SUPPLEMENTARY FIG. S2. b-galactosidase staining of
|
|
- Ezra Martin
- 5 years ago
- Views:
Transcription
1 SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived mesenchymal stem cells lineage in 100 mg=dl (10 magnification). Note the difference in the pellet size as well as the cell=matrix density. SUPPLEMENTARY FIG. S2. b-galactosidase staining of senescent cells in 500 mg=dl glucose þ tumor necrosis factoralpha treatment (10 magnification). SUPPLEMENTARY FIG. S4. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived mesenchymal stem cells lineage in 500 mg=dl of glucose (10 magnification). Note the difference in the pellet size as well as the cell=matrix density.
2 SUPPLEMENTARY FIG. S7. Oil Red O staining of adipogenic-differentiated adipose-tissue-derived mesenchymal stem cells in 250 mg=dl glucose concentrations (10 magnification). SUPPLEMENTARY FIG. S5. Representative experiment of 4 genes expressed in chondrogenic-differentiated nascs and dascs. All values were normalized to 100 nascs (x-axis; n ¼ 3). dasc, diabetic adipose-tissue-derived mesenchymal stem cell; nasc, nondiabetic adipose-tissue-derived mesenchymal stem cell. SUPPLEMENTARY FIG. S6. Oil Red O staining of adipogenicdifferentiated adipose-tissue-derived mesenchymal stem cells in 100 mg=dl glucose (10 magnification).
3 SUPPLEMENTARY FIG. S8. Regression analysis comparing nasc and dasc (100 mg=dl) gene expression. The data were normalized based on nascs. dasc, diabetic adipose-tissue-derived mesenchymal stem cell; nasc, nondiabetic adiposetissue-derived mesenchymal stem cell. Red and green circles indicate up regulation and down regulation of genes, respectively. Black circles indicate of genes displaying less than two fold difference between analyzed groups.
4 SUPPLEMENTARY FIG. S9. Regression analysis of nasc (250 mg=dl) genes as a function of glucose. The data were normalized based on nascs 100 mg=dl. nasc, nondiabetic adipose-tissue-derived mesenchymal stem cell. Red and green circles indicate up regulation and down regulation of genes, respectively. Black circles indicate of genes displaying less than two fold difference between analyzed groups.
5 SUPPLEMENTARY FIG. S10. Regression analysis of nasc (250 mg=dl) genes as a function of insulin. The data were normalized based on nascs 250 mg=dl without insulin. nasc, nondiabetic adipose-tissue-derived mesenchymal stem cell. Red and green circles indicate up regulation and down regulation of genes, respectively. Black circles indicate of genes displaying less than two fold difference between analyzed groups.
6 SUPPLEMENTARY FIG. S11. Regression analysis of dasc (250 mg=dl) genes as a function of glucose. The data were normalized based on dascs 100 mg=dl. dasc, diabetic adipose-tissue-derived mesenchymal stem cell. Red and green circles indicate up regulation and down regulation of genes, respectively. Black circles indicate of genes displaying less than two fold difference between analyzed groups.
7 SUPPLEMENTARY FIG. S12. Regression analysis of dasc (250 mg=dl) genes as a function of insulin. The data were normalized based on dascs without insulin. dasc, diabetic adipose-tissue-derived mesenchymal stem cell. Red and green circles indicate up regulation and down regulation of genes, respectively. Black circles indicate of genes displaying less than two fold difference between analyzed groups.
