Ly-6C HK1.4 BioLegend CLA-4 UC1-4B9 ebioscience Supplementary able 1 List of murine antibodies used for flow cytometry analysis. 7