nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering Toru Komatsu, Igor Kukelyansky, J Michael McCaffery, Tasuku Ueno, Lidenys C Varela & Takanari Inoue Supplementary figures and text: Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3 Supplementary Figure 4 Supplementary Figure 5 Supplementary Figure 6 Supplementary Figure 7 Supplementary Figure 8 Supplementary Figure 9 Supplementary Table 1 Organelle targeting motifs. Colocalization analysis of the anchor units with orthogonal organelle markers. Kinetic analysis of organelle targeted translocation. Quantification of the expression level of the dimerizer constructs. Visualizing ERK phosphorylation by immunohistochemistry. Effect of rapamycin analogs on the Ras-MAPK signaling pathway. TEM images of membrane junction sites created by inducible ER-mitochondria connection. Confocal fluorescence images of NBD-labeled phosphatidylserine upon induction of synthetic ER-mitochondria tethering. Confocal fluorescence images of HeLa cells showing hetero-organelle interactions upon irap addition. A list of PCR primers used in the study. Note: Supplementary Videos 1 6 are available on the Nature Methods website.
Supplementary Figure 1 a Giantin SARS Corona virus M protein Glucosylceramide transferase Galactosyl transferase b Organelle Targeting motif Golgi Giantin (3131-3259) Mitochondria Tom20 (1-33), Monoamine Oxidase A (490-527) ER Cytochrome b5 (100-134) Lysosome Lysosomal-associated membrane protein 1 (1-417)
Supplementary Figure 1 Organelle targeting motifs. (a) Confocal fluorescence images of HeLa cells showing the localization of Golgi targeting motifs. Giantin retains normal Golgi morphology as well as proper localization. Scale bar indicates 20 μm. (b) Targeting motifs used in the present study to recruit proteins to mitochondria, ER, lysosome and Golgi.
Supplementary Figure 2 mitochondria Tom20 CR YFP Mito Merge mitochondria CR MoA YFP Mito Merge lysosome LAMP CR Lysotracker Merge ER CR Cb5 YFP ER Merge Golgi CFP Golgi FY Giantin Merge
Supplementary Figure 2 Colocalization analysis of the anchor units with orthogonal organelle markers. Overlapped regions between CFP and YFP signals exhibit yellow color in the merged images presented on the right. Tom20 CFP FRB (Tom20 CR), CFP FRB MoA (CR MoA), LAMP CFP FRB (LAMP CR), CFP FRB Cb5 (CR Cb5), FKBP YFP Giantin (FY Giantin). Scale bar indicates 20 μm.
Supplementary Figure 3 irap 1.0 mitochondria Translocation index (Normalized) lysosome Golgi ER ER-mitochondria 0 1 min
Supplementary Figure 3 Kinetic analysis of organelle targeted translocation. Normalized fluorescence intensity of effector units in the cytoplasm (for mitochondria (green), lysosome (yellow) and ER (blue)) or at the specific organelle (for Golgi (red)) were plotted as the dimerization event was induced with 5 μm irap at 60 th second. CFP FKBP and FRB MoA, YFP FKBP and LAMP CFP FRB, YFP FRB and CFP FKBP Cb5, and CFP FKBP and FRB YFP Giantin were used for each assay. In the case for Golgi, the normalized fluorescence intensity was inverted to better compare with the other conditions. For ER mitochondria tethering, normalized fluorescence intensity of CFP FKBP Cb5 at the ER mitochondria junction sites were plotted (black). Error bars are SEM (n 3). Single exponential fitting provided the following time constants: 14.1 ± 3.6 s (mitochondria), 27.4 ± 2.1 s (lysosome), 92.7 ± 18.7 s (ER), 23.5 ± 4.9 s (Golgi), 52.6 ± 10.0 s (ER mitochondria tethering). The translocation kinetics is underestimated due a difficult separation of the fluorescence signal between the cytoplasm and the widespread, dynamic organelles, which is especially the case for ER targeted translocation.
Supplementary Figure 4 a 1 2 3 4 5 6 mtor + + + + CFP FKBP Cb5 Tom20 YFP FRB DMSO irap b + + mtor FRB YFP Giantin Tom20 YFP FRB DMSO irap
Supplementary Figure 4 Quantification of the expression level of the dimerizer constructs. The FKBP/FRB constructs were subject to western blot analysis for a quantification of their expression level. (a) Red: anti FRB antibody, Green: anti FKBP antibody. HeLa cells were transfected with Tom20 YFP FRB and CFP FKBP Cb5 (lane1,2), Tom20 YFP FRB alone (lane3), or YFP FKBP Cb5 alone (lane4) and treat with 5 mm irap (lane 1) or DMSO (0.1% final, lane 2 4) for 15 minutes prior to western blot analysis. The expression level of Tom20 YFP FRB in relation to endogenous mtor did not change between irap and DMSO treatment (13.4 ± 5.4 fold and 13.9 ± 7.1 fold, respectively, p = 0.48, n = 6). The expression level of CFP FKBP Cb5 in relation to mtor did not change either between irap and DMSO treatment (12.5 ± 6.0 fold, and 10.3 ± 7.0 fold, respectively, p = 0.41, n = 3). (b) Green: anti FRB antibody. HeLa cells expressing Tom20 YFP FRB (lane 5) or FRB YFP Giantin (lane 6) were treated with DMSO (0.1% final, lane 2 4) for 15 minutes prior to western blot analysis.
