Dissecting gene regulation network in human early embryos. at single-cell and single-base resolution

Similar documents
Single-cell RNA-Seq profiling of human pre-implantation embryos and embryonic stem cells

Results. Abstract. Introduc4on. Conclusions. Methods. Funding

Allelic reprogramming of the histone modification H3K4me3 in early mammalian development

Research programs involving human early embryos

Genetics and Genomics in Medicine Chapter 6 Questions

Lecture 27. Epigenetic regulation of gene expression during development

Embryogenesis begins during oogenesis

Name: Xueming Zhao. Professional Title: Professor. Animal embryo biotechnology, mainly including in vitro maturation (IVM), in vitro fertilization

An epigenetic approach to understanding (and predicting?) environmental effects on gene expression

SUPPLEMENTARY INFORMATION

Epigenetics DNA methylation. Biosciences 741: Genomics Fall, 2013 Week 13. DNA Methylation

Programming and Inheritance of Parental DNA Methylomes in Mammals

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq

DNA methylation Dots(+) CxxC EGFP DAP

Single-cell RNA-Seq profiling of human preimplantation embryos and embryonic stem cells

Oxidative stress in sperm affects the epigenetic reprogramming in early embryonic development

Today. Genomic Imprinting & X-Inactivation

Changes in histone methylation during human oocyte maturation and IVF- or ICSI-derived embryo development

Tet3 and DNA Replication Mediate Demethylation of Both the Maternal and Paternal Genomes in Mouse Zygotes

Supplementary Information

Imprinting. Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821

Nuclear reprogramming of sperm and somatic nuclei in eggs and oocytes

Increase your chance of IVF Success. PGT-A Preimplantation Genetic Testing for Aneuploidy (PGS 2.0)

Strategic delivery: Setting standards Increasing and. Details: Output: Demonstrating efficiency. informing choice.

MALBAC Technology and Its Application in Non-invasive Chromosome Screening (NICS)

Telomeres and Genomic Instability In Preimplanation Embryos. David L. Keefe, M.D.

Clinical Genomics. Ina E. Amarillo, PhD FACMGG

Epigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation

Foundational questions Oocyte-derived functional mediators of early embryonic development (EST and candidate gene) JY-1 Nobox Importin 8 Oocyte and cu

Methylation reprogramming dynamics and defects in gametogenesis and embryogenesis: implications for reproductive medicine

Selective impairment of methylation maintenance is the major cause of DNA methylation reprogramming in the early embryo

Biology Developmental Biology Spring Quarter Midterm 1 Version A

Epigenetics and inheritance of phenotype variation in livestock

Targeted qpcr. Debate on PGS Technology: Targeted vs. Whole genome approach. Discolsure Stake shareholder of GENETYX S.R.L

Epigenetics: A historical overview Dr. Robin Holliday

oocytes were pooled for RT-PCR analysis. The number of PCR cycles was 35. Two

Tet3 and DNA Replication Mediate Demethylation of Both the Maternal and Paternal Genomes in Mouse Zygotes

Rejuvenation of Gamete Cells; Past, Present and Future

Transcriptional repression of Xi

Fragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype

DRB666 Applied Developmental and Reproductive Biology Spring Semester, 2018

Session 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology

Dynamic CpG island methylation landscape in oocytes and preimplantation embryos

Non-invasive methods of embryo selection

DNA methylation & demethylation

Genetics and Genomics in Medicine Chapter 6. Questions & Answers

Epigenetics: Basic Principals and role in health and disease

Joanna Hillman Michael Higgins Lab Oncology for Scientists I 10/29/2015

Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3

Large conserved domains of low DNA methylation maintained by Dnmt3a

Ontogeny of CpG island methylation and specificity of DNMT3 methyltransferases during embryonic development in the mouse

Telomeres in human oocytes. contribution to chromosome (in)stability?