8 Supplementary Table S1. List of Analyzed Genes Gene Full name GenBank ABCC8 ATP-binding cassette, sub-family C (CFTR=MRP), member 8 NM_ ACE angiotensin I converting enzyme (peptidyl-dipeptidase A) 1 NM_ ACLY ATP citrate lyase NM_ ADRB3 adrenergic, beta-3-, receptor NM_ AGT angiotensinogen (serpin peptidase inhibitor, clade A, member 8) NM_ AKT2 v-akt murine thymoma viral oncogene homolog 2 NM_ AQP2 aquaporin 2 (collecting duct) NM_ CCL5 chemokine (C-C motif ) ligand 5 NM_ CCR2 chemokine (C-C motif ) receptor 2 NM_ CD28 CD28 molecule NM_ CEACAM1 carcinoembryonic antigen-related cell adhesion molecule 1 (biliary NM_ glycoprotein) CEBPA CCAAT=enhancer binding protein (C=EBP), alpha NM_ CTLA4 cytotoxic T-lymphocyte-associated protein 4 NM_ DUSP4 dual specificity phosphatase 4 NM_ ENPP1 ectonucleotide pyrophosphatase=phosphodiesterase 1 NM_ FBP1 fructose-1,6-bisphosphatase 1 NM_ FOXC2 forkhead box C2 (MFH-1, mesenchyme forkhead 1) NM_ FOXG1 forkhead box G1 NM_ FOXP3 forkhead box P3 NM_ G6PC glucose-6-phosphatase, catalytic subunit NM_ G6PD glucose-6-phosphate dehydrogenase NM_ GCG glucagon NM_ GCGR glucagon receptor NM_ GCK glucokinase (hexokinase 4) NM_ GLP1R glucagon-like peptide 1 receptor NM_ GPD1 glycerol-3-phosphate dehydrogenase 1 (soluble) NM_ GSK3B glycogen synthase kinase 3 beta NM_ HMOX1 heme oxygenase (decycling) 1 NM_ HNF4A hepatocyte nuclear factor 4, alpha NM_ ICAM1 intercellular adhesion molecule 1 NM_ IDE insulin-degrading enzyme NM_ IFNG interferon, gamma NM_ IGFBP5 insulin-like growth factor binding protein 5 NM_ IKBKB inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta NM_ IL10 interleukin 10 NM_ IL12B interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte NM_ maturation factor 2, p40) IL4R interleukin 4 receptor NM_ IL6 interleukin 6 (interferon, beta 2) NM_ INPPL1 inositol polyphosphate phosphatase-like 1 NM_ INSR insulin receptor NM_ IRS1 insulin receptor substrate 1 NM_ PDX1 pancreatic and duodenal homeobox 1 NM_ INS insulin NM_ IRS2 insulin receptor substrate 2 NM_ MAPK14 mitogen-activated protein kinase 14 NM_ MAPK8 mitogen-activated protein kinase 8 NM_ ME1 malic enzyme 1, NADP(þ)-dependent, cytosolic NM_ NEUROD1 neurogenic differentiation 1 NM_ NFKB1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 1 NM_ NOS3 nitric oxide synthase 3 (endothelial cell) NM_ NRF1 nuclear respiratory factor 1 NM_ NSF N-ethylmaleimide-sensitive factor NM_ PARP1 poly (ADP-ribose) polymerase 1 NM_ PIK3C2B phosphoinositide-3-kinase, class 2, beta polypeptide NM_ PIK3CD phosphoinositide-3-kinase, catalytic, delta polypeptide NM_ PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alpha) NM_ PPARA peroxisome proliferator-activated receptor alpha NM_ PPARG peroxisome proliferator-activated receptor gamma NM_ PPARGC1A peroxisome proliferator-activated receptor gamma, coactivator 1 alpha NM_ PPARGC1B peroxisome proliferator-activated receptor gamma, coactivator 1 beta NM_ PRKAA1 protein kinase, AMP-activated, alpha 1 catalytic subunit NM_ PRKAG2 protein kinase, AMP-activated, gamma 2 non-catalytic subunit NM_ (continued)
9 Supplementary Table S1. (Continued) Gene Full name GenBank PRKCB1 protein kinase C, beta NM_ PTPN1 protein tyrosine phosphatase, non-receptor type 1 NM_ PYGL phosphorylase, glycogen, liver NM_ RAB4A RAB4A, member RAS oncogene family NM_ RETN resistin NM_ SELL selectin L NM_ SLC2A4 solute carrier family 2 (facilitated glucose transporter), member 4 NM_ SNAP23 synaptosomal-associated protein, 23kDa NM_ SNAP25 synaptosomal-associated protein, 25 kda NM_ SREBF1 sterol regulatory element binding transcription factor 1 NM_ STX4 syntaxin 4 NM_ STXBP1 syntaxin binding protein 1 NM_ STXBP2 syntaxin binding protein 2 NM_ HNF1B HNF1 homeobox B NM_ TGFB1 transforming growth factor, beta 1 NM_ NKX2-1 NK2 homeobox 1 NM_ TNF tumor necrosis factor (TNF superfamily, member 2) NM_ TNFRSF1A tumor necrosis factor receptor superfamily, member 1A NM_ TRIB3 tribbles homolog 3 (Drosophila) NM_ VAMP3 vesicle-associated membrane protein 3 (cellubrevin) NM_ VAPA VAMP (vesicle-associated membrane protein)-associated protein A, 33 kda NM_ VEGFA vascular endothelial growth factor A NM_003376
