Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description: Representative 3D reconstruction of confocal Z-stack images of skin samples from Erg fl/+ mice, related to Figure 5: FITC-dextran was injected through the tail vein of Erg fl/+ mice to assess vascular permeaility. Movie shows extravasation of FITC-dextran (green) from lood vessels stained for isolectin B4 (IB4, purple) and (white). Type of file: VI Title of file for HTML: Supplementary Movie 2 Description: Representative 3D reconstruction of confocal Z-stack images of skin samples from Erg cec-het mice, related to Figure 5: FITC-dextran was injected through the tail vein of Erg cec-het mice to assess vascular permeaility. Movie shows extravasation of FITC-dextran (green) from lood vessels stained for isolectin B4 (IB4, purple) and (white). In vivo deletion of endothelial increases asal vascular permeaility in estalished vessels.
Counts a c MFNG LFNG d e f g h Isotype Erg fl/+ Erg cec-het i CD31-PC Supplementary Figure 1 regulates multiple Notch related proteins and overexpression is ale to normalize the expression of Dll4 and Jag1 in si-treated HUVEC (a) qpcr analysis of Notch effector and target gene expression following transfection of HUVEC with a 2 nd sirn targeting exon7 of (si#2) (n=3). qpcr analysis of () Notch1 and Notch4 expression and of (c) Manic Fringe (MFNG) and Lunatic Fringe (LFNG) gene expression in sictrl and si-treated HUVEC (n=4). (d) Western lot quantification of expression in sictrl and si-transfected HUVEC plated onto control BS or Dll4 (n=4). (e) qpcr analysis of mrn expression in sictrl and si-transfected HUVEC plated onto BS or Dll4 (n=4). (f) qpcr analysis of Dll4 and Jag1 gene expression following transfection of HUVEC with a 2 nd sirn targeting exon7 of (si#2) (n=3). (g) mrn expression of Dll4 and Jag1 in primary Erg cec-het mouse lung EC compared to control Erg fl/+. Hprt was used as the reference gene (n=6). (h) Flow cytometric analysis for the endothelial marker CD31 in positively selected isolated lung cells from Erg fl/+ and Erg cec-het mice (n=4). (i) qpcr analysis of Dll4 and Jag1 gene expression in sictrl and si HUVEC transfected with control pcdn or pcdn- plasmid (n=3). ll graphical data are mean ± s.e.m, *P < 0.05, **P < 0.01, ***P < 0.001, Student's t-test.
Erg iec-ko Erg iec-ko Erg iec-ko Erg iec-ko a ZOOM ZOOM Dll4 ZOOM -Dll4-IB4 ZOOM ZOOM Jag1 ZOOM -Jag1-IB4 c Dll4 -Dll4-IB4 d Jag1 -Jag1-IB4 V V V V Supplementary Figure 2 controls Dll4 and Jag1 expression in the remodelling plexus of the mouse retina Zoom of (a) Fig. 3a and () Fig. 3 showing and Dll4/Jag1 staining as individual channels and merged with isolectin B4 (IB4: red, : white, Dll4/Jag1: green). Representative low magnification images of (c) Dll4 and (d) Jag1 staining of postnatal day 6 retinal vessels in the stale plexus of and Erg iec-ko mice. Retinas are co-stained for (white) and isolectin B4 (IB4: red). Scale ar, 70 µm. rteries () and veins (V) are indicated.
Erg iec-ko a NICD NICD-IB4 Zoom (NICD) Zoom (NICD-IB4) V V Ratio NICD co-localised with IB4 / IB4 area 150 ** 100 50 0 Erg iec-ko Ratio NICD co-localised with IB4 / IB4 area 150 100 50 0 Capillaries ** Erg iec-ko NICD NICD-IB4 Erg iec-ko Ratio NICD pixel intensity/ IB4 area Ratio NICD pixel intensity/ IB4 area Ratio NICD pixel intensity/ IB4 area Ratio NICD pixel intensity/ IB4 area Central plexus Ratio NICD co-localised with IB4 / IB4 area rteries/veins 150 ** 100 50 0 Erg iec-ko Ratio NICD co-localised with IB4 / IB4 area 200 150 100 50 0 Erg iec-ko Supplementary Figure 3 differentially controls NICD levels in the angiogenic front versus vascular remodelling plexus of the mouse retina Representative images and quantification of NICD staining (green) of postnatal day 6 retinal vessels in the (a) stale plexus and () angiogenic front from and Erg iec-ko mice. Retinas are co-stained for isolectin B4 (IB4, red). Quantification represents the ratio etween the sum of pixel intensity and isolectin B4 area. Only NICD signal touching isolectin B4 signal was quantified (n=4 fields per mouse, n=3 mice per genotype). Scale ar, 70 µm. rteries () and veins (V) are indicated. rrowheads highlight tip cells at the angiogenic front. ll graphical data are mean ± s.e.m, **P < 0.01, Student's t-test.
