A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

Similar documents
Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

SUPPLEMENTARY INFORMATION

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

SUPPLEMENTARY INFORMATION

T H E J O U R N A L O F C E L L B I O L O G Y

SUPPLEMENTARY INFORMATION

Online Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of

SUPPLEMENTAL FIGURE LEGENDS

Supplemental information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer

Supplemental Figure 1

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Supplementary Figure 1

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

RayBio KinaseSTAR TM Akt Activity Assay Kit

Supplemental Information

Supplementary Materials for

Supplementary Appendix

SUPPLEMENTARY INFORMATION

Supplementary Materials for

Supplementary Figure S1 Supplementary Figure S2

Effec<ve Use of PI3K and MEK Inhibitors to Treat Mutant K Ras G12D and PIK3CA H1047R Murine Lung Cancers

ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC

Requires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c

Supplementary Information

supplementary information

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

Insulin Receptor Substrate 3 (IRS-3) and IRS-4 Impair IRS-1- and IRS-2-Mediated Signaling

Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Figures S1-S5, Figure Legends, Table S1 List of primers used in the study

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

Supplementary Data Table of Contents:

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages

Phospho-AKT Sampler Kit

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY FIGURES AND TABLE

William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin

Synthesis of Substituted 2H-Benzo[e]indazole-9-carboxylate as Potent Antihyperglycemic Agent that May Act through IRS-1, Akt and GSK-3β Pathways

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet

Interleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42

Supplementary information

Supplementary Materials for

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.

Plasma exposure levels from individual mice 4 hours post IP administration at the

Supplementary Figure 1

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein

Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3

SUPPLEMENTARY FIGURES

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

Supplementary Materials and Methods

Supplementary Materials for

Supplementary Materials for

Protocol for Gene Transfection & Western Blotting

Supplementary Figure 1. Procedures for p38 activity imaging in living cells. (a) Schematic model of the p38 activity reporter. The reporter consists

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Deglycosylation and Antibody Screening to Identify Receptor Tyrosine Kinases by 2DE

HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

Nature Neuroscience: doi: /nn Supplementary Figure 1

Supplementary Figure 1

Supporting Information

SUPPLEMENTARY INFORMATION

The Schedule and the Manual of Basic Techniques for Cell Culture

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

Dramatic increase in SHP2 binding activity of Helicobacter. pylori Western CagA by EPIYA-C duplication: its

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

Nature Immunology: doi: /ni.3866

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS

Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)

Calcium-Mediated Apoptosis and Apoptotic Sensitization in Prostate Cancer. CONTRACTING ORGANIZATION: M.D. Anderson Cancer Center Houston, TX 77030

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.

Supplementary Materials for

Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.

SUPPLEMENT. Materials and methods

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

Transcription:

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar SUPPLEMENTARY FIGURES, LEGENDS AND METHODS Supplementary Figure 1. Amino acid sequence similarities between Met and Insulin Receptor (INSR) kinase domains. Shown is the amino acid alignment of human INSR, Met and EGFR. Note the presence of the known regulatory triple Tyr (Y) residues in Met and INSR (box with solid line a motif which binds IRS2 when fully activated in the case of INSR 1 ) and the QPEY motif (box with dashed line) in Met, which is similar to the IRS binding site in INSR (NPEY not shown). EGFR lacks these similarities. 1

Supplementary Figure 2. Met phosphorylates IRS1 and -2. Hepatocytes were stimulated with EGF (20 ng ml -1 for 5 min.), insulin (200 ng ml -1 for 5 min.) or HGF (20 ng ml -1 for 1, 5, or 15 min.). Lysates were prepared and subjected to IP with py20 and IB with anti-irs1 or anti-irs2 as indicated. Fibroblast lysate (NIH3T3) provided by the supplier of IRS1/2 antibodies was included as a positive control. A pool of HGF treated samples was subjected to IP with normal mouse IgG as a negative control. 2

Supplementary Figure 3. Met activates INSR in a cell-free system. (a) Recombinant Met (GST-tagged, Mr 78 kda) and INSR (His-tagged, Mr approximately 37 kda) kinases were incubated in kinase buffer at the indicated molar ratios in an in vitro kinase assay and subjected to IB studies using py20 antibody. INSR concentration was 3 pmole and kept constant while Met concentration was increased as shown. (b) A hot kinase assay was performed by incubating recombinant Met, INSR (both GST-tagged, Mr, 78 and 70 kda, respectively) and EGFR kinases for 15 min. in kinase buffer containing 32 P-γATP. The reaction products were subjected to SDS-PAGE, transferred to PVDF membrane and processed for autoradiography (48 h. exposure). The blot was subsequently probed with anti-insrβ and ECL detection to document the presence of INSR in the reaction. Numbers to right of blots are size markers in kda. The bars depict relative normalized de novo pinsr/total INSR (i.e. corresponding to pinsr/insr signals from lanes 3, 4, 7 and 9). 3

Supplementary Figure 4. Met activates INSR in human hepatocytes. Normalized data corresponding to IB results shown in Figure 2c. Human primary hepatocyte cultures were treated with HGF and/or insulin for various times and assessed for Met and INSR activation by IP and IB as indicated. Error bar represents mean ± s.e.m. 4

Supplementary Figure 5. Recruitment of IRS2 to Met requires functional Met. Hepa1-6 cells expressing Tet regulatable DN-Met were cultured overnight with or without doxycycline, then stimulated with HGF (40 ng/ml) and subjected to IP with anti- Met antibodies and IB with anti-irs2 and anti-met as indicated. Input lysates were assessed for DN-Met expression and IRS2 by IB. 5

