K-Ras EGFR pegfr Tubulin. pplcγ 1. Mock EGF

Similar documents
Supplemental information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

SUPPLEMENTARY INFORMATION

Supplementary Figure S1. TRAIL-induced necroptosis at acidic phe is dependent on

Supplementary Information

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.

Supplementary Materials for

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as

Reviewers' comments: Reviewer #1 (Remarks to the Author):

SUPPLEMENTARY INFORMATION

KRAS: ONE ACTOR, MANY POTENTIAL ROLES IN DIAGNOSIS

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a

ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2

Supplementary material. Supplementary Figure legends

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting

Supplementary Information

Nature Neuroscience: doi: /nn Supplementary Figure 1

* * A3027. A4623 e A3507 A3507 A3507

SUPPLEMENTARY FIG. S5. ROS regulated the signaling responses of A. gambiae 4a3B cells to human insulin. (A) 4a3B cells were stimulated with 6000

Cancer model Liver metastasis I

CELL DENSITY AFFECTS ERK SIGNALING HETEROGENEITY. Yen-Der Li School of Medicine and Department of Physics National Taiwan University

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were

perk/erk STAT5B

Nature Medicine: doi: /nm.4078

mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL-

Infect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SAM library or vector. Introduce AKT reporter

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

File name: Supplementary Information Description: Supplementary figures and supplementary tables. File name: Peer review file Description:

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer

AP VP DLP H&E. p-akt DLP

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

Dox. R26-rtTA Tyr-CreERT2. any ink/arf, no rtta (n=8) ink/arf +/+ (n=5) Day 0 Day 11 Day 18 Day 28

SUPPLEMENTARY INFORMATION

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.

Supplementary Figures

nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering

Supplementary Material

Copyright 2013 Macmillan Publishers Ltd. Deposited on: 29 April 2013

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Differential effects of oncogenic K-Ras and N-Ras on proliferation, differentiation, and tumor progression in the colon

Impact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

Interleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42

Supplementary Materials for

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + +

The AZ-Merck Collaboration

BRAF: dal melanoma alla HCL

Nature Structural & Molecular Biology: doi: /nsmb.3218

K-Ras signalling in NSCLC

Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the

Supplemental information

Exosomes function in antigen presentation during an in vivo Mycobacterium tuberculosis infection

Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A)

Supplementary Information

Supplemental Information. Oncogenic RAS Signaling Promotes Tumor. Immunoresistance by Stabilizing PD-L1 mrna

Figures S1-S5, Figure Legends, Table S1 List of primers used in the study

Supplementary Information Titles Journal: Nature Medicine

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

SUPPLEMENTARY FIGURES

Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments:

CONTRACTING ORGANIZATION: Rush University Medical Center Chicago, IL 60612

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis

Supplementary Figure 1

Supplementary Figure 1

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Nature Immunology: doi: /ni.3866

Spectrum of somatically acquired mutations identified by combining WES and genome-wide DNA array analysis in the discovery cohort of 30 JMML cases.

SUPPLEMENTARY MATERIAL

Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from

SUPPLEMENTARY FIGURES AND TABLE

Hunk is required for HER2/neu-induced mammary tumorigenesis

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

Supplementary Information

SUPPLEMENTARY INFORMATION

Supplementary Materials for

Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.

SUPPLEMENTARY INFORMATION

Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis

WT Xid (h) poly(da:dt) Alum. Poly(dA:dT) 0.05

Spherical Nucleic Acids For Advanced Wound Healing Applications Chad A. Mirkin

Normal Skin. Tissue Samples and Melanoma Cell Lines. BRAF Mut. RAS Mut RAS WT /BRAF WT

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Information

Supplementary Figure 1

Supplementary Figures

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +

Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Table. File Name: Peer Review File Description:

SUPPLEMENTARY INFORMATION

SUPPLEMENTAL FIGURE LEGENDS

Supplementary Materials

P-Akt Thr308. T-Akt *** *** Anti-α3 IgG Ctrl

Supplemental Figure 1

Transcription:

shcttl shkras EGF + + 15 17 17 KRas EGFR pegfr 13 pplcγ 1 Level of pegfr (A.U.) 1 8 6 4 2 shkras Mock EGF Supplementary Figure S1. KRasdeficient pancreatic cancer cells retain normal RTK signalling. (a) AsPC1 cells engineered to express or shkras as descried in Figure 2a were serumstarved for 2 hr and then stimulated with 5 ng/ml EGF for 1 min at 37 C. Activation of EGFR signalling pathway was determined y western lotting using antiphospho EGFR (Tyr168) and antiphosphoplcγ1 (Tyr783) antiodies. was used as a loading control. () Values are means +/ SD from three independent experiments presented as fold activation compared to (mock).

