Figure S1A. Blood glucose levels in mice after glucose injection

Similar documents
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.

Supplementary Figure 1

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

SUPPLEMENTARY LEGENDS...

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

Supplementary Figure 1

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary methods:

Polycomb protein Ezh2 regulates pancreatic β-cell Ink4a/Arf expression and regeneration in streptozotocin-induced diabetes mellitus

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Information

Supplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory

Mechanisms underlying epigene2c effects of endocrine disrup2ve chemicals. Joëlle Rüegg

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supplementary Figures

Supplementary Figure 1

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplementary Figure 1.

Infect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SAM library or vector. Introduce AKT reporter

Control. csarnt -/- Cre, f/f

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

SUPPLEMENTARY INFORMATION

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)

Name Animal source Vendor Cat # Dilutions

Supplementary Figure 1

SUPPLEMENTARY INFORMATION

Supplementary Figures

ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2

Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.

SUPPLEMENTARY INFORMATION

MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min

Supplementary Material. Contents include:

SUPPLEMENTARY FIGURES AND TABLES

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

Nature Genetics: doi: /ng.3731

a! b! c! Supplementary Fig. 1! Diameter (μm) S1P (LogM) U (LogM) enos! β-actin! Nogo-B! MLEC! nnos! β-actin!

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

a b c d e C 3 ]Aspartate [ 20 minutes C 3 ]Hexose-P * * *

Supplementary Materials for

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed

T H E J O U R N A L O F C E L L B I O L O G Y

Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.

Supplementary Figures

Supplementary Materials for

SUPPLEMENTARY INFORMATION

Reviewers' comments: Reviewer #1 (Remarks to the Author):

Supplemental Figure S1. RANK expression on human lung cancer cells.

Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene. Fig. S1. STING ligands-mediated signaling response in MEFs. (A) Primary MEFs (1

Supporting information

SUPPLEMENTARY INFORMATION

Figure S1, Beyer et al.

Supplementary Materials for

SUPPLEMENTARY FIGURES

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis

Figures S1-S5, Figure Legends, Table S1 List of primers used in the study

Supplemental Figure 1

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

glpx Rv1100 Probe 4.4 kb 75 kda 50 kda 37 kda 25 kda 20 kda

SUPPLEMENTARY FIGURES

Supplementary Figure 1: Co-localization of reconstituted L-PTC and dendritic cells

Supplementary Materials for

CHAPTER 5 RESULTS Previous study: cell culture and organotypical slices

Supplementary Figure 1. Procedures for p38 activity imaging in living cells. (a) Schematic model of the p38 activity reporter. The reporter consists

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

Supplemental Table 1 Molecular Profile of the SCLC Cell Line Panel

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!

SUPPLEMENTARY INFORMATION

Supplementary Figure 1 IL-27 IL

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-

Estrogen receptor beta regulates locus-specific DNA methylation a possible mechanism for epigenetic effects of endocrine disrupters

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.

Supplementary Figures

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

E10.5 E18.5 P2 10w 83w NF1 HF1. Sham ISO. Bmi1. H3K9me3. Lung weight (g)

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplemental Figures:

Cesarini et al., http :// /cgi /content /full /jcb /DC1

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Transcription:

## Figure S1A. Blood glucose levels in mice after glucose injection Blood glucose (mm/l) 25 2 15 1 5 # 15 3 6 3+3 Time after glucose injection (min) #

Figure S1B. α-kg levels in mouse livers after glucose injection Abundance -KG 4 3 2 1 17.2 17.3 17.4 17.5 Elution time (min) Abundance Heptadecanoic acid 4 3 2 1 21.3 21.6 Elution time (min) Peak Area (Normalized by heptadecanoic acid).7.6 -KG.5.4.3.2 y =.3382x.124.1 R² =.9998 1 2 Actual quantity (Normalized by heptadecanoic acid) Mouse liver after glucose injection Elution time (min)