10 Supplementary Table S2. Transcriptomic Alterations of nascs and dascs in Response to Increased Glucose Concentration and Insulin Treatment Genes dascs vs. nascs (100 mg=dl) dascs vs. nascs (250 mg=dl) nascs (100 vs. 250 mg=dl) dascs (100 vs. 250 mg=dl) nascs vs. nascs þ Ins in 250 mg=dl dascs vs. dascs þ Ins in 250 mg=dl CTLA INSR ND 1.60 ND CEACAM ND SELL 2.78 ND 2.47 ND ADRB3 ND SLC2A4 ND ND SNAP25 ND ND STXBP2 ND ND ND ND GCK ND ND GPD ND FBP ND IFNG IL ND ND ND IL ND IL12B ND RETN ND VEGFA ND ND ND DUSP ND 2.76 CEBPA ND ND FOXP ND ND ND HNF4A ND ND PDX ND 1.93 ND HNF1B ND PPARGC1A ND ND NKX2-1 ND ND 4.96 List of genes obtained from comparison between nascs and dascs grown in glucose condition of 100 and 250 mg=dl with and without insulin treatment (n ¼ 6). Positive values represent an up-regulation in the dascs. Ratios are greater than 2(P < 0.05). ND, not detected
Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
More information* Kyoto Encyclopedia of Genes and Genomes.
Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited
More informationSupplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
More informationMaturity-onset diabetes of the young (MODY) is a heterogeneous group
Over the years, different forms of maturity-onset diabetes of the young (MODY) have been identified, with mutations in a number of different genes associated with a MODY-like phenotype. Depending on the
More informationValidated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name
5HT1a NM_008308.4 Serotonin Receptor 1a 5HT1b NM_010482.1 Serotonin Receptor 1b 5HT2a NM_172812.2 Serotonin Receptor 2a ACO-2 NM_080633.2 Aconitase 2 Adora2A NM_009630.02 Adenosine A2a Receptor Aif1 (IbaI)
More informationSupplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG
More informationUKGTN Testing Criteria
Test name: Neonatal Diabetes 22 Gene Panel UKGTN Testing Criteria Approved name and symbol of disorder/condition(s): See Appendix 1 Approved name and symbol of gene(s): See Appendix 1 number(s): number(s):
More informationCell Signaling part 2
15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,
More informationFinal Review Sessions. 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office Hours
Final Review Sessions 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office ours 3/14 (WED) 9:30 11:30 am (Rebecca) 3/16 (FRI) 9-11 am (Abel) Final ESSENTIALS Posted Lecture 20 ormonal
More informationMETABOLIC REGULATION: THE ROLE OF INSULIN/GLUCAGON IN DIABETES
METABOLIC REGULATION: THE ROLE OF INSULIN/GLUCAGON IN DIABETES Helena Caria Biomedical Sciences Department, School of Health, Polytechnic Institute of Setubal helena.caria@ess.ips.pt 8/12/2016 Glucose
More informationMolecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression
Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Question No. 1 of 10 1. Which statement about cell signaling is correct? Question #1 (A) Cell signaling involves receiving
More informationTNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57
Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive
More informationIntegration of Metabolism
Integration of Metabolism Metabolism is a continuous process. Thousands of reactions occur simultaneously in order to maintain homeostasis. It ensures a supply of fuel, to tissues at all times, in fed
More informationTable S1 Differentially expressed genes showing > 2 fold changes and p <0.01 for 0.01 mm NS-398, 0.1mM ibuprofen and COX-2 RNAi.
