Supplementary Figure 1

Similar documents
SUPPLEMENTARY INFORMATION

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

SUPPLEMENTARY INFORMATION

Supplementary Figure 1

Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β

SUPPLEMENTARY FIGURES AND TABLES

Supplementary Materials for

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.

Supplementary Figure 1

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)

Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times.

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Fig. S1. High K+ increases intracellular calcium level.

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Figure 1

Supplementary Figure 1

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

Nature Genetics: doi: /ng.3731

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

Supplementary Table 1. List of primers used in this study

Supplementary Information

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

Supplemental Figure 1: Anti-GDF15 antibody blocks binding of GDF15 to hgfral.

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

SUPPLEMENTARY INFORMATION


S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

Supplementary Information

Supplementary Figure 1: Co-localization of reconstituted L-PTC and dendritic cells

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

SUPPLEMENTARY INFORMATION

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplementary Information

A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain

Supplementary Figure S1 Supplementary Figure S2

SUPPLEMENTARY FIGURES

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Supplementary Fig. S1. Schematic diagram of minigenome segments.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary figures

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or

Supplementary Figure 1.

Supplemental Fig. 1. Changes in fat and lean mass determined by DEXA. Fat mass in high fat-fed

Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:

TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge

Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical

SUPPLEMENTARY INFORMATION

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min

Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous

Supplementary Figure 1. Effect of cellular glycolysis on tumor cell exosome secretion. A549 cells were cultured in medium containing different

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-

microrna-200b and microrna-200c promote colorectal cancer cell proliferation via

SUPPLEMENTARY FIGURES AND TABLE

FIG S1 Examination of eif4b expression after virus infection. (A) A549 cells

Data Sheet PD-1 / NFAT Reporter - Jurkat Cell Line Catalog #: 60535

Supplementary Figure 1. TNFα reduces BMPR-II protein and mrna expression via NF-кB/RELA. (a and b) Representative immunoblots of BMPR-II in human

Supplementary Figures

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.

SUPPLEMENTAL FIGURE LEGENDS

Control. csarnt -/- Cre, f/f

Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma

SUPPLEMENTARY INFORMATION

Soluble ADAM33 initiates airway remodeling to promote susceptibility for. Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David I Wilson,

Supplementary Materials for

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

A. Generation and characterization of Ras-expressing autophagycompetent

Figure S1A. Blood glucose levels in mice after glucose injection

Transcription:

Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15.

Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral mice (n = 2/group) measured by quantitative RT-PCR.

Supplementary Figure 3 a b c d Supplementary Figure 3 GDF15 does not suppress body weight and food intake in female Gfral knockout mice. (a-d) Starting body weight (a), percentage body weight change (b), cumulative food intake (c) and OGTT on day 13 (d) of normal chow-fed, 10 week old female wild-type (n = 4/group) (left graphs) or Gfral / (KO) mice (n = 4/group) (right graphs) treated with Fc-GDF15 (0.1 mg/kg, intraperitoneal injection, every other day) or vehicle. Values are means and s.e.m. Body weight changes from baseline were analyzed in repeated measurement model with TOEPLITZ covariance matrix. Group effect was tested at each day. Bonferroni corrections were applied to post hoc multiple comparisons as shown in figures to control within day Type I error. Between day multiplicity adjustments were not applied. Cumulative food intakes were analyzed in separated one-way analysis of variance (ANOVA) models at each day. Bonferroni corrections were applied to post hoc multiple comparisons as shown in figures without further between day multiplicity adjustments. Log transformations were applied to Glucose measurements followed by the same repeated measurement model and post hoc multiple comparisons as described before. *P<0.05; **P <0.01; ***P< 0.001.

Supplementary Figure 4 a b c d Supplementary Figure 4 Daily treatment of recombinant native GDF15 does not suppress body weight and food intake in Gfral knockout mice. (a-c) Starting body weight (a), percentage body weight change (b) and cumulative food intake (c) of normal chow-fed, 10 week old female wild-type (n = 6/group) or Gfral / (KO) mice (n = 5 for vehicle group and n = 6 for treatment group) treated with recombinant native GDF15 (0.1 mg/kg, intraperitoneal injection, daily) or vehicle. (d) Plasma exposure of recombinant native GDF15 in both wild-type or Gfral / (KO) mice after single dose of 0.1 mg/kg injection. Values are means and s.e.m. Body weight changes from baseline were analyzed in repeated measurement model with TOEPLITZ covariance matrix. Group effect was tested at each day. Bonferroni corrections were applied to post hoc multiple comparisons as shown in figures to control within day Type I error. Between day multiplicity adjustments were not applied. Cumulative food intakes were analyzed in separated one-way analysis of variance (ANOVA) models at each day. Bonferroni corrections were applied to post hoc multiple comparisons as shown in figures without further between day multiplicity adjustments. *P<0.05; **P <0.01; ***P< 0.001.

Supplementary Figure 5 Supplementary Figure 5 GDF15 does not activate RET phosphorylation in SH-SY5Y cells overexpressing GFRAL and RET. Left panel: Western blot analysis of pret and total-ret from parental RET stable SH-SY5Y cells treated with native GDNF and GFRA1. Right panel: Western blot analysis of pret and total-ret from RET stable SH-SY5Y cells transient transfected with C-terminal FLAG tagged human GFRAL stimulated with either native GDF15 or Fc-GDF15. Western blot is a representative one from two independent experiments with a single biological replicate run per gel. Uncropped Western blot images are shown in Supplementary Fig. 6.

Supplementary Figure 6 a b c Supplementary Figure 6 Full-scans of Western blots. (a-c) Full-sized images of Western blots from Figure 1a (a), Figure 1g (b) and Supplementary Figure 5 (c). Red boxes highlight areas that were cropped and are displayed in the indicated figures. Western blot membranes of Figure 6g were cut out between 100 kda and 250 kda to detect p-ret and total RET.

Supplementary Table 1

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback