Supplemental Data. Prolonged Rapamycin Treatment Inhibits mtorc2 Assembly and Akt/PKB. Supplemental Experimental Procedures

Similar documents
Supplementary Material

Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3

Supplementary Materials for

Kinex Reverse Lysate Microarray KRLM-1.0. Case Study

Human cell line list Production of Exosome Standards - Cell Lysates

Figure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h

SUPPLEMENTARY INFORMATION

Supplementary Figure S1 Supplementary Figure S2

T H E J O U R N A L O F C E L L B I O L O G Y

Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or

Necroptosis-Inducing Rhenium(V) Oxo Complexes

America, Hershey, PA Australia, Melbourne, VIC Europe, Munich

DEPTOR Is an mtor Inhibitor Frequently Overexpressed in Multiple Myeloma Cells and Required for Their Survival

ProteoScan Cancer Lysate Arrays. QC and Validation Data

SOMAPLEX REVERSE PHASE PROTEIN MICROARRAY HUMAN KIDNEY TUMOR & NORMAL TISSUE

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

SUPPLEMENTAL FIGURE LEGENDS

Supplemental Table 1. Biochemical and Cellular Potency and Selectivity of PF

20X Buffer (Tube1) 96-well microplate (12 strips) 1

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

RayBio KinaseSTAR TM Akt Activity Assay Kit

B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer

K-LISA mtor Activity Kit Cat. No. CBA055

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

HA-Sin1-N (aa 1-137), HA-Sin1-CRIM (aa ) and HA-Sin1-RBD (aa ) were constructed by

CANCER THERAPEUTICS: A NOVEL APPROACH

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

mtor complex 1 regulates lipin 1 localization to control the SREBP pathway

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were

A Rictor-Myo1c Complex Participates in Dynamic Cortical Actin Events in 3T3-L1 Adipocytes

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.

The nuclear import of ribosomal proteins is regulated by mtor

Supplementary Materials for

Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from

SUPPLEMENTARY INFORMATION

SHN-1 Human Digestive Panel Test results

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

supplementary information

(PDGF), 9 ( -2 (FGF-2), SMO

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supporting Information

Co-Development of DELFIA Technology. - Assessment of DELFIA technology in drug biodistribution in small animals

Supplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression

Lipoprotein Lipase Activity Assay Kit (Fluorometric)

Cancer preventive effects of lactic acid bacteria

The mir-199a/brm/egr1 axis is a determinant of anchorage-independent growth in epithelial tumor cell lines

Species Tumor Type Comment for in vivo work Lead Time for in vivo studies [weeks] MB-49-luc-2 Mouse urinary bladder carcinoma C57BL/6 2

Hunk is required for HER2/neu-induced mammary tumorigenesis

Mitochondrial Trifunctional Protein (TFP) Protein Quantity Microplate Assay Kit

TITLE: Chemoprevention of Prostate Cancer by Naturally Occurring and Synthetic Organoselenium Compounds. Medical Center Hershey, PA 17033

BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information)

Supplementary Materials for

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Targeting of the MUC1-C Oncoprotein in Colitis-Associated Colorectal Cancer

Effec<ve Use of PI3K and MEK Inhibitors to Treat Mutant K Ras G12D and PIK3CA H1047R Murine Lung Cancers

Atg5 flox/flox ; CAG-Cre, 19M brain heart lung. spleen stomach colon. Takamura_Fig. S1

Efficient Liver Targeting and Uptake by Novel Tenofovir Prodrug, CMX157, For the Treatment of Hepatitis B

SUPPLEMENTARY INFORMATION

Supplementary Figure 1

A Tumor Suppressor Complex with GAP Activity for the Rag GTPases That Signal Amino Acid Sufficiency to mtorc1

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

Plasma exposure levels from individual mice 4 hours post IP administration at the

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as

Supplementary Figure 1

HansaBioMed Catalog 2014 for Exosome Research. X. Human Cell Lines...

Supplementary Figure 1

La farmacologia dei CDK4/6 inibitori

Cancer Prevention and Research Institute of Texas. November 2017

mtor plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions

TITLE: A Genetic Approach to Define the Importance of Rheb in Tuberous Sclerosis

Simplify the relations between genes and diseases into typed binary relations. PubMed BioText GoPubMed

Luciferase (Firefly and Renilla) Expression Stable Cell Lines

SUPPLEMENTARY FIGURES AND TABLE

Insulin Stimulates Adipogenesis through the Akt-TSC2- mtorc1 Pathway

Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments:

Supplementary Information Titles Journal: Nature Medicine

ab Membrane Fractionation Kit Instructions for Use For the rapid and simple separation of membrane, cytosolic and nuclear cellular fractions.

ABSTRACT INTRODUCTION. Ulises D. Orlando 1,*, Ana F. Castillo 1,*, Melina A. Dattilo 1, Angela R. Solano 1, Paula M. Maloberti 1, Ernesto J.

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

p38g and d promote heart hypertrophy by targeting the mtor-inhibitory protein DEPTOR for degradation

The IKK-related kinase TBK1 activates mtorc1 directly in response to growth factors and innate immune agonists

OxiSelect MDA Adduct ELISA Kit

A protocol for enhancement of the AAV-mediated expression of transgenes

Supporting Information

supplementary information

( )-Englerin A as a novel potent activator of TRPC4 and TRPC5 channels

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

Appendix. Table of Contents

SUPPLEMENTARY INFORMATION

Mammalian target of rapamycin (mtor) is a central regulator

Figure S1, related to Figure 1. Escaper p38a-expressing cancer cells repopulate the tumors (A) Scheme of the mt/mg reporter that expresses a

Interrogating mtor Inhibition in Patients with HRPC

HHS Public Access Author manuscript Nat Cell Biol. Author manuscript; available in PMC 2011 September 01.