Table S1 Differentially expressed genes showing > 2 fold changes and p
More informationEditorial Type 2 Diabetes and More Gene Panel: A Predictive Genomics Approach for a Polygenic Disease
Cronicon OPEN ACCESS EC DIABETES AND METABOLIC RESEARCH Editorial Type 2 Diabetes and More Gene Panel: A Predictive Genomics Approach for a Polygenic Disease Amr TM Saeb* University Diabetes Center, College
More informationVisfatin regulates insulin secretion, insulin receptor signalling and mrna expression of diabetes related genes in mouse pancreatic beta-cells
Page 1 of 21 Accepted Preprint first posted on 11 November 2009 as Manuscript JME-09-0071 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Visfatin regulates insulin secretion,
More informationSupplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice
Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice undergoing AD- and psoriasis-like disease. Immunofluorescence staining for Fn14 (green) and DAPI (blue) in skin of naïve
More informationVets 111/Biov 111 Cell Signalling-2. Secondary messengers the cyclic AMP intracellular signalling system
Vets 111/Biov 111 Cell Signalling-2 Secondary messengers the cyclic AMP intracellular signalling system The classical secondary messenger model of intracellular signalling A cell surface receptor binds
More informationRho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion
Probe Set ID RefSeq Transcript ID Gene Title Gene Symbol 205980_s_at NM_001017526 /// NM_181334 /// NM_181335 Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion ARHGAP8 /// LOC553158 FC ALK shrna
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
More informationTable S1. Metadata for transcriptome interaction network and pathway analysis of 5448 intracelluarly infected TEpi cells in comparison to mock TEpi cells. Gene symbol Full name Log2FC gene expression in
More information(de novo synthesis of glucose)
Gluconeogenesis (de novo synthesis of glucose) Gluconeogenesis Gluconeogenesis is the biosynthesis of new glucose. The main purpose of gluconeogenesis is to maintain the constant blood Glc concentration.
More informationSynergy of radiotherapy and PD-1 blockade in Kras-mutant lung cancer
Supplementary Information Synergy of radiotherapy and PD-1 blockade in Kras-mutant lung cancer Grit S. Herter-Sprie, Shohei Koyama, Houari Korideck, Josephine Hai, Jiehui Deng, Yvonne Y. Li, Kevin A. Buczkowski,
More informationReceptor mediated Signal Transduction
Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third
More informationCARBOHYDRATE METABOLISM 1
CARBOHYDRATE METABOLISM 1 web 2017 József Mandl Strategy of metabolism 1 Strategy of metabolism to extract energy ( hydrogen ) from the environment to store the energy excess to store hydrogen CH 3 O 2
More informationT-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
More informationT-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
More informationChapter 15 Homework Assignment
Chapter 15 Homework Assignment The following problems will be due once we finish the chapter: 3, 5, 6, 8, 9 Chapter 15 1 Regulation of Metabolic Pathways Dynamic Steady State Fuels, such as glucose, enter
More informationBiology 638 Biochemistry II Exam-2
Biology 638 Biochemistry II Exam-2 Biol 638, Exam-2 (Code-1) 1. Assume that 16 glucose molecules enter into a liver cell and are attached to a liner glycogen one by one. Later, this glycogen is broken-down
More informationKEY CONCEPT QUESTIONS IN SIGNAL TRANSDUCTION
Signal Transduction - Part 2 Key Concepts - Receptor tyrosine kinases control cell metabolism and proliferation Growth factor signaling through Ras Mutated cell signaling genes in cancer cells are called
More informationSupplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection.
Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection. Genes found to be significantly upregulated (FDR2) in Y strain
More informationSupplemental Table 1: List of genes contained on the custom Steroltalk v2 microarray prepared for this study
Supplemental Table 1: List of genes contained on the custom Steroltalk v2 microarray prepared for this study Gene GenBank No. Description Ch25h NM_009890 Cholesterol 25-hydroxylase Bile acid synthesis
More informationGeneration of post-germinal centre myeloma plasma B cell.