Supplementary Figure 6. Met and INSR and Met and IRS form a complex in the livers of mice. (a) Wild type CD1 mice (n = 2) were fasted overnight and then injected with insulin. At various times, livers were harvested and subjected to IP and IB using the indicated antibodies. The data shown are from insulin given at 1 mu g -1 i.p. (b) Livers from AlbDN-Met and wild type mice were subjected to IP with anti-met antibody and IB with anti-insr antibody as indicated. 6

Supplementary Figure 7. sirna-mediated knock down of Met in primary cultures of mouse hepatocytes. Primary mouse hepatocytes were transfected with Met or control sirna for 24 72 h. Lysates were subjected to IB analysis and knockdown of Met was confirmed using an anti-met antibody. 7

Supplementary Figure 8. Relative abundance of Met and INSR proteins in mouse tissues. Ob/ob mice were injected with HGF or saline control, and 15 min. later, tissues were harvested and analyzed for Met and INSR expression by IB. Liver from lean mice injected with HGF is included as positive control. Error bars represents mean ± s.e.m. 8

Supplementary Figure 9. HGF is a potent activator of AKT and Gab1 in human hepatocytes. Primary cultures of human hepatocytes were treated with HGF, insulin or IGF1 (at the indicated doses) for 0 15 min., and lysates were assessed by IB with the indicated antibodies. 9

10

SUPPLEMENTARY METHODS Cell lines, culture conditions, and antibodies. HepG2, Hepa1-6, and primary hepatocyte cultures were maintained in DMEM supplemented with 10% FBS. Antibodies against pmet (Tyr1234/35), pinsr (Tyr1146), pinsr (Tyr1150/51), pirs (Tyr895), pfoxo1 (Ser256 which also cross-reacts with pfoxo4 Ser193), FoxO1, FoxO4, PARP, and Met (25H2) were obtained from Cell Signaling; Met (B2), G6Pase, PEPCK and INSR-beta were from Santa Cruz Biotechnology; IRS1 and -2, β-actin and GLUT-2 were from Millipore; pirs (Tyr612), and pinsr (Tyr972) were from Invitrogen; and py20 was from BD Biosciences. All antibodies were used at the manufacturer s recommended dilution. Protein isolation, SDS PAGE, immunoprecipitation and immunoblot analysis. Protein isolation, SDS-PAGE, immunoprecipitation (IP) and immunoblot (IB) analysis were carried out using standard procedures as previously described 2. Generally, 40 micrograms of protein lysate made in RIPA buffer was subjected to SDS-PAGE. For IP, 1 mg of total protein was incubated with the indicated antibodies. Membranes were probed with primary and corresponding secondary antibodies. Signals were illuminated by the Western Lightning Chemiluminescence Reagent PLUS (Perkin-Elmer) and captured on X-ray film. sirna-mediated knockdown. HepG2 cells were plated at 2 x 10 6 cells in a 100 mm cell culture dish. To knock down endogenous Met expression, 21 base pair doublestranded RNA oligonucleotides specific for Met (Sense: 5 - GGAGGUGUUUGGAAAGAUAtt; Antisense: 5 -UAUCUUUCCAAACACCUCCtg) were obtained from Ambion, Inc. (sirna ID#: 42825) and transfected into cells (100 ng per well) using Silencer siport Amine sirna Transfection kit (Ambion, Inc.). Negative control sirnas purchased from Ambion (#4637) were also transfected (100 ng per well). They consist of 19 bp nontargeting sequences with 3 dt overhangs and have no significant homology to any known gene sequences in mouse, rat, or human. The 11

transfected cells were incubated at 37 C for the indicated time and then harvested for IB analysis. Dominant negative Met expression in vitro. We utilized a Tet-regulated stable Hepa1-6 mouse hepatocytic cell line which expresses a dominant negative (DN-Met) form of Met as previously described 2. These cells were used in numerous experiments with or without doxycycline (i.e. Tet) and with varying treatments of insulin, HGF, and/or both at the indicated concentrations and time points in the figures. Histological studies. Histological analysis was performed on livers as previously described 3. Microarray analysis. Wild type male Balb/c mice (n = 4 per group) were injected systemically with either saline or recombinant human HGF (50 micrograms). Approximately, three hours later animals were sacrificed, RNA from their livers was prepared. Samples were subjected to microarray analyses using an Affymetrix Genechip platform performed by our departmental core facility at the University of Pittsburgh as recommended by the manufacturers and as previously described 4. Statistical analyses. Computations were performed using VassarStat website for statistical computation at http://faculty.vassar.edu/lowry/vassarstats.html and instat-2 software. A P value of 0.05 or less considered significant. 12

SUPPLEMENTARY REFERENCES 1. Hanke, S. & Mann, M. The phosphotyrosine interactome of the insulin receptor family and its substrates IRS-1 and IRS-2. Mol Cell Proteomics 8, 519-534 (2009). 2. Wang, X., et al. A mechanism of cell survival: sequestration of Fas by the HGF receptor Met. Mol Cell 9, 411-421 (2002). 3. Zou, C., et al. Lack of Fas antagonism by Met in human fatty liver disease. Nat Med 13, 1078-1085 (2007). 4. Luo, J.-H., et al. Transcriptomic and genomic analysis of human hepatocellular carcinomas and hepatoblastomas. Hepatology 44, 1012-1024 (2006). 13