# ##Figure S1C. Global 5hmC levels in mouse tissues after glucose injection Mouse liver after glucose injection Genomic DNA (ng) Relative 5hmC 3 2 1 Liver # ## 15 3 6 3+3 Time after glucose injection (min) Mouse kidney after glucose injection Genomic DNA (ng) Relative 5hmC 4 3 2 1 Kidney 15 3 6 3+3 Time after glucose injection (min) Mouse muscle after glucose injection Genomic DNA (ng) 21 22 23 24 5 Fasted, min 6 7 A 9 1 11 12 13 15 16 15 min 3 min 8 19 2 1 2 3 4 6 min 3+3 min 21 22 23 24 5 6 7 9 1 11 12 13 15 16 8 19 2 1 2 3 4 Relative 5hmC 2.5 2. 1..5. Muscle P=.6.s. #n#p=.7 15 3 6 3+3 Time after glucose injection (min)

Figure S1D. Quantification of various cytosine derivatives by LC-MS/MS analysis Actual quantity (normalized by ddc) Actual quantity (normalized by ddc) Actual quantity (normalized by ddc) Actual quantity (normalized by ddc)

Figure S1E. Global 5mC and 5fC levels in mouse livers after glucose injection 2.5 (By LC-MS/MS) Relative 5mC (liver) 2. 1..5. 15 3 6 3+3 Time after glucose injection (min) Relative 5fC (liver) 2.5 2. 1..5 P=.5. 15 3 6 3+3 Time after glucose injection (min)

Figure S1F. The expression and subcellular localization of Tet2 or Tet3 in mouse livers after glucose injection Relative mrna expression 2. 1..5. Tet2 Tet3 3 6 3+3 Time post glucose injection (min) Time post glucose injection Tet3 Tet2 β-actin Cytosolic Fraction Nuclear Fraction Time post glucose injection min 3 min 6 min 3+3 min min 3 min 6 min 3+3 min Tet3 WB Lamin A/C -Tubulin

Figure S1G. Global 5hmC and 5mC levels in mouse livers after glutamine or glutamate injection Mouse liver after glutamine or glutamate injection -5hmC Methylene Blue Genomic DNA (ng) 3 3 Relative 5hmC (liver) (By dot-blot) 2 1 15 3 6 Relative 5hmC (liver) (By dot-blot) 2 1 15 3 6 Time after glutamine injection (min) Time after glutamate injection (min) 2. 2. Relative 5mC (liver) (By LC-MS/MS) 1..5 P=.6 Relative 5mC (liver) (By LC-MS/MS).. 15 3 6 15 3 6 Time after glutamine injection (min) Time after glutamate injection (min) 1..5

Figure S1H. 5hmC and 5mC levels in the selected region of Gck gene in mouse livers after glucose injection 4 5hmC T=min 5hmC in Gck by hmedip-seq 1kb 4 T=3min 4 T=6min 4 5mC T=min 5mC in Gck by MeDIP-seq 5kb 4 5mC T=min 1kb 4 T=3min 4 T=3min 4 T=6min 4 T=6min Relative 5mC enrichment (MeDIP-qPCR) 1..5. p=.6 3 6 3+3

Figure S1I. 5hmC and 5mC levels in a control region of Gck gene in mouse livers after glucose injection 5hmC 3 T= min 3 T=3 min 3 T=6 min Relative enrichment of 5hmC 1..5. 3 6 3+3 Time post glucose injection time (min) Relative enrichment of 5mC 1..5. 3 6 3+3 Time post glucose injection time (min)

Figure S1J. The mrna expression of glycolytic or gluconeogenic genes in mouse livers after glucose injection Relative mrna expression Relative mrna expression Relative mrna expression 2. 1..5. 3 2 1 1..5. G6pase Lpk Pck1 G6Pase LPK PEPCK 3 6 3+3 Time post glucose injection (min)