Generation of post-germinal centre myeloma. DNA DAMAGE CXCR4 Homing to Lytic lesion activation CD38 CD138 CD56 Phenotypic markers Naive Secondary lymphoid organ Multiple myeloma is a malignancy of s caused
More informationSarah Jaar Marah Al-Darawsheh
22 Sarah Jaar Marah Al-Darawsheh Faisal Mohammad Receptors can be membrane proteins (for water-soluble hormones/ligands) or intracellular (found in the cytosol or nucleus and bind to DNA, for lipid-soluble
More informationT cell Receptor. Chapter 9. Comparison of TCR αβ T cells
Chapter 9 The αβ TCR is similar in size and structure to an antibody Fab fragment T cell Receptor Kuby Figure 9-3 The αβ T cell receptor - Two chains - α and β - Two domains per chain - constant (C) domain
More informationSupplementary Figure 1.
Supplementary Figure 1. Increased expression of cell cycle pathway genes in insulin + Glut2 low cells of STZ-induced diabetic islets. A) random blood glucose measuers of STZ and vehicle treated MIP-GFP
More informationRegulation of Glucose Metabolism by Intracellular Compounds
Regulation of Metabolism by Intracellular ompounds Hexokinase ( ) -6- H ribose-5- or fructose-6- -6-phosphate () ( ) H -6-phosphate GI GM UD-glucose pyrophosphorylase 1-phosphate UD- hosphorylase synthase
More informationSupplementary Table 1. Candidate loci that were associated with diabetes- and/or obesity-related traits.
Supplementary Table 1. Candidate loci that were associated with diabetes- and/or obesity-related traits. All With Fst in the With long With SNP(s) at the 5' top 5% bracket haplotypes regulatory region
More informationChapter 10. Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002
Chapter 10 Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002 Chapter 10: Integration and Control of Metabolism Press the space bar or click the mouse
More informationSupplemental Table 1 Age and gender-specific cut-points used for MHO.
Supplemental Table 1 Age and gender-specific cut-points used for MHO. Age SBP (mmhg) DBP (mmhg) HDL-C (mmol/l) TG (mmol/l) FG (mmol/l) Boys 6-11 90th * 90th * 1.03 1.24 5.6 12 121 76 1.13 1.44 5.6 13 123
More informationImmunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells
Immunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells Andrew H. Lichtman, M.D. Ph.D. Department of Pathology Brigham and Women s Hospital and Harvard
More informationINTRODUCTORY BIOCHEMISTRY. BI 28 Second Midterm Examination April 3, 2007
INTRODUCTORY BIOCHEMISTRY BI 28 Second Midterm Examination April 3, 2007 Name SIS # Make sure that your name or SIS # is on every page. This is the only way we have of matching you with your exam after
More informationq 2017 by The University of Chicago. All rights reserved. DOI: /690105
q 2017 by The University of Chicago. All rights reserved. DOI: 10.1086/690105 Appendix from R. M. Cox et al., Hormonally Mediated Increases in Sex-Biased Gene Expression Accompany the Breakdown of Between-
More informationI tried to put as many questions as possible, but unfortunately only answers were found without the questions.
I tried to put as many questions as possible, but unfortunately only answers were found without the questions. These are some questions from doctor2015 med exam : 1. One of them isn t acute phase protein
More informationI tried to put as many questions as possible, but unfortunately only answers were found without the questions.
I tried to put as many questions as possible, but unfortunately only answers were found without the questions. These are some questions from doctor2015 med exam : 1. One of them isn t acute phase protein
More informationApplied Biosystems models 7500 (Fast block), 7900HT (Fast block), StepOnePlus, ViiA 7 (Fast block)
RT² Profiler PCR Array (96-Well Format and 384-Well [4 x 96] Format) Human HIV Infection and Host Response Cat. no. 330231 PAHS-051YA For pathway expression analysis Format Format A Format C Format D Format
More informationSupplementary Information
Scientific Reports Supplementary Information Upregulated expression of FGF13/FHF2 mediates resistance to platinum drugs in cervical cancer cells Tomoko Okada, Kazuhiro Murata, Ryoma Hirose, Chie Matsuda,
More informationACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT
ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS Choompone Sakonwasun, MD (Hons), FRCPT Types of Adaptive Immunity Types of T Cell-mediated Immune Reactions CTLs = cytotoxic T lymphocytes
More informationMultiple choice: Circle the best answer on this exam. There are 12 multiple choice questions, each question is worth 3 points.