Ratio Dll4 pixel intensity/ IB4 Ratio Jag1 pixel intensity/ IB4 Erg cec-het Erg cec-het a IB4 Dll4 Dll4-IB4 IB4 Jag1 Jag1-IB4 Erg fl/+ Erg fl/+ Supplementary Figure 4 In vivo deletion of downregulates Dll4 and upregulates Jagged 1 expression in estalished vessels Representative images and quantification of (a) Dll4 (green) and () Jag1 (green) staining of adult retina from 9 weeks-old Erg cec-het and Erg fl/+ mice (n=4). Retinas are co-stained for isolectin B4 (IB4, red). Scale ar, 70 μm. Quantification represents the ratio etween the sum of pixel intensity and isolectin B4 area (n=4). ll graphical data are mean ± s.e.m, *P < 0.05, **P < 0.01, ***P < 0.001, Student's t-test.
si sictrl a ptie2 DPI Merge Ctrl Tie2 sictrl si - + - + ng1 160kDa pkt (s473) 60kDa ng1 total kt 60kDa 55kDa 52kDa GPDH 38kDa Ctrl ng1 Supplementary Figure 5 ng1 induction of Tie2 phosphorylation at cell-cell contacts is still active in silenced cells (a) (green), phospho-tie2 (ptie2; white), DPI (lue) staining of control (sictrl) and -silenced (si) HUVEC treated in the present or asence of ng1 (250 ng/ml for 30min). Scale ar, 30 μm. () Representative western lot and quantification of Tie2 expression and kt phosphorylation (at serine 473) in extracts of sictrl and si HUVEC treated in the presence or asence of ng1 (n=4). kt activity represents the ratio of phospho-kt to total kt. Data are mean ± s.e.m, *P < 0.05, **P < 0.01, ***P < 0.001, Student's t-test.
-16k -12k int3 +14k 41,207,300 41,207,700 41,210,000 41,211,500 41,222,800 41,223,300 41,232,000 41,234,500 41,210,000 41,215,000 41,220,000 41,225,000 41,230,000 41,230,000 Conservation H3K27c H3K4me1 DNse I hyper Supplementary Figure 6 ound genomic regions at the Dll4 locus Conserved DN inding motifs (grey ars) within the putative enhancers in the distal landscape surrounding the Dll4 locus. ENCODE sequence conservation etween 100 verterates is shown across this region. ENCODE ChIP-seq data profiles for H3K27c, H3K4me1 and DNse I hypersensitivity in HUVEC indicate open chromatin and putative active enhancers. Numers aove gene tracks indicate genomic location.
a GPDH ng1 ng/ml 0 100 200 55kDa 52kDa 38kDa c d DPI alone Merge p-serine alone e β-catenin alone LY294002 kt inhiitor IV Supplementary Figure 7 ng1 upregulates expression in vitro (a) qpcr and () western lot analysis of expression in extracts of control and -deficient cells treated with ng1 at 0, 100, 200 ng/ml for 6 h (n=3). (c) qpcr analysis of expression in extracts of skin samples from control Erg fl/+ mice treated with intradermal injection of PBS or ng1 (50 ng) for 1h (n=3). (d) Proximity ligation assay (PL) analysis using rait anti-, mouse anti-phospho-serine or mouse anti-β-catenin antiodies alone as controls. Scale ar, 20 µm. (e) Luciferase activity was measured in HUVEC co-transfected with an empty vector control or cdn expression plasmid (pcdn-) and the pgl4-dll4 luciferase construct and treated in the presence or asence of LY294002 or kt inhiitor IV (n=4). ll graphical data are mean ± s.e.m, *P < 0.05, **P < 0.01, ***P < 0.001, Student's t-test.
a β-catenin GPDH sictrl si - + - + LiCl 92kDa 55kDa 52kDa 38kDa Relative -catenin protein expression fold change 2.0 1.5 1.0 0.5 0.0 NS ** * * - + - + LiCl sictrl si - Supplementary Figure 8 Stailisation of β-catenin y LiCl treatment in deficient EC has no effect of Dll4 expression (a) Western lot analysis and quantification of β-catenin expression in LiCl treated sictrl and si HUVEC (n=3). () qpcr analysis of Dll4 expression in LiCl treated sictrl and si HUVEC (n=3). Data are mean ± s.e.m, *P < 0.05, **P < 0.01, ***P < 0.001, Student's t-test.
