The Chimpanzee Model Of HCV: Antiviral Therapy

Transcription

1 The Chimpanzee Model Of HCV: Antiviral Therapy

2 Antiviral Therapies in Chimpanzees PEG IFN + Ribavirin STAT C with DAA Protease Inhibitors Nucleoside analogues Polymerase Inhibitors NS5A Inhibitors Immunomodulators TLR7, TLR9, McAb to cytokines and cytokine receptors Antisense sirna targeting viral RNA Therapeutic vaccines Essential host targets Cyclophilin inhibitors mir122 antisense LNA Entry Inhibitors 4 receptors

3 Design of Antiviral Studies in Chimpanzees Phase I, PK in uninfected animals Dosing, acceptability Serum to liver ratio Phase II, Efficacy in HCV chronic animals, n=2 4 Kinetics of decline of vrna Evolution of resistance mutations Persistence of resistance mutations Dosing limitations Oral: if accepted by chimps indefinite periods, 3 6 months. Tang, Kool Aid, Applesauce (micro encapsulated) Gavage, IV, SQ, IM all require sedation IACUC normally limits study to 5 7 doses with follow up bleeds progressively spaced out Chimps can be trained for oral pills and with some effort for SQ and IM injection

4 STAT-C Therapy in Chimps

5 Abbott A NNI (benzothiadiazine) HCV G1a and 1b infected chimpanzees BID, 14 days Very rapid decline, G1b decrease 2.5 logs in 2 days Rapid emergence of resistance in 1b Day 5, G1b 13% WT; G1a, 74% WT Chen, C.-M. et al Antimicrob. Agents Chemother. 51(12):

6 Efficacy of Protease Inhibitor EA 058 in a Genotype 1a Infected Chimpanzee Dosing period (12.8 mg/kg) BID by oral gavage Viral Load Change From Baseline (Log 10 IU/mL) Last dose All clones wt 46% 1% 1% 5% 6% 11% 10% 20% R155K A156T A156V D168A D168E D168G D168V wt Time (Days) >4 log 10 reduction in viral load after 2 days of treatment Only day 4 contained virus with known resistance mutations; Short term treatment (2 days) did not lead to persistence of resistance mutations Pilot-Matias et al, International Symposium on HCV, Nice France Abbott

7 Viral loads in HCV-infected chimps dosed at 1 mg/kg MK-0608 orally once daily for 37 days 282 mutation observed after dosing for single day in X6 Carroll, S. S. et al Antimicrob. Agents Chemother. 53(3):

8 Bigger et al. J Virol 78: ,2004. HCV Chronic Infection 10 HCV chronics; viremia vary by 1000 fold: 10 4 to 10 7 ge/ml Expression of 971 genes altered at 99% confidence ISG and cytokines also elevated during acute infection Elevated hepatic IFN response persists for decades with little pathology Infected Uninfected Decreased Increased

9 Hepatic ISG Levels Independent of vrna Levels Gene Fold Change Avg fold change vs all 6 baselines ISG IP-10 CXCL ITAC CXCL MXA OAS Animals selected to have 1000 fold variation in viremia Variation in liver ISG response not proportional to viremia; maxed-out Bigger et al. J Virol 78: ,2004.

10 CHIMPANZEE Chimpanzee RESPONSE Response to IFNα Previous studies with Ad gene therapy for IFN failed How many HCV induced genes are ISGs Total genome response to IFN in vivo Single dose induction in 3 uninfected chimpanzees human and chimpanzee IFN tested 5x10 6 IU IFN SQ Liver and PBMC 0, 4, 8, 24 hrs

11 Hepatic ISG Response Rapidly Down-Regulated Ch IFN Fold Change ISG Hu peg-ifn Fold Change >500pg/ml IFN hr post IFN Rapid Down-Regulation of ISG Response in Presence of High IFN Levels Contrasts to lack of down-regulation during acute and chronic infection. Lanford et al, Hepatology 43: , 2006.