CHEM 4420 Exam 4 Spring 2015 Dr. Stone Page 1 of 6 Name Use complete sentences when requested. There are 120 possible points on this exam. Therefore there are 20 bonus points. Multiple choice: Circle the
More informationEnergy storage in cells
Energy storage in cells Josef Fontana EC - 58 Overview of the lecture Introduction to the storage substances of human body Overview of storage compounds in the body Glycogen metabolism Structure of glycogen
More informationRevision. camp pathway
االله الرحمن الرحيم بسم Revision camp pathway camp pathway Revision camp pathway Adenylate cyclase Adenylate Cyclase enzyme Adenylate cyclase catalyses the formation of camp from ATP. Stimulation or inhibition
More informationMoh Tarek. Razi Kittaneh. Jaqen H ghar
14 Moh Tarek Razi Kittaneh Jaqen H ghar Naif Karadsheh Gluconeogenesis is making glucose from non-carbohydrates precursors. Although Gluconeogenesis looks like Glycolysis in many steps, it is not the simple
More informationRegulation of Metabolism
Regulation of Metabolism Pratt and Cornely Chapter 19 Regulation by Compartmentalization Form of reciprocal regulation Degradation vs biosynthesis Requires transporters 1 Specialization of organs Fuel
More informationPlasma membranes. Plasmodesmata between plant cells. Gap junctions between animal cells Cell junctions. Cell-cell recognition
Cell Communication Cell Signaling Cell-to-cell communication is essential for multicellular organisms Communicate by chemical messengers Animal and plant cells have cell junctions that directly connect
More informationCYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.
More information5.0 HORMONAL CONTROL OF CARBOHYDRATE METABOLISM
5.0 HORMONAL CONTROL OF CARBOHYDRATE METABOLISM Introduction: Variety of hormones and other molecules regulate the carbohydrates metabolism. Some of these have already been cited in previous sections.
More informationGlucose is the only source of energy in red blood cells. Under starvation conditions ketone bodies become a source of energy for the brain
Glycolysis 4 / The Text :- Some Points About Glucose Glucose is very soluble source of quick and ready energy. It is a relatively stable and easily transported. In mammals, the brain uses only glucose
More informationSALSA MLPA probemix P241-D2 MODY mix 1 Lot D As compared to version D1 (lot D1-0911), one reference probe has been replaced.
mix P241-D2 MODY mix 1 Lot D2-0413. As compared to version D1 (lot D1-0911), one reference has been replaced. Maturity-Onset Diabetes of the Young (MODY) is a distinct form of non insulin-dependent diabetes
More informationPRINT your Name Student (FAMILY, first name) Midterm 7:00 P.M.
PRINT your Name Student No. (FAMILY, first name) BIOCHEMISTRY 311A VERSION 1 (ONE) Midterm 7:00 P.M. Examiners: Dr. R. E. MacKenzie (69%) Dr. A. Storer (18%) Dr. W. Mushynski (13%) READ THE QUESTIONS CAREFULLY!!
More informationGlycogen Metabolism. BCH 340 lecture 9
Glycogen Metabolism BC 340 lecture 9 Structure of glycogen Glycogen is homopolysaccharide formed of branched D-glucose units The primary glycosidic bond is 1-4-linkage Each branch is made of 6-12 glucose
More informationMechanisms of Hormone Action
Mechanisms of Hormone Action General principles: 1. Signals act over different ranges. 2. Signals have different chemical natures. 3. The same signal can induce a different response in different cells.