RESEARCHER S NAME: Làszlò Tora RESEARCHER S ORGANISATION: Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC)

Transferring Fragments of Paternal Metabolism to the Offspring. Erica D. Watson 1,* UK, CB2 3EG. *Correspondence:

Methylation Dynamics in the Early Mammalian Embryo: Implications of Genome Reprogramming Defects for Development

Article Pre-embryonic diagnosis for Sandhoff disease

DRB666 Applied Developmental and Reproductive Biology (Spring 2013)

CHAIRE ÉPIGÉNÉTIQUE ET MÉMOIRE CELLULAIRE. Année : Reprogrammations développementales, induites et pathologiques

DPPA3 prevents cytosine hydroxymethylation of the maternal pronucleus and is required for normal development in bovine embryos

Transgenerational Epigenetic Inheritance

Animal Development. Lecture 3. Germ Cells and Sex

Oocyte and Sperm from ipscs

DRB666 Applied Developmental and Reproductive Biology Spring Semester, 2011

BIOLOGY

King s Research Portal

GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG

Role of Tet1 in genomic imprinting erasure

Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment

Ellen Anckaert, Sergio Romero, Tom Adriaenssens, Johan Smitz Follicle Biology Laboratory UZ Brussel, Brussels

Role of Cnot6l in maternal mrna turnover

Epigenetics. Lyle Armstrong. UJ Taylor & Francis Group. f'ci Garland Science NEW YORK AND LONDON

DNA methylation and hydroxymethylation in early rabbit embryos: Consequences of in vitro culture. Bedhane Mohammed

but it still needs a bit of work

Introduction: DNA methylation in mammals. DNA+Histones=Chromatin. Long-lasting cellular memory

Are you the way you are because of the

Dynamic Reprogramming of DNA Methylation in the Early Mouse Embryo

Paternal Poly (ADP-ribose) Metabolism Modulates Retention of Inheritable Sperm Histones and Early Embryonic Gene Expression

The effects of PGS/PGT-A on IVF outcomes

DNA double-strand break repair of parental chromatin in ooplasm and origin of de novo mutations. Peter de Boer

Paternal exposure and effects on microrna and mrna expression in developing embryo. Department of Chemical and Radiation Nur Duale

Genome Analyses of Single Human Oocytes

4/20/2016. Objectives. Epigenetic Definitions. Gene Expression. More Questions. Questions to Consider

THE CHROMOSOMAL BASIS OF INHERITANCE CHAPTER 15

Regulation of Gene Expression in Eukaryotes

Epigenetic Inheritance

Stem Cell Epigenetics

Articles Somatic cell haploidization: an update

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014

DNA METHYLATION IN EARLY MAMMALIAN DEVELOPMENT

Diagnostic Techniques to Improve the Assessment of Human IVF Embryos: Genomics and Proteomics

Supplementary tables and figure legends

Preimplantation genetic diagnosis: polar body and embryo biopsy

Epigenetic processes are fundamental to development because they permit a

OVERVIEW OF EPIGENETICS

DNA Methylation and Cancer

EPIGENOMICS PROFILING SERVICES

Zongliang (Carl) Jiang. 333 Cedar St, New Haven, CT OBJECTIVE

Study on Several Factors Involved in IVF-ET of Human Beings

Epigenetics Armstrong_Prelims.indd 1 04/11/2013 3:28 pm

Supplementary Materials and Methods

Transcription:

Dissecting gene regulation network in human early embryos at single-cell and single-base resolution Fuchou Tang BIOPIC, College of Life Sciences Peking University 07/10/2015

Cockburn and Rossant, 2010 Mammalian embryonic development starts from a single cell - zygote

Single Cell Transcriptome Single Cell Genome Low number of Cells Epigenome In vivo In vitro In vivo In vivo In vitro Key SNVs Key Transcription Factors Crucial epigenetic codes Gene Expression Network Epigenetic Network Cell Fate Determination (Early Embryonic Development) Mouse Model (Gene Knockout & Knockdown) Human ES Cell Model (Gene Knockdown & Overexpression) Early Embryo Dissecting Gene Regulation Network of Human Early Embryos