Supplementary Figure 5 a b c perk Ras at PM (Lyn FRB + CFP FKBP RasGEF) Ras at Golgi (FRB YFP Giantin + CFP FKBP RasGEF) EGF + EGF CFP perk CFP perk
Supplementary Figure 5 Visualizing ERK phosphorylation by immunohistochemistry. The HeLa cells expressing no exogenous proteins (a), Lyn FRB and CFP FKBP RasGEF (b) or FRB YFP Giantin and CFP FKBP RasGEF (c) were stimulated with or without 100 ng/ml EGF (a) or with 5 μm irap for 15 minutes (b,c). The cells were then subject to immunohistochemistry using anti phospho ERK antibody. EGF stimulation and irapinduced Ras activation at the plasma membrane induced ERK phosphorylation preferentially in the nucleus (a,b), whereas irap induced Ras activation at the Golgi led to accumulation of phospho ERK primarily at the Golgi (c). White dotted lines contours the cell periphery based on the corresponding bright field images. Scale bar indicates 20 μm.
Supplementary Figure 6 Nuclear phospho ERK (a.u.) 30 0 Control 0 min 15 min EGF EGF + Rapamycin EGF + irap
Supplementary Figure 6 Effect of rapamycin analogs on the Ras MAPK signaling pathway. The HeLa cells were stimulated with 100 ng/ml EGF for 15 minutes in the presence or absence of rapamycin (100nM) or irap (5 μm). The cells were then subject to immunohistochemistry using anti phospho ERK antibody. EGF stimulation induced ERK phosphorylation in the nucleus (22.0 ± 1.1 arbitrary unit (a.u.), n=15), the level of which was not affected by rapamycin (21.6 ± 1.8, p = 0.88, n = 15) or irap (19.8 ± 0.9, p = 0.28, n = 15).
Supplementary Figure 7 a c er b m b er
Supplementary Figure 7 TEM images of membrane junction sites created by inducible ER mitochondria connection. An inset image in (a) is enlarged in (b). Black arrow heads point to the well delineated junction sites. Separations between the two organelles was calculated to be 6.6 ± 1.4 nm (minimum: 4.66 nm, maximum: 9.22 nm, n = 200). (c) In contrast, untransfected, untreated cells exhibit a good separation between the two membranes (average distance: 93.0 ± 84.2 nm, minimum: 10.1 nm, maximum: 437.0 nm, n = 200). Scale bars indicate 500 nm (a) and 250 nm (b), (c).
Supplementary Figure 8 Tom20-YFP-FRB NBD-PS Merge +irap Tethering No tethering -irap
Supplementary Figure 8 Confocal fluorescence images of NBD labeled phosphatidylserine upon induction of synthetic ER mitochondria tethering. The HeLa cells expressing Tom20 YFP FRB and FKBP Cb5 were stained with NBD labeled PS (NBD PS). NBD PS was then visualized as ER and mitochondria became opposed to each other. The images represent before (top rows) or 15 minutes after 5 μm irap addition (middle and bottom rows). Middle rows are the cells that expressed Tom20 YFP FRB alone and thus did not induce membrane tethering event. Bottom rows are the cells that were doubly transfected and demonstrated ER mitochondria tethering. Note an accumulation of NBD PS at the junction sites in the merged image (indicated as yellow, N=3,38cells). The NBD fluorescence has a bleedthrough in the YFP channel, which, however, was a negligible extent compared to the robust YFP signal from Tom20 YFP FRB. Insets show a close up view. Scale bar indicates 20 μm.
Supplementary Figure 9 a CFP-Lyso YFP-ER Merge +irap -irap b CFP-ER YFP-Golgi Merge c CFP-Mito YFP-Lyso Merge +irap -irap -irap +irap
Supplementary Figure 9 Confocal fluorescence images of HeLa cells showing hetero organelle interactions upon irap addition. The cells were transfected with (a) YFP FKBP Cb5 (left panels), LAMP CFP FRB (middle panels), (b) CFP FKBP Cb5 (left panels) + FRB YFP Giantin (right panels) and (c) Tom20 CFP FRB (left panels), LAMP FKBP and YFP labeled lysosome marker (YFP Lyso, middle panels). Right panels show merged images (yellow) of CFP (green) and YFP (red) corresponding organelles. Among all the combinations of the anchor units we tested, only a few showed striking membrane tethering. This implies that the orientation of dimerization proteins has to be optimal to achieve efficient membrane membrane tethering. Insets show a close up view. Scale bar indicates 20 μm.
Supplementary Table Oligonucleotides used for the PCR Giantin Cytochrome b5 Tom20 Monoamine oxidase A LAMP RasGRF 5 ctccaactcgaggagaaccgcagcaaagcttttctgaag 3 GTAGCTGGATCCCTATAGATGGCCCGTAAAACACAGAATG 5 catatggaattcgagtgctggtggtatcaccaccgtggagtccaac 3 AGTTCAGGATCCCTAGTCCTCGGCCATGTACAG 5 catccggaattcgccaccatggtgggtcggaacagcg 3 GTAGCGGGATCCGAAGTTGGGGTCACTTCGTCTTTTG 5 catccggaattcgagtgctggtggtttctgggaaaggaacctgc cc 3 GTAGCGGGATCCTCAAGACCGTGGCAGGAGC 5 atcgttgaattcgccaccatggcggcccccgg 3 GTAGCTGGATCCGATAGTCTGGTAGCCTGCGTG 5 catgaattcttttgaaaaccactcagccctgga 3 ATTGGATCCTCAGGTGGGGAGTTTTGGTTCTAT