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Transcription:

Supplemental Data Prolonged Rapamycin Treatment Inhibits mtorc2 Assembly and Akt/PKB Dos D. Sarbassov, Siraj M. Ali, Shomit Sengupta, Joon-Ho Sheen, Peggy P. Hsu, Alex F. Bagley, Andrew L. Markhard, and David M. Sabatini Supplemental Experimental Procedures Rapamycin Treatment of Mice and Organ Harvest Rapamycin (1 mg) was dissolved in 20 µl of ethanol, which was then diluted with Ringer s saline solution to a final concentration of 1 mg/ml directly before use. Three-month-old male C57BL/6NTac (Taconic) mice were administered daily intraperitioneal injections of 10 mg/kg rapamycin or the drug vehicle for 7 days. Mice were then euthanized with C0 2, and organs were harvested into RIPA buffer and homogenized with mechanical disruption followed by sonication. Lysates from vehicle- and rapamycin-treated organ pairs were normalized for protein content and analyzed by immunoblotting. The vehicle- and rapamycin-treated mice ate similar amounts during the 7 day treatment period and at necropsy all mice had evidence of processed food in their stomachs and small intestines. Control experiments using phospho-s6 as a marker of the effectiveness of rapamycin reveals that the drug penetrates all major tissues. The experiment was repeated twice with similar results.

Figure S1. Prolonged In Vitro Incubation of mtorc1 and mtorc2 with Rapamycin Leads to Disruption of the Raptor-mTOR but Not Rictor-mTOR Interaction A HeLa cell lysate was prepared with a CHAPS-based lysis buffer and divided into three equal portions. One was incubated with 100 nm rapamycin for 1 hr, another with rapamycin for 24 hr, and the third with the drug vehicle for 1 hr. mtor immunoprecipitates were then prepared and analyzed by immunoblotting for the levels of mtor, rictor, and raptor.

Figure S2. Rapamycin Inhibits Akt/PKB Phosphorylation In Vivo Mice were treated for 1 week with daily intraperitoneal injections of rapamycin or the drug vehicle. Tissues were harvested as described in the Experimental Procedures, and Akt/PKB S473 phosphorylation and protein levels were monitored by immunoblotting. Reminiscent of the behavior of many cell lines (Figure 2), several tissues, notably the stomach and liver, showed rapamycin-induced increases in Akt/PKB phosphorylation.

Figure S3. PTEN Loss Is Neither Necessary nor Sufficient to Confer Rapamycin-Sensitive Akt/PKB Phosphorylation to a Cell Line (A) PTEN-null Jurkat cells having a doxycycline-inducible PTEN were cultured for 24 hr (left) or 1 week (right) in the indicated concentrations of doxycyline. The cells were then treated with 100 nm rapamycin for the indicated times and analyzed by immunoblotting for the levels of phospho-s473 Akt/PKB, Akt/PKB, and PTEN. (B) Parental DLD1 cells, DLD1 cells having a stably integrated vector (vector control DLD1), and DLD1 cells null for PTEN were treated with 100 nm rapamycin for the indicated times and analyzed by immunoblotting for the levels of phospho-s473 Akt/PKB, Akt/PKB, and PTEN. DLD1 cells are in the class of cells that increase Akt/PKB phosphorylation with rapamycin treatment.

Figure S4. Stable Overexpression of FKBP12 Does Not Confer Rapamycin-Sensitive Akt/PKB Phosphorylation HEK-293T or HeLa cells stably expressing myc-fkbp12 or transduced with the empty vector were treated with 100 nm rapamycin or drug vehicle for 24 hours and analyzed by immunoblotting for the indicated proteins and phosphorylation states.

Supplemental Table S1. Effect of 24 hr rapamycin treatment on Akt/PKB phosphorylation Tissue of Origin/Cancer Type Cell Line Name Strong Inhibition Partial Inhibition None or Increase PTEN Status* Species Lymphoma/Leukemia Jurkat null human BJAB null human SKW3 human U937 null human WEHI mouse K562 null human Breast Cancer MDA-MB-231 human MDA-MB-468 null human Multiple Myeloma OPM2 null human 47 null human Prostate Cancer PC3 null human LNCaP null human Colorectal Cancer HT29 human CACO2 human SW480 human Endometrial Cancer Ishikawa null human Cervical Cancer HeLa S3 human HeLa human Osteosarcoma U2OS human Hepatic Cancer HepG2 human Melanoma/Epithelial UACC-903 null human Mel-STRG human A375 human HMLE human Rhabdomyosarcoma Kym-1 human Rd88SC.10 human rh30 human Glioblastoma u87 null human 827 null human Lung Cancer A549 human H460 human Renal Carcinoma 786-0 null human Kidney transformed HEK-293T human Fibroblasts MEFs (p53 -/-) wild-type mouse BJ Fibroblasts wild-type human Skeletal Muscle c2c12 myoblasts wild-type mouse Smooth Muscle Cells rsmc (primary) wild-type rat Endothelial Cells HUVEC (primary) wild-type human Adipocytes 3t3L1 differentiated wild-type mouse * PTEN status is only noted if evidence is available from the literature. Blank boxes indicate that the status is unknown to us.

Table S1. Survey of 33 Cancer/Transformed and Six Primary Cell Lines for Rapamycin Sensitivity of Akt/PKB Phosphorylation Cells were treated with 100 nm rapamycin for 24 hours and processed as in Figure 2. PTEN status was determined from the literature and is indicated only where status is certain. Empty boxes indicate that PTEN status is unknown to us. Using immunoblotting for PTEN we confirmed unpublished references found on the internet that claim that BJAB cells are null for PTEN.