Isolation of single cells from human preimplantation embryos

An individual human embryonic cell expresses: 18,022 RefSeq transcripts; 13,772 Ensembl transcripts. Single cell RNA-Seq of human early embryos (Yan et al., Nature Structural & Molecular Biology, 2013)

Global DNA methylome changes during mammalian embryonic development (Saitou et al., Development 2012)

Single cell DNA methylome analysis (Guo et al., Genome Research, 2013)

Global DNA methylation dynamics of human early embryos (Guo et al., Nature, 2014)

Gene imprinting dynamics of human early embryos

Differentially Methylated Regions (DMRs) of human early embryos

Differentially Methylated Regions (DMRs) of human early embryos

Global DNA methylation dynamics of human early embryos

Discriminate male & female pronuclei within individual zygotes

Global DNA methylation at zygote stage within individual pronuclei

Global DNA methylation at zygote stage within individual pronuclei

Active DNA demethylation in both maternal & paternal genome in mouse zygotes (Guo et al., Cell Stem Cell, 2014)

Active DNA demethylation is dependent on Tet3 (Guo et al., Cell Stem Cell, 2014)

Active DNA demethylation removed 5mCpG on both strands

Active DNA demethylation leads to unmodified cytosines

Active DNA demethylation is independent on TDG

Single cell SUPER-Seq analysis of mouse early embryos (Fan et al., Genome Biology, 2015)

SUPER-Seq analysis of averaged single cells (HEK-293 cells)

SUPER-Seq analysis to detect circrnas in mouse preimplantation embryos

SUPER-Seq analysis to detect circrnas in mouse preimplantation embryos

SUPER-Seq analysis to detect circrnas in mouse preimplantation embryos

SUPER-Seq analysis to detect novel polya minus RNAs in mouse preimplantation embryos

SUPER-Seq analysis to detect novel polya minus RNAs in mouse preimplantation embryos

SUPER-Seq analysis to detect circrnas in human preimplantation embryos (Unpublished)

SUPER-Seq analysis to detect circrnas in human preimplantation embryos (Unpublished)

SUPER-Seq analysis to detect circrnas in human preimplantation embryos (Unpublished)

SUPER-Seq analysis to detect circrnas in human preimplantation embryos (Unpublished)

SUPER-Seq analysis to detect polya minus RNAs in human preimplantation embryos (Unpublished)

Summary of single cell genome sequencing of human oocytes (Hou et al., Cell, 2013)

CNV CNV An Oocyte from Donor #1 with Chromosome Abnormality 1 st Polar Body 2 nd Polar Body Female pronucleus predicted Female pronucleus observed Total chromosome copy numbers conserved in the whole oocyte

Aneuploidy rate for each donor

8-cell stage embryos from Donor #9 with Chromosome Abnormality

Stage No. of Single Cells GV oocyte 8 MII oocyte 42 Sperm 7 2-cell embryo 21 4-cell embryo 25 8-cell embryo 8 TE 9 ICM 11 Total 131 Single cell multiple omics sequencing of human preimplantation embryos (Unpublished)

Stage No. of Samples No. of Samples Showing CNVs GV oocyte 8 0 MII oocyte 42 5 Sperm 9 0 2-cell embryo 21 8 4-cell embryo 25 3 TE 6 1 ICM 12 7 Blastocyst 4 1 Single cell multiple omics sequencing of human preimplantation embryos (Unpublished)

Single cell multiple omics sequencing of human preimplantation embryos (Unpublished)

Single cell multiple omics sequencing of human preimplantation embryos (Unpublished)

Single cell multiple omics sequencing of human preimplantation embryos (Unpublished)

Single cell multiple omics sequencing of human preimplantation embryos (Unpublished)

Single cell multiple omics sequencing of human preimplantation embryos (Unpublished)

DNA methylation dynamics during human early embryonic development

Acknowledgements Sunney Xie Jie Qiao Ruiqiang Li Yanyi Huang Guoliang Xu Jinsong Li Guanghui Liu Chuan He Jirun Peng Bing Liu Chunsheng Han Yu Hou Hongshan Guo Lin Li