Relative gene expression fold change 50 40 30 20 10 1.5 1.0 0.5 0.0 ns * - + - + DPT pcdn -pcdn Supplementary Figure 9 Confirmation of overexpression in HUVEC transfected with pcdn- expression plasmid mrn expression in HUVEC transfected with control pcdn or pcdn- plasmid and treated in the presence or asence of the γ-secretase inhiitor DPT (n=3). Data are mean ± s.e.m, *P < 0.05, **P < 0.01, ***P < 0.001, Student's t-test.
Supplementary Figure 10 Uncropped Western lotting images for figures
Supplementary Tale 1 Oligonucleotides used in this study Primers DLL4 (human) Dll4 (mouse) Dll4 (human) promoter (cloning) DLL4-16 enhancer (ChIP) DLL4-12 enhancer (ChIP) DLL4 R1 promoter (ChIP) DLL4 int3 enhancer (ChIP) DLL4 +14 enhancer (ChIP) DLL4 Ctrl exon 11 (ChIP) (human) (mouse) GPDH (human) HES1 (human) HEY1 (human) Hprt (mouse) JG1 (human) Jag1 (mouse) JG1 R1 JG1 R2 JG1 R3 JG1 Ctrl 3 UTR Oligonucleotide Sequences Forward 5 - CTGGCCGCGCTGTGGGTG -3 Reverse 5 - GGCGCCCCGGGGCTC -3 Forward 5 - TTTGCTCTCCCGGGCTCT -3 Reverse 5 - GGCTCCTGCCTTTCCTCT -3 Forward (Nhe1) 5 -CGTGCTGCGGGCCGCCTCTTCC-3 Reverse (Hind III) 5 -CGTGCTTCGCCGCTCTGCCTG-3 Forward 5 - TCTTCGCTCGGCCCT -3 Reverse 5 - TGTGCCCTGCGCTGTTT -3 Forward 5 - TCCCCGCCCTCTTGGT -3 Reverse 5 - GCGGCTCCGCGTTTC -3 Forward 5 - GGGCCGGGCCGG -3 Reverse 5 - CTGTCTTCCTGGGGCTGC -3 Forward 5 - GTTTCCTGCGGGTTTTTTT -3 Reverse 5 - CTTTCCGGGCGGT -3 Forward 5 - GGGGTTGTGCGGGG -3 Reverse 5 - TTTTCCCTCCCCCTGCC -3 Forward 5 - CTCGGGCGTGTGTTGG -3 Reverse 5 - CTCGGGTTGTGGGTGGG -3 Forward 5 - GGGTGGGCGGTGG -3 Reverse 5 - GGTGTCGGCGTTGTGC -3 Forward 5 - CCGGTCTGTGGGGTGG -3 Reverse 5 - TCTGCGCTCTTTGTGGTC -3 Forward 5 - CGGTCTCCTGCCTTTG -3 Reverse 5 - GGGCCTCCCGTCTTCTG -3 Forward 5 - TTCCTCGTCCCCGGTGGCT -3 Reverse 5 - CTTGGTGCCGCGGCTTCTT -3 Forward 5 - TCGGCTCTGGTTCCTGTCCCC -3 Reverse 5 - GCTTGCGTCCCTGCTTCTC -3 Forward 5 - GTTGCGTCGCCCCTG -3 Reverse 5 - TCGGGCTTCCCCC -3 Forward 5 - GTTTCGCCTGGCCGGGTCC -3 Reverse 5 - GTGGGCCGCCCGTGTTCT -3 Forward 5 - CTGCTTGTGGGGGTCCT -3 Reverse 5 - GCGCTGTCTCCTTCGC -3 Forward 5 - GGCCGCCCTCTCTGT -3 Reverse 5 - GCCGCGGTCCTGC -3 Forward 5 - GGGTGGGGGTGGGTG -3 Reverse 5 - GTGCCCCCTTGGCC -3 Forward 5 - CTCCTGGCGGTTCCTTG -3 Reverse 5 - CGGCTGCCCCTTCC -3 Forward 5 - CCTGCGGGGTGGGG -3 Reverse 5 - GGGTCGGCTCCCCT -3
Primers LFNG (human) MNFG (human) NOTCH1 (human) NOTCH4 (human) NRRP (human) Oligonucleotide Sequences Forward 5 - GCCCGGGTGCGTT-3 Reverse 5 - CCGGCGTTTGTGTGCC -3 Forward 5 - CGGTGCGGTCCCC -3 Reverse 5 - GTCGCTCGCGCCTCT -3 Forward 5 - CCTCCCCTCTGCGG -3 Reverse 5 - GCTCTCTCTGGGCGG -3 Forward 5 - CTGCGTGGCGCTCGCC -3 Reverse 5 - CTGGCCCCCCGTCTGCTTG -3 Forward 5 - GCGCTGCCCGTCGGTCT -3 Reverse 5 - GCCGCGTCTTCGCCTTGGT -3