c e + + + + + + + + + + + + * WT + * WT + * WT + * RA/LE + * RA/LE + * RA/LE + 17 17 17 1.2 d 1.2 f 1.2 1..8.6.4.2 1..8.6.4.2 1..8.6.4.2 * WT * RALE * WT * RALE * WT * RALE Supplementary Figure S2. mediated cross activation of WT HRas y oncogenic KRas is responsile for pancreatic cancer cell growth. (af) Pancreatic cancer cells [PL45 (a, ), CFPAC1 (c, d), and AsPC1 (e, f)] engineered as in Figure 2a to express inducile, and shrnaresistant constructs (* WT or * RA/LE ) as indicated were cultured in.5% serum in the presence of doxycycline for the indicated intervals. Cell density was determined y Syto6 staining and quantified (, d, f) as descried in Methods. Values are means +/ SD of technical triplicates presented as fold activation compared to. The experiment shown is representative of three independent experiments. Efficiency of knockdown and ectopic expression of were confirmed y western lotting. was used as a loading control. A.U., aritrary units.

c 17 17 d 1..8.6.4.2 1..8.6.4.2 Supplementary Figure S3. is not essential for the growth of pancreatic cancer cells harouring wild type Ras. (ad) Pancreatic cancer cells [BxPC3 (a, ) and Hs7T (c, d)] expressing inducile and were cultured in.5% serum in the presence of doxycycline for the indicated intervals. Cell density was determined y Syto6 staining and quantified (, d) as descried in Methods. Values are means +/ SD of technical triplicates presented as fold activation compared to. The experiment shown is representative of three independent experiments. Efficiency of knockdown was confirmed y western lotting. was used as a loading control. A.U., aritrary units.

c + + + + * WT + * RA/LE + 17 ERK activity (A.U.) 2. 1.5 1..5 4 4 4 5 7 7 * WT * RA/LE MEK1/2 pmek1/2 Erk2 perk1/2 Akt pakt S6 ps6 35 3 25 2 15 1 5 Day Day3 Day6 Day9 Supplementary Figure S4. mediated cross activation of WT HRas y oncogenic KRas contriutes to pancreatic cancer cell growth and signalling. (a) PL45 cells engineered as in Figure 2a to express inducile, and wole constructs (* WT or * RA/LE ) as indicated were cultured in.5% serum in the presence of doxycycline for the indicated intervals. Efficiency of knockdown and ectopic expression of were confirmed y western lotting. () Values of ERK activity are presented as fold activation compared to and represent means +/ SD from three independent experiments. (c) Effect of suppression of expression on the kinetics of pancreatic cancer cell growth. PL45 cells expressing or were maintained in culture for the indicated intervals. Cell density at each time point was analyzed y Syto6 staining. Values are means +/ SD from three independent experiments. A.U., aritrary units.

+ + + HANRas G12D + 17 4 5 25 13 Erk2 perk1/2 Akt pakt NRas G12D Vinculin Supplementary Figure S5. mediated cross activation of WT Ras y oncogenic KRas contriutes to pancreatic cancer cell signalling. MIA PaCa2 cells engineered as in Figure 2a to express inducile or. T7NRasG12D was transfected (Lipofectamine 2, Invitrogen) using standard procedures. Transfection efficiency (>8%) was verified y cotransfecting pegfp (Clontech). Cells were cultured in.5% serum in the presence of doxycycline then lysed, immunolotted, and proed with the specified antiodies. Data shown is representative of three independent experiments with similar results.

Tumor Volume (mm 3 ) 2 15 1 5 /Vector /* WT /* F929A Vector * WT * F929A 9 18 27 36 45 54 Time (days) Supplementary Figure S6. GEF catalytic activity is necessary for pancreatic tumour formation. (a) MIA PaCa2 cells harouring the indicated inducile constructs were injected sucutaneously into mice. Following injections, animals were fed doxycyclinecontaining diet and tumour growth was measured as descried in Methods. Values are means +/ SD (n=3 or 4). () Representative mice and tumours are shown.

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback