Supplementary Information

Similar documents
Effect of BI-1 on insulin resistance through regulation of CYP2E1

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Supplementary Information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Materials for

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

New Drug Development for Hepatic Insulin Resistance

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

Curriculum Vitae. Dissertation Title M.S. Thesis: Regulation of Notch1 signaling by Runx2 during osteoblast differentiation.

Doctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Supporting Information Table of content

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

SUPPLEMENTARY INFORMATION

Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance

2.5. AMPK activity

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Table. File Name: Peer Review File Description:

HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD

Supplemental Material:

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

2017 Obesity Fact Sheet

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

SUPPLEMENTARY INFORMATION

EGIS BILIARY STENT. 1. Features & Benefits 2. Ordering information 3. References

Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat

Supplementary Figure 1

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Hepatitis C Virus and Cytokine Responses

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Supplementary Figure 1 a

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

Supporting Information

Changes in the seroprevalence of IgG anti-hepatitis A virus between 2001 and 2013: experience at a single center in Korea

Mica Nanoparticle, STB-HO Eliminates the Human Breast Carcinoma Cells. by Regulating the Interaction of Tumor with its Immune Microenvironment

Trial of Everolimus-Eluting Stents or Bypass Surgery for Coronary Disease (BEST Trial)

Research Article Inhibitory Effects of 4-(4-Methylbenzamino)benzoate on Adipocyte Differentiation

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)

SUPPLEMENTARY INFORMATION

Supplementary Figure 1

University of Ulsan College of Medicine, Seoul 05505, Republic of Korea.

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171

Supplemental Information. Brown Adipogenic Reprogramming. Induced by a Small Molecule

ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)

Nature Medicine: doi: /nm.3922

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

Fig. S1. Validation of ChIP-seq binding sites by single gene ChIP-PCR Fig. S2. Transactivation potential of PPAR

KAHBPS-O-PL-01 KAHBPS-O-PL-02

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

Quality of life (QoL) in metastatic breast cancer patients with. maintenance paclitaxel plus gemcitabine (PG) chemotherapy:

Dipeptidyl Peptidase-4 Inhibitor Increases Vascular Leakage in Retina through VE-cadherin. Phosphorylation

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs

Supplementary Figures

Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization

Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]

3-Thia Fatty Acids A New Generation of Functional Lipids?

Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent

Supplementary material. Supplementary Figure legends

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments:

HVEM-deficient mice fed a high-fat diet are protected from adipose tissue inflammation and glucose intolerance

T H E J O U R N A L O F C E L L B I O L O G Y

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

SERUM CYSTATIN C CONCENTRATION IS A POWERFUL PROGNOSTIC INDICATOR IN PATIENTS WITH CIRRHOTIC ASCITES

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

Supplementary Figure S1

Supporting Information

SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of

Endothelial PGC 1 - α 1 mediates vascular dysfunction in diabetes

T H E J O U R N A L O F C E L L B I O L O G Y

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies

Impact of Aortic Stiffness on Further Cardiovascular Events in Patients with Chest Pain : A Invasive Study

Supplementary Figure 1

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

SUPPLEMENTARY FIGURES AND TABLE

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin

SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.

Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.

AOSpine Principles Symposium Daegu

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Hyun Kee Kim, M.S. Curriculum Vitae

1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8

Transcription:

Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,, Sang-Ha Baik, Yuri Choi, Bo Youn Choi, Bahn Gahee, Suji Kim, So-Mi Kwon, Jin Su Park, Seung Hyun Baek, Tae Joo Park, Keejung Yoon 6, Byung-Joon Kim, Mark P. Mattson 7, Sung-Joon Lee, Dong-Gyu Jo,, Kye Won Park, Department of Food Science and Biotechnology, Sungkyunkwan University, Korea. School of Pharmacy, Sungkyunkwan University, Korea. Department of Biotechnology, Graduate School of Life Sciences & Biotechnology, BK-PLUS program, Korea University, 6-7 Seoul Korea. Department of Internal Medicine, Graduate School of Medicine, Gachon University of Medicine and Science, School of Nano-Bioscience and Chemical Engineering, Ulsan National Institute of Science and Technology, 6 Department of Genetic Engineering, Sungkyunkwan University, Korea. 7 Laboratory of Neurosciences, National Institute on Aging Intramural Research Program, Baltimore, Maryland, USA # These authors contributed equally. Corresponding authors: Dong-Gyu Jo, PhD. School of Pharmacy, Sungkyunkwan University, Suwon -76, Korea. Phone: (+8)--9-778, jodg@skku.edu; Kye Won Park, PhD. Department of Food Science and Biotechnology Sungkyunkwan University, Suwon -76, Korea. Phone: (+8)--9-78, kwpark@skku.edu Supplementary Information: Figure S Figure S Figure S Figure S Figure S Figure S6 Figure S7 Figure S8 Original blots

A C Body weight (g) Insulin (pmol/l). 7 8. B C7 C7 D C7 (g/day) C7 HFD ND 6 7 8 (Weeks) Glucagon (pmol/l)..8. C7 Figure S. Body weight, food intake, insulin, and glucan levels in Notch insufficient mice. (A-C) Body weight (A), food intake (B), insulin (C), levels were not different in high fat diet fed (HFD) C7BL/6 mice (C7) and Notch antisense transgenic () mice. (D) Plasma glucagon level was decreased in mice (n= of each group). Statistically significant differences in the control normal chow fed C7BL/6 (C7-ND) and Notch antisense transgenic () mice or high fat diet fed C7BL/6 mice (C7-HFD) and high fat diet fed Notch antisense transgenic mice (-HFD) were determined using Student s t-test ( P <.).