12 HCV Chronic Chimps Null IFNα Response 10 9 GE/ml Genotype 3a Genotype 1b Genotype 1a 10 4 Peg IFN hr 8 hr 4 hr -2 wk -4 wk 18 wk 14 wk 13 wk 12 wk 11 wk 10 wk 9 wk 8 wk 6 wk 4 wk 2 wk 1 wk Time After First Dose of IFN Lanford et al, Hepatology 46: , 2007.

13 Fold Change IP-10 Transcription Uninfected HCV Chronic PBMC Fold Increase Liver Fold Increase Hours Post-IFN Hours Post-IFN Lanford et al, Hepatology 46: , 2007.

14 Fold Change IP-10 Transcription Uninfected HCV Chronic PBMC Fold Increase Liver Fold Increase FC vs uninfected FC vs HCV baseline Hours Post-IFN Hours Post-IFN Lanford et al, Hepatology 46: , 2007.

15 Conclusions from IFN Studies ISG response highly elevated in chronic chimpanzee liver May be maximally induced Exogenous IFN does not further induce liver ISG response Chimps maybe be representative of human null responders Humans: two phenotypes high or low ISG prior to therapy low ISG correlates with protective IL28B alleles Potential of antivirals to convert null response phenotype reduced vrna reduce ISGs = responder phenotype? Only 35% of chimps progress to chronic infection, protective allele All chimps examined have high ISG phenotype and lack response to IFN, non protective allele Chimps are not polymorphic at same sites in IL28B as humans

16 Targeting Host Factors for Antiviral Therapy mir122 liver specific mirna 70% of all mirna in liver - 50,000 copies per cell mir122 regulates cholesterol and fatty acid synthesis Jopling et al demonstrated HCV requires mir122 Two mir122 binding sites in 5 NCR, Santaris developed LNA technology mir122 knockdown in vivo in AGM reduced TSC ~40% Potential for HCV therapy

17 5 GUGAGGU GUGAGGU mir 122 CGACACUCCACCAUGAAUCACUCCC HCV SPC3649 treatment UGUUUGUGGUAACAGUGUGAGGU 5 mir122 CcAttGTcAcaCtCC 3 SPC3649 CGACACUCCACCAUGAAUCACUCCC HCV SPC3649: 15-mer high-affinity LNA-antimiR122 (8 LNAs, T m =80 o C, PS backbone)

18 Proof of Concept Study Safety Efficacy Trial in HCV Infected Chimpanzees 4 HCV genotype 1 infected chimpanzees: 2 high dose - 5 mg/kg 2 low dose - 1 mg/kg 4 weeks pre-study 12 weeks IV dosing in saline 14 weeks follow up

19 SPC3649-Prolonged Antiviral Activity HCV VIRAL RNA Total Serum Cholesterol 1.00E+08 GE/ml 1.00E E E E+04 Chnage in TSC E placebo dosing week 2.6-log reduction in HCV RNA No viral rebound during dosing Maximum HCV suppression extended 11 weeks after dosing mir122-lna duplex still present in liver at 14 weeks after dosing Total serum cholesterol reduced by 45%. Lanford et al, Science 327: ,

20 No Selection of Adaptive Changes in mir-122 Seed Matches Clonal and Deep sequencing of high dose animals No increase in nt changes in 5 NCR during dosing

21 Normalization of Hepatic ISG Expression Affymetrix microarray data Supervised analysis of ISGs ISGs decline during treatment or normalize HCV infected chimpanzees are Null responders to IFN Conversion of Null Phenotype to Responder Phenotype

22 CONCLUSIONS SPC3649 provides long term sequestration of mir122. No rebound of virus and no selection of adaptive variants. Very long half life in liver SPC3649 provides a high barrier to resistance. TSC was reduced by up to 44% in chimpanzees and 30% in humans. The ISG response was normalized suggesting the opportunity to more effectively treat IFN null responders.

23 Collaborators Southwest Foundation Deborah Chavez Bernadette Guerra Helen Lee Lena Notvall Yunmi Chung SNPRC Kathleen Brasky DVM Santaris Pharma Lisa Hildebrandt-Eriksen Andreas Petri Sakari Kauppinen Henrik Oerum Stan Lemon Chris Walker Dave Thomas