SUPPLEMENTARY FIGURE LEGENDS Figure S1A. Blood glucose levels in mice after glucose injection. Over-night fasted mice received single or repeated intraperitoneal injection(s) of glucose (1g/kg body weight). Blood glucose was measured at the indicated time points after glucose injection(s). Data are represented as the mean ± S.D. (n=2-5 per group). p <.5, p <.1, p <.1 for comparison with t= min; ## p <.1, ### p <.1 for the indicated comparison; =not significant. Figure S1B. α-kg levels in mouse livers after glucose injection Metabolites were extracted from mouse tissues as described in the Method, and detected for α-kg levels by GC-MS analysis (upper panel). The relative levels of α-kg were calculated using an internal standard heptadecanoic acid (C17:). Data shown are representative of the abundance of α-kg and heptadecanoic acid in mouse livers at the indicated time points after glucose injection (lower panel). Figure S1C. Global 5hmC levels in mouse tissues after glucose injection Genomic DNA was extracted from mouse tissues at the indicated time points after glucose injection. Global 5hmC levels in the liver, kidney, and muscle were determined by dot-blot analysis. In addition, genomic DNA was also spotted and stained with.2% methylene blue in.3 M sodium acetate (ph=5.2) to control equal loading. Data are represented as the mean ± S.D. (n=2-5 per group). p <.5, p <.1 for comparison with t= min; # p <.5, ## p <

.1 for the indicated comparison; =not significant. Figure S1D. Quantification of various cytosine derivatives by LC-MS/MS analysis Dideoxycytidine (ddc), 5mC, 5hmC, 5fC, and 5caC were subjected to LC-MS/MS in the selected reaction monitoring (SRM) scan mode. The typical LC-MS/MS chromatograms of each standard (1 pg) are shown, with ddc (1 pg) being added as an internal control. Standard curves for 5mC, 5hmC, 5fC, and 5caC (1-1 pg) were generated and a good linearity was achieved for these cytosine derivatives. Figure S1E. Global 5mC and 5fC levels in mouse livers after glucose injection Genomic DNA was extracted from mouse livers at the indicated time points after glucose injection, and determined for global levels of 5mC and 5fC by LC-MS/MS. Data are represented as the mean ± S.D. (n=3 per group). p <.5 for comparison with t= min; =not significant. Figure S1F. The expression and subcellular localization of Tet2 or Tet3 in mouse livers after glucose injection The mrna and protein expressions of Tet2 and Tet3 in mouse livers at the indicated time points after glucose injection were determined by qrt-pcr analysis and western-blot, respectively. Moreover, the subcellular localization of Tet3 was determined in isolated cytosolic and nuclear fractions from mouse livers at the indicated time points after glucose

injection. Figure S1G. Global 5hmC and 5mC levels in mouse livers after glutamine or glutamate injection Over-night fasted mice received single intraperitoneal injection of L-glutamine (1.2 mg/g body weight) or glutamate (1.2 mg/g body weight). Genomic DNA was extracted from mouse livers at the indicated time points after glutamine or glutamate injection, and global levels of 5mC and 5hmC were determined by dot-blot and LC-MS/MS analysis. Data are represented as the mean ± S.D. (n=3 per group). p <.5, p <.1 for comparison with t= min; =not significant. Figure S1H. 5hmC and 5mC levels in the selected region of Gck gene in mouse livers after glucose injection An enlarged drawing for hmedip-seq peaks in the Gck gene visualized in IGV, as labelled by a red-dotted box in Figure 1E. One region (chr11:5948151bp-5948348bp) which was chosen for hmedip-qpcr verification in Figure 1F was labeled by a red line (upper panel). Moreover, MeDIP-seq peaks in the Gck gene were visualized in IGV (lower panel). One region (chr11:5948151bp-5948348bp) which was chosen for MeDIP-qPCR verification at the bottom was labeled by a red line. Data are represented as the mean ± S.D. (n=3 per group). p <.5 for comparison with t= min.

Figure S1I. 5hmC and 5mC levels in a control region of Gck gene in mouse livers after glucose injection A control region with similar GC content as the selected region in Figure 1 was labeled by a red line, and 5hmC and 5mC levels in the control region were determined by hmedip-qpcr and MeDIP-qPCR, respectively. Data are represented as the mean ± S.D. (n=3 per group). =not significant. Figure S1J. The mrna expression of glycolytic or gluconeogenic genes in mouse livers after glucose injection The mrna expression of G6pase, Lpk, and Pck1 in mouse livers at the indicated time points after glucose injection was determined by qrt-pcr analysis. Data are represented as the mean ± S.D. (n=3 per group). p <.5; p <.1 for comparison with t= min; =not significant.