Free fatty acid(ueq/l) 6 8 6 8 ND HFD ND HFD C7 Figure S. Serum free fatty acid levels from normal diet (ND) or high fat diet fed (HFD) C7BL/6 mice (C7) and Notch antisense transgenic () mice were determined. Statistically significant differences in the control normal chow fed C7BL/6 (C7-ND) and Notch antisense transgenic () mice or high fat diet fed C7BL/6 mice (C7-HFD) and high fat diet fed Notch antisense transgenic mice (-HFD) were determined using Student s t-test ( P <.).

A DAPT - + + - - DBZ - - - + + HES B 8 6 EN GVP reporter DMSO DAPT DBZ Figure S. Notch inhibitors decrease Notch activation. (A) Western blot analysis of HES from DAPT and DBZ treated HepG cells. HepG cells were treated with Notch signaling inhibitors DAPT or DBZ ( µm) and of HES was measured by western blot analysis. (B) HepG cells transfected with the CSL luciferase reporter (notchspecific reporter) and an vector coding for ΔEN (γ-secretase cleavage sites fused to GAL-VP6) were treated with DAPT or DBZ ( µm) and luciferase activity was measured. Data are expressed as the means ± SEM. Statistically significant differences in gene was determined relative to the control by the Student s t-test ( P <.).

Kda C7 Acc Figure S. Western blot analysis of Acc protein in livers from control (C7) and Notch antisense transgenic () mice. Hepatic Acc protein levels were not different in high fat diet fed control and mice.

A Kda C7 Notch Normalized mrna Normalized mrna B... Pparα Acsl C7 mice Cpta Ucp P=.8 Figure S. Notch deficient mice induce of oxidative genes in epididymal white adipose tissues. (A) Reduced Notch in epididymal white adipose tissues from high fat diet fed C7BL/6 mice (C7) and Notch antisense transgenic () mice. Notch protein was measured by immunoblotting. (B) Oxidative genes including Pparα, Acsl, Cpta, and Ucp in epididymal fats of HFD control (C7BL/6) and mice were measured by real time PCR (n= of each group). Data shown represent the mean ± SEM. Statistically significant differences in gene was determined relative to the control (C7BL/6) mice by the Student s t- test ( P <.).

Normalized mrna Acot Nicd Acot Acsl Acsl Ucp Nicd Acox Acox Pparα Ucp Pparα pbp NICD pbp NICD pbp NICD pbp NICD pbp NICD pbp NICD T-L CHT/ T-L CHT/ T-L CHT/ Figure S6. Notch gain of function suppressed the of oxidative genes in preadipocytes. T-L and CHT/ preadipocytes were infected with retrovirus expressing NICD (pbp-nicd ) or virus harboring pbabe-puro (pbp) empty vector and stable cells were selected with puromycin ( µg/ml) for weeks. Gene in stable preadipocytes was measured by real time PCR. Data were expressed as mean ± SEM. Statistically significant differences in gene was determined relative to the control by the Student s t-test (p <.; p <.; p <.).

Normalized mrna C A Lipid accumulation pbp Fabp... pbp pbp-nicd 6 (day) CHT/ pbp- NICD (CHT/) Normalized mrna 8 6 Pparγ Cd6 6 (day) Normalized mrna B D Lipid accumulation pbp Fabp.. T-L pbp pbp-nicd 6 (day) Normalized mrna 6 pbp- NICD (T-L) Pparγ Cd6 6 (day) pbp pbp-nicd pbp pbp-nicd Song et al., Fig S7

Figure S7. Notch gain of function increases lipid accumulation and induces of adipocyte markers during adipocyte differentiation of CHT/ and T-L cells. (A) CHT/ cells were infected pbabe-puro (pbp) or pbabe-nicd harboring retrovirus (pbp-nicd) and stable cells were selected with puromycin ( µg/ml) for week. Stable cells were induced into adipocytes and lipid accumulation on day 6 was assessed by Oil red O staining. (B) T- L cells were infected with pbabe-puro (pbp) or pbabe-nicd harboring retrovirus (pbp-nicd) and stable cells were selected with puromycin ( µg/ml) for week followed by adipocyte differentiation for 6 days. Stable cells were induced into adipocytes and lipid accumulation on day 6 was assessed by Oil red O staining. Gene was measured by real time PCR. (C,D) Stable cells were induced into adipocytes and lipid accumulation on day 6 was assessed by Oil red O staining followed quantification. Lipid accumulation was quantified by measuring the extracted Oil red O dye at nm. Data are expressed as the means ± SEM. Statistically significant differences in gene was determined relative to the control by the Student s t-test ( P <.; P <.; P <.).

Normalized mrna 6 Nicd ctrl NICD 8 Pparα Acsl Acot Acox 6 ctrl NICD ctrl NICD ctrl NICD ctrl NICD Figure S8. Notch gain of function suppressed the of oxidative genes in mature adipocytes. CHT/ preadipocytes were differentiated into mature adipocytes for 8 days and infected with lentivirus expressing NICD (NICD) or control plasmid. Gene in NICD and control cells was measured by real time PCR. Data were expressed as mean ± SEM. Statistically significant differences in gene was determined relative to the control by the Student s t-test (p <.).

Original blots Notch Fig. B p-irs- Fig. F Notch Fig. 6C p-akt Notch Fig A Akt