More informationSupplementary figures
Supplementary figures Supplementary figure 1: Pathway enrichment for each comparison. The first column shows enrichment with differentially expressed genes between the diet groups at t = 0, the second
More informationGlycolysis. Intracellular location Rate limiting steps
Glycolysis Definition Fx Fate Site Intracellular location Rate limiting steps Regulation Consume ATP Subs level phosphoryla tion Key reactions control points Nb Oxidation of glucose to give pyruvate (
More informationCellular Signaling Pathways. Signaling Overview
Cellular Signaling Pathways Signaling Overview Signaling steps Synthesis and release of signaling molecules (ligands) by the signaling cell. Transport of the signal to the target cell Detection of the
More informationBiol220 Cell Signalling Cyclic AMP the classical secondary messenger
Biol220 Cell Signalling Cyclic AMP the classical secondary messenger The classical secondary messenger model of intracellular signalling A cell surface receptor binds the signal molecule (the primary
More informationSupplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
More informationChapter 20. Cell - Cell Signaling: Hormones and Receptors. Three general types of extracellular signaling. endocrine signaling. paracrine signaling
Chapter 20 Cell - Cell Signaling: Hormones and Receptors Three general types of extracellular signaling endocrine signaling paracrine signaling autocrine signaling Endocrine Signaling - signaling molecules
More informationPrinciples of Genetics and Molecular Biology
Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a
More informationMetabolism of cardiac muscle. Dr. Mamoun Ahram Cardiovascular system, 2013
Metabolism of cardiac muscle Dr. Mamoun Ahram Cardiovascular system, 2013 References This lecture Mark s Basic Medical Biochemistry, 4 th ed., p. 890-891 Hand-out Why is this topic important? Heart failure
More informationGLYCOLYSIS Generation of ATP from Metabolic Fuels
GLYCOLYSIS Generation of ATP from Metabolic Fuels - Catabolic process degradative pathway - Energy stored in sugars (carbohydrates) released to perform biological work - Transforms GLUCOSE to PYRUVATE
More informationMetabolic integration and Regulation
Metabolic integration and Regulation 109700: Graduate Biochemistry Trimester 2/2016 Assistant Prof. Dr. Panida Khunkaewla kpanida@sut.ac.th School of Chemistry Suranaree University of Technology 1 Overview
More informationEndocrine System Hormones
Endocrine System Hormones 2007-2008 Regulation Why are hormones needed? chemical messages from one body part to another communication needed to coordinate whole body homeostasis & regulation metabolism
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,
More informationSUPPLEMENTARY DATA. Assessment of cell survival (MTT) Assessment of early apoptosis and cell death
Overexpression of a functional calcium-sensing receptor dramatically increases osteolytic potential of MDA-MB-231 cells in a mouse model of bone metastasis through epiregulinmediated osteoprotegerin downregulation
More informationLecture 34. Carbohydrate Metabolism 2. Glycogen. Key Concepts. Biochemistry and regulation of glycogen degradation
Lecture 34 Carbohydrate Metabolism 2 Glycogen Key Concepts Overview of Glycogen Metabolism Biochemistry and regulation of glycogen degradation Biochemistry and regulation of glycogen synthesis What mechanisms
More informationSupplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR
Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very
More informationG-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D
G-Protein Signaling Introduction to intracellular signaling Dr. SARRAY Sameh, Ph.D Cell signaling Cells communicate via extracellular signaling molecules (Hormones, growth factors and neurotransmitters
More informationInnate Immunity. Chapter 3. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples. Antimicrobial peptide psoriasin
Chapter Know Differences and Provide Examples Innate Immunity kin and Epithelial Barriers Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive Immunity
More informationUNIVERSITY OF PNG SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY AND MOLECULAR BIOLOGY
1 UNIVERSITY OF PNG SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY AND MOLECULAR BIOLOGY GLUCOSE HOMEOSTASIS An Overview WHAT IS HOMEOSTASIS? Homeostasis
More informationFigure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.
Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets
More informationIn The Name Of God. In The Name Of. EMRI Modeling Group
In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement
More informationFatty acids synthesis
Fatty acids synthesis The synthesis start from Acetyl COA the first step requires ATP + reducing power NADPH! even though the oxidation and synthesis are different pathways but from chemical part of view
More informationCytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs
Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are
More informationSUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS
SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS No. Protein 1 serum albumin precursor gi 30794280 2 annexin A2 gi 27807289 3 Phosphatidylethanolamine-binding
More information2. What is molecular oxygen directly converted into? a. Carbon Dioxide b. Water c. Glucose d. None of the Above
Biochem 1 Mock Exam 3 Chapter 11: 1. What is glucose completely oxidized into? a. Carbon Dioxide and Water b. Carbon Dioxide and Oxygen c. Oxygen and Water d. Water and Glycogen 2. What is molecular oxygen
More informationCell Communication. Local and Long Distance Signaling
Cell Communication Cell to cell communication is essential for multicellular organisms Some universal mechanisms of cellular regulation providing more evidence for the evolutionary relatedness of all life
More informationDeveloping a clinically feasible personalized medicine approach to pediatric
Developing a clinically feasible personalized medicine approach to pediatric septic shock Hector R. Wong, Natalie Z. Cvijanovich, Nick Anas, Geoffrey L. Allen, Neal J. Thomas, Michael T. Bigham, Scott
More informationFunctional Cell-Based Assays
2017 Page 1/8 Axxam S.p.A. (Italy) offers functional cell-based assays for protein targets of relevance to drug discovery research, including challenging targets such as multi subunit ion channels and
More informationZaid sarhan. Osama Al-Ghafri ... Dr.nayef karadsheh
16 Zaid sarhan Osama Al-Ghafri... Dr.nayef karadsheh ALL THE FIGUERS IN THIS SHEET ARE VERY IMPORTANT AND USEFUL, PLEASE DON T SKIP THEM. Glycogen phosphorylase kinase = GPK // glycogen phosphorylase=gp
More informationChapter 9. Cellular Signaling
Chapter 9 Cellular Signaling Cellular Messaging Page 215 Cells can signal to each other and interpret the signals they receive from other cells and the environment Signals are most often chemicals The
More informationBoth pathways start with Glucose as a substrate but they differ in the product.
Glycosis:may occur either with the presence or absence of -Glucose-.So with oxygen we have Aerobic glycolysis-, without the participation of oxygen Anaerobic glycolysis-(it occur in certain places) where
More informationPathogenesis of Diabetes Mellitus
Pathogenesis of Diabetes Mellitus Young-Bum Kim, Ph.D. Associate Professor of Medicine Harvard Medical School Definition of Diabetes Mellitus a group of metabolic diseases characterized by hyperglycemia
More informationnumber Done by Corrected by Doctor Nayef Karadsheh
number 13 Done by Asma Karameh Corrected by Saad hayek Doctor Nayef Karadsheh Gluconeogenesis This lecture covers gluconeogenesis with aspects of: 1) Introduction to glucose distribution through tissues.
More informationFetal-maternal alignment of regulatory T cells correlates with Interleukin 10 mediated Bcl-
Fetal-maternal alignment of regulatory T cells correlates with Interleukin 10 mediated Bcl- 2 upregulation in pregnancy B. Santner-Nanan, K. Straubinger, P. Hsu, G. Parnell, B. Tang, B. Xu, A. Makris,
More informationSUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences.
Supplementary Table 2. Antibodies used for Immunofluoresence. Antibody Dilution Source Goat anti-pdx1 1:100 R&D Systems Rabbit anti-hnf6 1:100 Santa Cruz Biotechnology Mouse anti-nkx6.1 1:200 Developmental
More informationSignal Transduction Cascades
Signal Transduction Cascades Contents of this page: Kinases & phosphatases Protein Kinase A (camp-dependent protein kinase) G-protein signal cascade Structure of G-proteins Small GTP-binding proteins,
More informationAhmad Ulnar. Faisal Nimri ... Dr.Faisal
24 Ahmad Ulnar Faisal Nimri... Dr.Faisal Fatty Acid Synthesis - Occurs mainly in the Liver (to store excess carbohydrates as triacylglycerols(fat)) and in lactating mammary glands (for the production of
More informationChapter 22. Before the class. 10 Steps of glycolysis. Outline. Can you tell the ten steps of glycolysis? Do you know how glucoses are
Chapter 22 Gluconeogenesis, Glycogen metabolism, and the Pentose Phosphate Pathway Reginald H. Garrett Charles M. Grisham 1 Before the class Can you tell the ten steps of glycolysis? Do you know how glucoses
More information3.D- Cell Communication
3.D- Cell Communication Big Idea 3: Living systems store, retrieve, transmit and respond to information essential to life processes. EU 3.A: Heritable information provides for continuity of life. EU 3.B:
More information